Bio - Mitosis and DNA Replication Review
Metaphase
Chromosomes line up along the equator of the cell
B
Cytokinesis in plant cells occurs by means of a cleavage furrow. A) True B) False
Pyrimidines
Cytosine and thymine
Nucleotide
DNA is a polymer, which means that it is made up of many repeating single units (monomers). What are the monomers called?
B
DNA replication occurs in mitosis. A) True B) False
Hershey and Chase
Determined that DNA not proteins were the genetic material in cells
Cytokinesis
Division of the cytoplasm at the end of mitosis
Mitosis
Division of the nucleus
Prophase
During which stage of a cell's cycle do the replicated chromosomes thicken and become visible?
Cleavage furrows
Form in animal cells during telophase
Cell plates
Form in plant cells during telophase
Centriole
Found in animal cells only; form spindle fibers
Nucleotide
Made of sugar, phosphate group, and a nitrogen base
A
Mitosis and cytoplasmic division result in the formation of two genetically identical cells. A) True B) False
Binary fission
Mitosis in bacteria and other unicellular organisms
Vegetative propagation
Mitosis in plant cells
Nucleotides
Monomers of DNA
Deoxyribonucleic acid
Name of DNA
46
Number of chromosomes in a normal human cell
2
Number of hydrogen bonds between A and T
3
Number of hydrogen bonds between G and C
Guanine
Pairs with cytosine
Sugar and phosphate group
The backbone of the DNA molecule is made up of two components, what are these?
Hydrogen
The bases are paired by ______ bonds along the axis of the molecule.
A
The cell cycle is regulated by checkpoints during the _______ phases. A) G1, S and G2 B) G1, S and C C) G1, G2, and M D) G1, S and M E) G1, S, G2 and M
Sister chromatid
The copy of an original chromatid
Adenine and guanine
The two bases that are purines are:
A
After cytokinesis, the cell enters the G1 phase. A) True B) False
A
A eukaryotic cell that receives a "go-ahead" signal at the G1 checkpoint of the cell cycle will A) complete the cycle and divide. B) move directly into the M phase. C) move directly into the G2 phase. D) enter a resting stage. E) stop growing.
Sugar
Are the nitrogen bases attached to the sugar or the phosphate group?
Adenine, thymine, guanine, cytosine
Based on this information, scientists could predict that the base ______ pairs with ______ and the base ______ pairs with ______ in the formation of the DNA molecule.
B
Centromeres divide during metaphase. A) True B) False
Adenine, thymine, guanine, cytosine
Chargoff's rule states that the DNA of any species contains equal amounts of ______ and ______ and also equal amounts of ______ and ______.
Purines
Guanine and adenine
True
Hershey and Chase labeled the phage DNA with radioactive ³²P. True or false?
Chargaff
His law is A=T and C=G; A+T does not equal C+G
Centromere
Holds sister chromatid together during mitosis
D
If ³⁵S was found in progeny phases rather than ³²P, Hershey and Chase would have concluded that: A) Proteins contain phosphorus B) DNA contains sulfur C) Phage DNA enters the host cell D) Phage protein enters the host cell E) Phage can kill the E. coli cell
Centrioles, no
In animal cell, which structure is thought to produce the spindle fibers that help separate the sister chromatids during anaphase? Is this structure found in plant cells
B
In the Hershey and Chase experiment, radioactively-labeled: A) ³²P did not enter the cell B) ³²P remained inside the cells after vigorous shaking C) ³²P was removed from the cells by vigorous shaking D) ³²P and ³⁵S remained inside the cells after vigorous shaking E) ³²P and ³⁵S were removed from the cells after vigorous shaking
Interphase
Includes G1, S, and G2
Checkpoint
Occurs at the end of G1 and G2 to make sure the cell can divide
Adenine
Pairs with thymine
Backbone
Part of DNA made of sugar and phosphate groups
Synthesis
Part of interphase when DNA replicates
Prophase
Phase when the nuclear membrane disappears
Telophase
Phase when the nuclear membrane reappears
A
Preparation for cell division occurs in the G2 phase. A) True B) False
Watson and Crick
Scientists who won Nobel Prize for DNA structure
Double helix
Shape of a DNA molecule
Anaphase
Sister chromatids are pulled apart
Wilkins and Franklin
Studied the structure of DNA using x-ray chromatography
D
The division of the cytoplasm is called A) synapsis. B) mitosis. C) meiosis. D) cytokinesis. E) cytogenetics.
C
The mitotic spindle fibers attach to chromosomes via special structures termed A) centrioles. B) asters. C) kinetochores. D) centrosomes. E) keratins.
True
The phage used in the experiment consisted of a DNA molecule surrounded by a protein coat. True or false?
E
The success of DNA replication is assessed during the ______ phase. A) G1 B) M C) C D) S E) G2
Thymine and cytosine
The two bases that are pyrimidines are:
Adenine, thymine, cytosine, guanine
There are four different variations of these monomers (four different bases), what are the names of those bases?
Two, one
These bases are of two different types of molecules: purines and pyrimidines. Purines have _____ ring(s) in their structure, and pyrimidines have _____ ring(s) in their structure.
Opposite
This is called complementary base pairs. Thus one strand of DNA is complementary to the other strand (opposite/matching).
Watson and Crick
Two scientists were given credit for discovering the structure of DNA. What is the name of these two scientists?
Hydrogen
Type of bond that holds the bases together in the ladder
Daughter
Type of cells formed during mitosis
Stem cells
Undifferentiated body cells found in embryos and bone marrow
Deoxyribonucleic acid
What do the letters DNA stand for?
A
What part of the phage entered the bacterial cell following infection? A) DNA B) RNA C) Protein coat D) The entire phage E) No part
D
Which of the following events do NOT occur in prophase of mitosis? A) DNA condenses to form chromosomes B) nuclear membrane breaks down C) nucleolus breaks down D) chromosomes are replicated E) mitotic spindle begins to form
B
Which of the following represents the correct order of the phases of mitosis? A) prophase -> anaphase -> metaphase -> telophase B) prophase -> metaphase -> anaphase -> telophase C) prophase -> metaphase -> telophase -> anaphase D) metaphase -> prophase -> telophase -> anaphase E) metaphase -> prophase -> anaphase -> telophase
C
Which of the following represents the correct order of the phases of the cell cycle? A) G1 -> G2 -> S -> M B) G1 -> G2 -> M -> S C) G1 -> S -> G2 -> M D) G1 -> S -> M -> G2 E) G1 -> M -> G2 -> S
C
Which of the following statements about microtubules during anaphase is TRUE? A) those attached to chromosomes elongate, while those that are unattached shorten B) those attached to chromosomes shorten, while those that are unattached elongate C) both attached and unattached microtubules shorten D) both attached and unattached microtubules elongate E) both attached and unattached microtubules elongate at first and then shorten
X-ray chromatography, double helix
Wilkins and Franklin studied the structure of DNA using _____, a technique to examine molecules, and helped Watson and Crick determine the shape of a molecule was _____ _____.
TTAAGCGGCCATAATCTGCAA
Write the complementary sequence to the following DNA strand. AATTCGCCGGTATTAGACGTT
