Bio 1201 Exam 3

In a repressible operon the repressor made in an ______ form.

inactive

If the sequence of nucleotides is GGCCATTA what is the sequence of DNA nucleotides on the complementary strand of DNA? CCGGTAAT GGCCATTA GGCCAUUA CCGGUAAU

CCGGTAAT

Based on the figure below leading strand replication would occur at locations?

II and III

In a repressible operon the repressor made in an ______ form.

Inactive

The Calvin Cycle (dark reactions) occur in the: Cytoplasm Thylakoid Stroma Matrix Space between the membranes

Stroma

When lactose is present the repressor is ___________ to the operator and the DNA _________ transcribed. Bound, is Bound, is not Not bound, is Not bound, is not

Not bound, is

When no tryptophan is present the repressor is ___________ to the operator and the DNA _________ transcribed. Bound, is Bound, is not Not bound, is Not bound, is not

Not bound, is

A mRNA molecule contains 246 nucleotides, what is the maximum number of amino acids in the polypeptide translated from this mRNA? 4 82 246 738 2214

82

The mRNA sequence "GCC" codes for the amino acid? Met Arg Ala More than one None of the above

Ala

What are the inputs to the Calvin Cycles? CO2 ATP NADPH + H+ CO2 and ATP CO2, ATP and NADPH + H+ CO2, ATP, NADPH + H+ and G3P

CO2, ATP and NADPH + H+

Tryptophan is an important amino acid, organisms need a low level all the time. If there is no tryptophan do you want the genes for the enzymes to be "on"

yes

What is/are the outputs of Cyclic Photophosphorylation? G3P NADP+ ATP Oxygen More than one of the above

ATP

A procaryotic operon consists of: Promoter Promoter and Operator Promoter, Operator and Structural Genes none of the above

Promoter, Operator and Structural Genes

Translate the following mRNA, pay attention to the directionality and the start codon 3'AAAAUGAAGUCCCUGGGUAGG Met-Lys-Ser-Leu-Gly-Arg Met-Gly-Pro do not know how to start

Met-Gly-Pro

Translate the following mRNA, pay attention to the directionality and the start codon 5'AAAAUGAAGUAC Met-Lys-Tyr Met-Lys I do not know how to start

Met-Lys-Tyr

What sequence of amino acids would this DNA molecule produce? 3' ATATTTTACAGGTGACGCCAG 5' TATAAAATGTCCACTGCGGTC Tyr-Lys-Met-Ser-Thr-Ala-Val Met-Ser-Thr-Ala-Val Arg-Ser-Tyr

Met-Ser-Thr-Ala-Val

Which codon codes for the amino acid Proline (Pro)? CCU CGA CCG More than one None of the above

More than one

At night which of the following molecules would be excepted to increase in concentration inside stroma of the chloroplast? G3P NADP+ ATP Oxygen

NADP+

When lactose is present the repressor is ___________ to the operator and the DNA _________ transcribed.

Not bound, is

A nitrogenous base is indicated by the letter _____.

c This is a nitrogenous base.

Three identical plates of radish seeds are incubated under three conditions, with results as shown. Their dry weights in increasing order will be: 1, 2, 3 1, 3, 2 3, 2, 1 3, 1, 2

3, 1, 2

What is/are the outputs of Non-cyclic Photophosphorylation? G3P ATP Oxygen NADPH + H+ CO2

ATP Oxygen NADPH + H+

If the sequence ATGCATGTCAATTGA were mutated such that a base were inserted after the first G and the third T were deleted, how many amino acids would be changed in the mutant protein? Two. One. Three. None.

2 The second and third codons in the new sequence are different from the original codons.

Transcribe the DNA sequence shown below. 5' TTAAGGCC answer choices 5' AAUUCCGG 5' TTAAGGCC 5' GGCCUUAA 5' CCGGAATT

5' GGCCUUAA

Where did most of the mass (dry weight) of this tree come from? (Think about photosynthesis).

Air

The mRNA sequence "AGG" codes for the amino acid? Met Arg Ala More than one None of the above

Arg

When no lactose is present the repressor is ___________ to the operator and the DNA _________ transcribed.

Bound, is not

When no lactose is present the repressor is ___________ to the operator and the DNA _________ transcribed. Bound, is Bound, is not Not bound, is Not bound, is not

Bound, is not

When tryptophan is present the repressor is ___________ to the operator and the DNA _________ transcribed. Bound, is Bound, is not Not bound, is Not bound, is not

Bound, is not

Which of the following best describes the light reactions? Conversion of CO2 to Glucose Capture light energy in chemical energy Converts light energy in to Glucose Captures CO2 and converts it into light energy

Capture light energy in chemical energy

Eukaryotic gene regulation occurs at which level/s? Chromosomal Transcriptional Post-Transcriptional Translational Post-Translational Replicational

Chromosomal Transcriptional Post-Transcriptional Translational Post-Translational

One type of chromosomal level gene regulation is: mRNA processing DNA packing cleavage and modification mRNA capping tailing

DNA packing

What are the outputs of the Calvin Cycles? G3P ADP NADP+ G3P and ADP G3P, ADP and NADP+

G3P, ADP and NADP+

Order the flow of electrons in Non-Cyclic photophosphorylation (start to finish)

H20 < Photosystem 2 < Cytochrome Complex < Photosystem 1 < NADPH + H+ < Calvin Cycle (Dark Reactions) < G3P

Order the flow of electrons in Cyclic photophosphorylation (start to finish)

Photosystem 1 < Cytochrome Complex < Photosystem 1 < Cytochrome Complex < Photosystem 1

The cleavage and modification of polypeptides after translation would be considered level gene regulation Chromosomal Transcriptional Post-transcriptional Translational Post-translational

Post-translational

As electrons flow along the thylakoid membrane from PS II to PSI they release energy.

TRUE

If only the reaction center molecules can give up electrons why have so many types of pigments in a photosystem? Antenna Pigments: ~200 Chlorophyll a ~50 Chlorophyll b ~50 other pigments Reaction Center Molecules: Special versions of Chlorophyll a (P700 or P680) To capture a greater range of light energy To capture CO2 To capture H2O

To capture a greater range of light energy

Procaryotic genes are generally regulated by preventing . Replication Mutation Transcription Mitosis Translation

Transcription

Prokaryotic gene regulation occurs at which level/s? Chromosomal Transcriptional Post-Transcriptional Translational Post-Translational Replicational

Transcriptional

Tryptophan is an important amino acid, organisms need a low level all the time. If there is no tryptophan do you want the genes for the enzymes to be "on"

Yes

tRNA molecules have: codons anti-codons carbohydrate attahment sites amino acid attachment sites DNA nucleotides

anti-codons and amino acid attachment sites

In an inducible operon the repressor (alone) ______________ the operator and ____________ transcription. binds to, allows binds to, blocks does not bind to, blocks does not bind to, allows

binds to, blocks

If there is no lactose do you want the genes for the enzymes to be "on"

no

If the repressor molecule is in an active form it binds to the promoter and the genes are:

off

In a repressible operon the signal molecule binds to the repressor and activates the repressor. This turns the genes _____________.

off

If the repressor molecule is in an inactive form it can not bind to the promoter and the genes are:

on

In an inducible operon is the repressor made in an ______ form.

on

In an inducible operon the signal molecule binds to the repressor and inactivates the repressor. This turns the genes _____________.

on

What is the fate of the Oxygen in Water? Does it become part of: Glucose Oxygen New water I never thought about it

oxygen

The human dystrophin gene contains 2.4 million base pairs with 79 exons, while the final (mature) mRNA transcribed from this gene is 14,000 base pairs. What percentage of the DNA in this gene actually codes for the protein? ~0.5% ~2.0% ~5.0% ~25.0%

~0.5%

Based on your knowledge of mRNA processing in eukaryotes the final mature (processed) mRNA would be expect to be ___________________ the original transcript? longer than same length as shorter than

shorter than

In an inducible operon, in the presence of ________________, the structural genes will be transcribed. no external molecule the repressor the inducer the repressor and co-repressor the co-repressor

the inducer

Why regulate gene expression (genes)?

to control the rate of chemical reactions to save energy, by not producing a protein that you don't need at that time to be able to create different cell types within the same organism

In a nucleotide, the nitrogenous base is attached to the sugar's _____ carbon and the phosphate group is attached to the sugar's _____ carbon. 1' ... 2' 2' ... 3' 1' ... 5' 1' ... 3' 2' ... 1'

1' ... 5' The nitrogenous base is attached to the sugar's 1' carbon and the phosphate group is attached to the sugar's 5' carbon.

Based on the figure shown below what would locations A and C be? (3'--A) (B--C) 3' and 5' 3' and 3' 5' and 3' 5' and 5'

5' and 3'

Nucleic acids are assembled in the _____ direction. 5' to 1' 2' to 3' 4' to 5' 5' to 3' 1' to 5'

5' to 3' New nucleotides are added to the 3' end of a growing polynucleotide

The direction of synthesis of an RNA transcript is _____. 1' —> 5' 5' —> 3' 1' —> 3' 3' —> 5' 2' —> 4'

5' —> 3' Nucleotides are added to the 3' end of RNA.

Which of the following statements about mutations is false? An addition mutation results in an added base in the DNA sequence. A deletion mutation results in the loss of a base in the DNA sequence. Addition and deletion mutations disrupt the primary structure of proteins. A knock-out mutation results in a total absence of the mutated protein.

A knock-out mutation results in a total absence of the mutated protein. (A knock-out mutation refers to the loss of a protein's function but not necessarily to its complete absence.)

Transcription begins at a promoter. What is a promoter? A site in DNA that recruits the RNA Polymerase The same as a start codon Part of the RNA molecule itself A site found on the RNA polymerase

A site in DNA that recruits the RNA Polymerase (This is the site where the RNA polymerase must bind to initiate transcription.)

Non-cyclic photophosphorylation produces (outputs)? G3P ATP ATP and NADPH + H+ NADPH + H+ all of the above

ATP and NADPH + H+

If a mutated DNA sequence produces a protein that differs in one central amino acid from the normal protein, which of the following kinds of mutations could have occurred? None. An addition mutation An addition mutation and a deletion mutation. A deletion mutation.

An addition mutation and a deletion mutation if the mutations occur within the same codon, only that codon (amino acid) will be altered. Return to Assignment

Which of these is a tRNA?

B

In the accompanying image, a nucleotide is indicated by the letter _____.

B . B is indicating a single nucleotide.

What determines which base is to be added to an RNA strand during transcription? The previous base Base pairing between the two DNA strands The order of the chemical groups in the backbone of the RNA molecule Base pairing between the DNA template strand and the RNA nucleotides

Base pairing between the DNA template strand and the RNA nucleotides (Transcription involves the formation of an RNA strand that is complementary to the DNA template strand.)

Which of these is(are) pyrimidines?

C, D, and E Pyrimidines are single-ring structures.

What is the basic role of CO2 in photosynthesis? CO2 is taken in by plants as a form of inverse respiration, in which carbon dioxide is "breathed in" and oxygen is "breathed out." CO2 is a source of electrons in the formation of organic molecules. CO2 is fixed or incorporated into organic molecules.

CO2 is fixed or incorporated into organic molecules. Read about the fixation of CO2 in the Calvin cycle.

The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____. CAG CTG GAC CUG TCG

CUG In RNA uracil replaces thymine.

Which of the following is/are an input/s to the Calvin Cycle? Carbon Dioxide ADP NADP+ G3P Glucose

Carbon Dioxide

Which of the following is/are inputs required for photosynthesis? Oxygen Carbon Dioxide NADH + H+ Glucose more than one of the above

Carbon Dioxide

Which of the following terms best describes the relationship between the newly synthesized RNA molecule and the DNA template strand? Complementary Permanently base-paired Covalently bound Identical

Complementary (Because the template strand determines the nucleotides to be added to the RNA strand, using the same complementarity rules of the DNA, they will be complementary to each other.)

How are genes coordinately controlled in eukaryotic cells? Coordinately controlled genes in eukaryotic cells share a set of control elements. Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals. Coordinately controlled genes in eukaryotic cells are located together on the same chromosome.

Coordinately controlled genes in eukaryotic cells share a set of control elements. Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals. (In eukaryotes, specific transcription factors bind to control elements, promoting transcription of coordinately controlled genes, even if the genes are on separate chromosomes. Read about coordinately controlled genes in eukaryotes.)

Which of these is a regulatory gene?

D . The regulatory gene is not a part of the operon.

In the diagram below, the two blue strands represent _____. RNA DNA transcription factors RNA polymerase the promoter

DNA (DNA is a double helix.)

Which of these is a difference between a DNA and an RNA molecule? DNA contains uracil, whereas RNA contains thymine. DNA is usually double-stranded, whereas RNA is usually single-stranded. DNA contains five-carbon sugars, whereas RNA contains six-carbon sugars. DNA contains nitrogenous bases, whereas RNA contains phosphate groups. DNA is a polymer composed of nucleotides, whereas RNA is a polymer composed of nucleic acids.

DNA is usually double-stranded, whereas RNA is usually single-stranded. With some exceptions, DNA is a double-stranded molecule and RNA is a single-stranded molecule.

During DNA replication the enzyme responsible for making the DNA strand is: RNA polymerase topoisomerase SSB protein DNA polymerase helicase

DNA polymerase

What catalyzes DNA synthesis? dNTPs DNA polymerase Replication fork Primer

DNA polymerase (This enzyme catalyzes DNA synthesis.)

Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments? the replication forks block the formation of longer strands DNA polymerase can assemble DNA only in the 5' to 3' direction only short DNA sequences can extend off the RNA primers it is more efficient than assembling complete new strands DNA polymerase can assemble DNA only in the 3' to 5' direction

DNA polymerase can assemble DNA only in the 5' to 3' direction Since DNA polymerase can assemble DNA only in the 5' to 3' direction, the new strand complementary to the 3' to 5' strand must be assembled either in short 5' to 3' segments, which are later joined together by ligase, or be assembled continuously.

If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred? Both addition and deletion. Addition. Deletion. None.

Deletion The original sequence has lost the base C.

A researcher isolates a chloroplast and decreases the pH inside the individual thylakoids. Assuming that there is abundant light energy and CO2 and that there are no other changes to this chloroplast indicate whether the following statement if True or False. This chloroplast will produce more G3P or glucose than a control chloroplast under the same light and CO2 conditions

FALSE

True or false? A codon is a group of three bases that can specify more than one amino acid.

FALSE A codon is a group of three bases that can specify only one amino acid.

Select the correct molecule that is the main product of the Calvin cycle. Glucose NADPH G3P

G3P Glucose is discussed as the product of photosynthesis primarily for convenience. In fact, very little free glucose is produced by or transported from photosynthetic cells. Read about the Calvin cycle.

Which of these correctly illustrates the pairing of DNA and RNA nucleotides? GTTACG CAATCG GTTACG CAAUGC GTTACG GTTACG GTTACG ACCGTA GTTACG UAACAU

GTTACG CAAUGC . (b) In RNA, uracil takes the place of thymine.

In DNA which nitrogenous base would pair with cytosine? Thymine Adenine Uracil Guanine

Guanine

Which statement(s) about inducible operons is/are correct? In an inducible operon, the repressor is synthesized in an active form. In an inducible operon, an inducer inactivates the repressor. Inducible enzymes generally function in synthetic pathways that produce end products from raw materials.

In an inducible operon, the repressor is synthesized in an active form. In an inducible operon, an inducer inactivates the repressor. (An inducible operon is usually off but can be turned on when an inducer interacts with and inactivates the repressor. The enzymes in an inducible operon generally function in catabolic pathways. Read about inducible operons.)

What happens to RNA polymerase II after it has completed transcription of a gene? It is degraded. It begins transcribing the next gene on the chromosome. It joins with another RNA polymerase to carry out transcription. It is free to bind to another promoter and begin transcription.

It is free to bind to another promoter and begin transcription. (The enzyme is free to transcribe other genes in the cell.)

The operon model of the regulation of gene expression in bacteria was proposed by _____. Watson and Crick Franklin Darwin Jacob and Monod Mendel

Jacob and Monod In 1961 Jacob and Monod proposed the operon model of gene regulation.

Which of the following molecules is the primary product of photosystem I? ATP Carbon dioxide Oxygen NADPH

NADPH The NADPH produced by photosystem I is used to supply energy for the production of sugars during photosynthesis.

In eukaryotes the mRNA must be processed prior to translation. Where does this mRNA processing occur? ribosome peroxisome Nucleus Golgi Complex ER

Nucleus

In a repressible operon the signal molecule binds to the repressor and activates the repressor. This turns the genes _____________.

Off

Which mutation(s) would not change the remainder of the reading frame of a gene sequence that follows the mutation(s)? One addition mutation. One addition and one deletion mutation. One deletion mutation. One addition and two deletion mutations.

One addition and one deletion mutation. (This combination results in no net change in the number of bases, so the reading frame would eventually be restored.)

DNA does not store the information to synthesize which of the following? DNA Messenger RNA Proteins Organelles

Organelles (Synthesis of organelles is not directly coded in the DNA.)

The initiator tRNA attaches at the ribosome's _____ site. A translocation E P Q

P The initiator tRNA attaches to the ribosome's P site.

Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis? Sugar Free 3' hydroxyl (-OH) group Phosphate groups Base

Phosphate groups (The potential energy stored in the bonds of the phosphates provides the energy for DNA synthesis.)

Which process produces oxygen?

Photosynthesis Oxygen is a by-product of the photosynthetic process.

Which of the following enzymes creates a primer for DNA polymerase? Topoisomerase Primase Ligase Helicase

Primase (This RNA polymerase synthesizes an RNA primer antiparallel to the template DNA strand.)

Which of the following statements about DNA synthesis is true? Nucleotides are added in a random fashion to single-stranded DNA. As DNA polymerase moves along the template strand, each new nucleotide provides a 5' hydroxyl group for the next reaction to occur. Primers are short sequences that allow the initiation of DNA synthesis. DNA polymerase adds dNTP monomers in the 3' to 5' direction.

Primers are short sequences that allow the initiation of DNA synthesis. (When a primer is added to a single strand of DNA, DNA polymerase can start adding nucleotides to synthesize a complementary strand.)

In the diagram below, the gray unit represents _____. RNA DNA transcription factors RNA polymerase the promoter

RNA polymerase (RNA polymerase untwists a portion of the DNA double helix.)

The synthesis of a new strand begins with the synthesis of a(n) _____. RNA primer complementary to a preexisting DNA strand single-strand binding protein poly(A) tail Okazaki fragment short pieces of DNA

RNA primer complementary to a preexisting DNA strand The synthesis of a DNA strand begins with the formation of an RNA primer.

What is the function of a spliceosome? protein activation translation protein degradation regulating the transport of mRNA to the cytoplasm RNA processing

RNA processing (Spliceosomes are involved in RNA processing.)

Which statement(s) about repressible operons is/are correct? In a repressible operon, the repressor is synthesized in an active form. Repressible operons usually contain genes that code for anabolic enzymes. A repressible operon is on unless a co-repressor is present.

Repressible operons usually contain genes that code for anabolic enzymes. A repressible operon is on unless a co-repressor is present. (A repressible operon is usually on but can be turned off when a co-repressor interacts with and activates the repressor. The enzymes in an inducible operon generally function in anabolic pathways. Read about repressible operons.)

Which molecule is regenerated in the regeneration phase of the Calvin cycle? Without regeneration of this molecule, the Calvin cycle would stop. RuBP 3-phosphoglycerate ATP G3P

RuBP The regeneration of RuBP ensures that the Calvin cycle can proceed indefinitely, since RuBP fixes carbon dioxide into an organic molecule that is used to produce sugar.

The Calvin Cycle occurs in the Matrix Stroma Cytoplasm

Stroma

True or false? Single-stranded DNA molecules are said to be antiparallel when they are lined up next to each other but oriented in opposite directions.

TRUE When the 3' end of one DNA strand points in the same direction as the 5' end of the other DNA strand, the strands are said to be antiparallel.

Select the most accurate statement describing the basic function of the light reactions of photosynthesis. The basic function of the light reactions of photosynthesis is the conversion of solar energy to chemical energy. The basic function of the light reactions of photosynthesis is the trapping of light energy. The basic function of the light reactions of photosynthesis is the production of glucose.

The basic function of the light reactions of photosynthesis is the conversion of solar energy to chemical energy. Read about the light reactions of photosynthesis.

Which set of reactions uses H2O and produces O2?

The light-dependent reactions The light-dependent reactions use H2O and produce O2.

Which of the following statements best describes the relationship between the light-dependent and light-independent reactions of photosynthesis? The light-independent reactions release energy, and the light-dependent reactions require energy. The light-dependent reactions pass electrons through an electron transport chain to the light-independent reactions. The light-dependent reactions produce carbon dioxide, which is then used by the light-independent reactions. The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions.

The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions. Light energy drives the formation of ATP and NADPH during the light-dependent reactions; these energy molecules are then used during the light-independent reactions to form sugars.

What is the importance of the light-independent reactions in terms of carbon flow in the biosphere? The light-independent reactions turn glucose, a sugar, into CO2 gas. The light-independent reactions turn CO2, a gas, into usable carbon in the form of sugars. The light-independent reactions turn sugar into ATP for energy. The light-independent reactions use CO2 to make ATP.

The light-independent reactions turn CO2, a gas, into usable carbon in the form of sugars. CO2 is unusable until plants have "fixed" this carbon into sugar.

Which of the following statements best describes the promoter of a protein-coding gene? The promoter is a site at which only RNA polymerase will bind. The promoter is part of the RNA molecule itself. The promoter is a nontranscribed region of a gene. The promoter is a site found on RNA polymerase.

The promoter is a nontranscribed region of a gene. (The promoter is the regulatory region of a protein-coding gene at which RNA polymerase must bind to initiate transcription—it is not transcribed into the RNA.)

Which of the following statements about Okazaki fragments in E. coli is true? They are usually 50 to 500 bases long. They are formed on the lagging strand of DNA. They are sealed together by the action of helicase. They are synthesized in the 3' to 5' direction.

They are formed on the lagging strand of DNA. (While DNA is synthesized continuously on the leading strand, Okazaki fragments are formed on the lagging strand because DNA synthesis always proceeds in the 5' to 3' direction.)

What is the biological significance of the light-independent reactions of photosynthesis? They convert carbon dioxide to sugar. They generate ATP and NADPH. They make oxygen. They convert ATP to sugar.

They convert carbon dioxide to sugar. All organisms use the sugars produced by photosynthesis to generate energy.

Which of the following enzymes is important for relieving the tension in a helix as it unwinds during DNA synthesis? Single-strand binding proteins Topoisomerase Ligase Helicase

Topoisomerase (This enzyme untwists the coils that occur in the DNA as it is being unwound into a single-stranded template.)

What is the process called that converts the genetic information stored in DNA to an RNA copy? Translocation Translation Replication Transcription

Transcription DNA is transcribed to give an RNA copy.

Based on the preceding two questions indicate whether the following statement is True or False. If the researcher also increased the concentration of NADPH +H+ in the stroma of the experimental chloroplast, but not the control, the experimental chloroplast would produce more G3P or glucose.

True

Based on the previous question indicate whether the following statement is True or False. The experimental chloroplast will produce more ATP than the control chloroplast.

True

Below you will find a DNA sequence and the amino acid sequence that it produces. There is also a nucleotide sequence containing a mutation in the DNA. Amino Acid Sequence GGLAFRVF Original DNA GGTGGCCTGGCCTTCCGAGTCTT Mutated DNA GGTGGCCTGGCCTTCCAAGTCTT Using this information determine if the following statement is true or false. The mutation is a "base substitution"

True

True or false? The light-dependent reactions of photosynthesis use water and produce oxygen.

True The water molecules are split to replenish electrons in photosystem II, leaving behind protons, which are used to generate a proton gradient for the formation of ATP, and oxygen, which is released as a by-product.

During RNA processing a(n) _____ is added to the 3' end of the RNA. 3' untranslated region a long string of adenine nucleotides 5' untranslated region coding segment modified guanine nucleotide

a long string of adenine nucleotides (A poly-A tail is added to the 3' end of the RNA.)

What enzyme catalyzes the attachment of an amino acid to tRNA? aminoacyl-tRNA synthetase rubisco dextrinase argininosuccinate lyase nuclease

aminoacyl-tRNA synthetase This enzyme matches a particular tRNA with a particular amino acid.

Translation occurs in the _____. cytoplasm lysosome nucleus Golgi apparatus nucleoplasm

cytoplasm (Ribosomes, the sites of translation, are found in the cytoplasm.)

After DNA replication is completed, _____. there are four double helices one DNA double helix consists of two old strands and one DNA double helix consists of two new strands each of the four DNA strands consists of some old strand parts and some new strand parts each new DNA double helix consists of one old DNA strand and one new DNA strand each new DNA double helix consists of two new strands

each new DNA double helix consists of one old DNA strand and one new DNA strand DNA replication is semiconservative.

The RNA segments joined to one another by spliceosomes are _____. caps exons snRNPs tails introns

exons (Exons are expressed regions.)

The first step in the replication of DNA is catalyzed by _____. DNA polymerase single-strand binding protein helicase primase ligase

helicase The first step of DNA replication is unwinding the DNA double helix.

What is the name of the process shown in the diagram? initiation (of transcription) RNA processing initiation (of translation) elongation termination (of translation)

initiation (of translation)

During the editing of the initial transcript in a eukaryote what is removed from the sequence? rRNA nucleotides DNA nucleotides tRNA nucleotides introns exons

introns

Part of the coding region for a piece of DNA is shown below 5' CTAGGGCAT what is the correct sequence of amino acids produced by this DNA? The choices are listed beginning with the first amino acid added to the polypeptide. asp-pro-val met-pro-trp tyr-gly-ile leu-gly-leu met-pro

met-pro

During RNA processing a(n) _____ is added to the 5' end of the RNA. 3' untranslated region a long string of adenine nucleotides 5' untranslated region coding segment modified guanine nucleotide

modified guanine nucleotide (The 5' cap consists of a modified guanine nucleotide.)

Hydrogen bonds must be broken during the process of DNA replication. These bonds occur between? phosphates sugars nitrogenous bases sugar and phosphate groups

nitrogenous bases

In the presence of a regulatory protein the lac operon is _____. transcribed not transcribed transcribed at a faster than usual rate is turned on either transcribed or not transcribed

not transcribed The regulatory protein of the lac operon is a repressor.

This is an image of a(n) _____. nucleic acid thiol nucleotide amino acid none of the above

nucleotide Nucleotides are composed of a pentose sugar, a nitrogenous base, and a phosphate group.

The letter A indicates a _____. phosphate group nitrogenous base nucleotide sugar none of the above

phosphate group Phosphate groups contain phosphorus..

Enzyme complexes that break down protein are called _____. lipases ubiquitins amylase proteasomes nucleases

proteasomes (Proteasomes are enzyme complexes that break down proteins.)

Translation uses the information in mRNA to guide the synthesis of tRNA rRNA DNA protein mRNA

protein

Protein-phosphorylating enzymes' role in the regulation of gene expression involves _____. protein activation translation protein degradation regulating the transport of mRNA to the cytoplasm RNA processing

protein activation(Proteins are often activated by phosphorylation.)

The nuclear membrane's role in the regulation of gene expression involves _____. protein activation translation protein degradation regulating the transport of mRNA to the cytoplasm RNA processing

regulating the transport of mRNA to the cytoplasm (This is the role of the nuclear membrane in the regulation of gene expression.)

Which of these is NOT a component of the lac operon? lactose-utilization genes only promoter only regulatory gene only operator only promoter and operator

regulatory gene only The regulatory gene, while not a part of the operon, plays a role in regulating the expression of the genes of the operon.

The action of helicase creates _____. primers and replication bubbles replication forks and replication bubbles primers and DNA fragments DNA fragments and replication forks DNA fragments and replication bubbles

replication forks and replication bubbles A replication fork is the transition region between paired and unpaired DNA strands.

Spliceosomes are composed of _____. small RNAs and proteins polymerases and ligases introns and exons the RNA transcript and protein

small RNAs and proteins Spliceosomes are complexes composed of small RNAs and proteins.

You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a _____. phosphate group, not a uracil thymine nitrogenous base, not a uracil nitrogenous base sugar with two, and not three, oxygen atoms double-stranded molecule, not a single-stranded molecule uracil nitrogenous base, not a thymine nitrogenous base

sugar with two, and not three, oxygen atoms DNA nucleotides are composed of deoxyribose sugars, whereas RNA nucleotides are composed of ribose sugars.

The backbone of a DNA strand is composed of nucleotides sugar-sugar bonds sugar-phosphate bonds phosphate-phosphate bonds

sugar-phosphate bonds

An old DNA strand is used as a _____ for the assembly of a new DNA strand. template model complement source of nucleotides primer

template An old DNA strand is used as a template for the synthesis of a complementary new strand.

Regulatory proteins bind to _____. the operator the lactose-utilization genes the regulatory gene RNA polymerase transcription factors

the operator Transcription is inhibited when a regulatory protein binds to the lac operon operator.

In the diagram below, the green unit represents _____. RNA DNA transcription factors RNA polymerase the promoter

the promoter (The promoter is the region of DNA at which the process of transcription begins.)

Which of these nitrogenous bases is found in DNA but not in RNA?

thymine DNA contains thymine; RNA does not.

In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand. guanine ... adenine thymine ... cytosine cytosine ... uracil uracil ... cytosine cytosine ... thymine

thymine ... cytosine This is referred to as specific base pairing.

In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand. cytosine ... thymine cytosine ... uracil uracil ... cytosine thymine ... cytosine guanine ... adenine

thymine ... cytosine This is referred to as specific base pairing.

During transcription the mRNA strand is produced anti-parallel to the template DNA strand.

true