Bio - Mitosis and DNA Replication Review

Metaphase

Chromosomes line up along the equator of the cell

B

Cytokinesis in plant cells occurs by means of a cleavage furrow. A) True B) False

Pyrimidines

Cytosine and thymine

Nucleotide

DNA is a polymer, which means that it is made up of many repeating single units (monomers). What are the monomers called?

B

DNA replication occurs in mitosis. A) True B) False

Hershey and Chase

Determined that DNA not proteins were the genetic material in cells

Cytokinesis

Division of the cytoplasm at the end of mitosis

Mitosis

Division of the nucleus

Prophase

During which stage of a cell's cycle do the replicated chromosomes thicken and become visible?

Cleavage furrows

Form in animal cells during telophase

Cell plates

Form in plant cells during telophase

Centriole

Found in animal cells only; form spindle fibers

Nucleotide

Made of sugar, phosphate group, and a nitrogen base

A

Mitosis and cytoplasmic division result in the formation of two genetically identical cells. A) True B) False

Binary fission

Mitosis in bacteria and other unicellular organisms

Vegetative propagation

Mitosis in plant cells

Nucleotides

Monomers of DNA

Deoxyribonucleic acid

Name of DNA

46

Number of chromosomes in a normal human cell

2

Number of hydrogen bonds between A and T

3

Number of hydrogen bonds between G and C

Guanine

Pairs with cytosine

Sugar and phosphate group

The backbone of the DNA molecule is made up of two components, what are these?

Hydrogen

The bases are paired by ______ bonds along the axis of the molecule.

A

The cell cycle is regulated by checkpoints during the _______ phases. A) G1, S and G2 B) G1, S and C C) G1, G2, and M D) G1, S and M E) G1, S, G2 and M

Sister chromatid

The copy of an original chromatid

Adenine and guanine

The two bases that are purines are:

A

After cytokinesis, the cell enters the G1 phase. A) True B) False

A

A eukaryotic cell that receives a "go-ahead" signal at the G1 checkpoint of the cell cycle will A) complete the cycle and divide. B) move directly into the M phase. C) move directly into the G2 phase. D) enter a resting stage. E) stop growing.

Sugar

Are the nitrogen bases attached to the sugar or the phosphate group?

Adenine, thymine, guanine, cytosine

Based on this information, scientists could predict that the base ______ pairs with ______ and the base ______ pairs with ______ in the formation of the DNA molecule.

B

Centromeres divide during metaphase. A) True B) False

Adenine, thymine, guanine, cytosine

Chargoff's rule states that the DNA of any species contains equal amounts of ______ and ______ and also equal amounts of ______ and ______.

Purines

Guanine and adenine

True

Hershey and Chase labeled the phage DNA with radioactive ³²P. True or false?

Chargaff

His law is A=T and C=G; A+T does not equal C+G

Centromere

Holds sister chromatid together during mitosis

D

If ³⁵S was found in progeny phases rather than ³²P, Hershey and Chase would have concluded that: A) Proteins contain phosphorus B) DNA contains sulfur C) Phage DNA enters the host cell D) Phage protein enters the host cell E) Phage can kill the E. coli cell

Centrioles, no

In animal cell, which structure is thought to produce the spindle fibers that help separate the sister chromatids during anaphase? Is this structure found in plant cells

B

In the Hershey and Chase experiment, radioactively-labeled: A) ³²P did not enter the cell B) ³²P remained inside the cells after vigorous shaking C) ³²P was removed from the cells by vigorous shaking D) ³²P and ³⁵S remained inside the cells after vigorous shaking E) ³²P and ³⁵S were removed from the cells after vigorous shaking

Interphase

Includes G1, S, and G2

Checkpoint

Occurs at the end of G1 and G2 to make sure the cell can divide

Adenine

Pairs with thymine

Backbone

Part of DNA made of sugar and phosphate groups

Synthesis

Part of interphase when DNA replicates

Prophase

Phase when the nuclear membrane disappears

Telophase

Phase when the nuclear membrane reappears

A

Preparation for cell division occurs in the G2 phase. A) True B) False

Watson and Crick

Scientists who won Nobel Prize for DNA structure

Double helix

Shape of a DNA molecule

Anaphase

Sister chromatids are pulled apart

Wilkins and Franklin

Studied the structure of DNA using x-ray chromatography

D

The division of the cytoplasm is called A) synapsis. B) mitosis. C) meiosis. D) cytokinesis. E) cytogenetics.

C

The mitotic spindle fibers attach to chromosomes via special structures termed A) centrioles. B) asters. C) kinetochores. D) centrosomes. E) keratins.

True

The phage used in the experiment consisted of a DNA molecule surrounded by a protein coat. True or false?

E

The success of DNA replication is assessed during the ______ phase. A) G1 B) M C) C D) S E) G2

Thymine and cytosine

The two bases that are pyrimidines are:

Adenine, thymine, cytosine, guanine

There are four different variations of these monomers (four different bases), what are the names of those bases?

Two, one

These bases are of two different types of molecules: purines and pyrimidines. Purines have _____ ring(s) in their structure, and pyrimidines have _____ ring(s) in their structure.

Opposite

This is called complementary base pairs. Thus one strand of DNA is complementary to the other strand (opposite/matching).

Watson and Crick

Two scientists were given credit for discovering the structure of DNA. What is the name of these two scientists?

Hydrogen

Type of bond that holds the bases together in the ladder

Daughter

Type of cells formed during mitosis

Stem cells

Undifferentiated body cells found in embryos and bone marrow

Deoxyribonucleic acid

What do the letters DNA stand for?

A

What part of the phage entered the bacterial cell following infection? A) DNA B) RNA C) Protein coat D) The entire phage E) No part

D

Which of the following events do NOT occur in prophase of mitosis? A) DNA condenses to form chromosomes B) nuclear membrane breaks down C) nucleolus breaks down D) chromosomes are replicated E) mitotic spindle begins to form

B

Which of the following represents the correct order of the phases of mitosis? A) prophase -> anaphase -> metaphase -> telophase B) prophase -> metaphase -> anaphase -> telophase C) prophase -> metaphase -> telophase -> anaphase D) metaphase -> prophase -> telophase -> anaphase E) metaphase -> prophase -> anaphase -> telophase

C

Which of the following represents the correct order of the phases of the cell cycle? A) G1 -> G2 -> S -> M B) G1 -> G2 -> M -> S C) G1 -> S -> G2 -> M D) G1 -> S -> M -> G2 E) G1 -> M -> G2 -> S

C

Which of the following statements about microtubules during anaphase is TRUE? A) those attached to chromosomes elongate, while those that are unattached shorten B) those attached to chromosomes shorten, while those that are unattached elongate C) both attached and unattached microtubules shorten D) both attached and unattached microtubules elongate E) both attached and unattached microtubules elongate at first and then shorten

X-ray chromatography, double helix

Wilkins and Franklin studied the structure of DNA using _____, a technique to examine molecules, and helped Watson and Crick determine the shape of a molecule was _____ _____.

TTAAGCGGCCATAATCTGCAA

Write the complementary sequence to the following DNA strand. AATTCGCCGGTATTAGACGTT