BIOL 2051 - Exam 3

Automated sequencing techniques require only one lane on an electrophoresis gel rather than four. What is one method that makes this possible?

Each base is identified with a different fluorescent color.

is secreted in mucus and digests bacterial cell walls.

Lysozyme

Where is the site of Shigella attachment in the host?

M cells

ingest a range of pathogens found in a wide variety of tissues and are often the first defensive cells to interact with pathogens.

Macrophages

granulocytes can trigger inflammation and are often involved in allergic responses.

Mast cell

Which of these organisms is likely to have the largest genome?

a yeast cell

The process by which a phagocyte moves toward a chemical signal at the site of an infection is called

chemotaxis.

Virulence factors that enhance invasiveness of a pathogen can include __________.

coagulase exotoxins collagenase

When a known single-stranded DNA probe is mixed with unknown nucleic acid sequences to look for similarity, it is called __________.

hybridization

Which of the following is another term for antibodies?

immunoglobins

the study of all of the genetic material of all organisms in a particular habitat.

metagenonics

If a researcher wanted to compare the enzymatic capacity to degrade compounds in a water column at various depths under a specific set of conditions, which would be the most useful approach?

metaproteomics

Sequencing an organism's genome often leads to identification of hypothetical proteins, which are characterized as __________.

proteins that likely exist though their function is unknown

the study of all of the proteins produced by an organism.

proteomics

What are the four main characteristics of inflammation?

redness, heat, swelling, and pain

Genetically engineered vaccines can be created by __________.

removing virulence genes from a pathogen purifying a specific subunit of a pathogen adding virulence genes from a pathogen to a non-virulent organism

Plasmids are commonly used as cloning vectors because __________.

they can replicate independently of the chromosome they can contain genes for antibiotic resistance used for plasmid selection they are easily inserted into cells by transformation

Which of the following is NOT included in the genome? A) coding regions of DNA B) genes that encode RNAs C) proteins D) noncoding regions of DNA

proteins

All AB toxins have which of the following?

2 subunits

In which direction does DNA polymerase synthesize the new DNA strand?

5' to 3'

What is the temperature used for the extension step?

72 C

What is the sequence of the temperatures of a typical PCR reaction?

94 °C, 60 °C, 72 °C

What method of mutagenesis would be best to determine if a gene is essential for a prokaryote?

cassette mutagenesis

clumps pathogens in networks of fibers.

AB peptide

Which of the following is an example of a barrier defense that forms part of the innate immunity of vertebrates?

Acidity in the stomach kills many microbes.

Which of the complement pathways employs properdin?

Alternative pathway

A response that is uniquely directed against pathogenic Bordetella pertussis would involve what component?

Antibodies

Why is the spleen considered a secondary lymphoid organ?

B and T lymphocytes migrate to the spleen.

leukocytes mature in the bone marrow and give rise to plasma cells, which produce antibodies.

B cell

Which domain of the A-B toxin binds to cell surface receptors on the host cell?

B domain

Restriction endonucleases are found in nature. They are extremely useful for genetic engineering. Why do organisms produce them?

Because they cut only at specific sequences in DNA, they are useful in cutting harmful DNA (such as viral DNA) without harming the organism that produces them (which can protect those sequences in its own DNA).

In the classical pathway, which of the following directly activates cellular responses?

C3a, C5a, and C5bC6C7

Which complement protein is used as an opsonin?

C3b

The absence of C5 means that the molecule is not present to be activated. What happens in normal serum when C5 is "activated"?

C3b splits C5 into two fragments, C5a and C5b.

Fragment C5b initiates the binding of the terminal complement proteins that form the membrane-attack complex (MAC). Which of these proteins associates with the MAC?

C7

Which of the following can release histamines?

Cells from damaged tissues and the complement pathway

What complement result involves the use of phagocytes?

Chemotaxis and opsonization

Which microorganism requires the low pH inside a phagolysosome in order to reproduce?

Coxiella burnetii

If a person could not form C2, which result of complement would be affected?

Cytolysis, chemotaxis, inflammation, and opsonization

Which cells directly attack abnormal cells in the body?

Cytotoxic T cells

Which of the following attaches the target gene to a desired location?

DNA ligase

Electrophoresis can be used to separate molecules by size, shape, and charge. When DNA samples are run in an electrophoresis gel, the different bands produced generally represent fragments of different sizes. Why is the size of the fragment the most critical factor in determining how far it migrates on a gel when DNA fragments are compared?

DNA moves toward a positive charge due to the negative charge on its phosphate groups. The charge is consistent because all DNA nucleotides have a single phosphate group rather than having more diverse patterns of charges. Because the charge is relatively consistent, size is the most important factor determining how far fragments move.

Which of the following is true about hybridization?

DNA strands that differ in a few bases may still be able to hybridize

What provides the energy for DNA polymerization in a PCR reaction?

Deoxyribonucleoside triphosphates

Which of the following would be the first sign of an infection that resulted in the release of endotoxin?

Fever

How does cytolysis occur via the complement pathway?

Formation of the MAC in invading cells, killing them

Bt crops, including potatoes and cotton, are genetically engineered using laboratory techniques. Which of the following utilizes recombinant DNA technology to produce advantageous traits in the crops that are produced?

Genetically engineered crops have an advantageous gene from another organism inserted into their genome.

What does the plasma membrane of a phagocyte attach to on a microorganism?

Glycoproteins

Which of the following enzymes breaks down the "glue" that holds cells together?

Hyaluronidase

Why is vasodilation important to tissue repair?

It allows for an increased delivery of oxygen, nutrients, and phagocytes to the site of damage.

Why would a recombinant DNA molecule be inserted into a host cell?

It can be copied, transcribed, and translated into a desired protein.

How does the protozoan Trypanosoma evade detection by the immune system?

It can change the surface antigens frequently, preventing the immune system from tracking it.

Why is a release of endotoxin into the bloodstream potentially deadly?

It can lower blood pressure and cause the patient to go into shock.

Why is DNA polymerase from Thermus aquaticus ideal for PCR?

It can withstand the high temperatures associated with PCR.

The polymerase chain reaction, PCR, has revolutionized molecular genetics. Despite all of the advantages of PCR, it does have limitations. Which of the following is NOT a limitation of PCR?

It requires very pure and high-quality DNA samples.

Endotoxins are also known as

Lipid A

Some cells may not have class I MHC proteins on their surfaces due to a viral infection or because they have become cancerous. How does the immune system respond?

Natural Killer cells attach to these cells and kill them.

phagocytes are also called polymorphonuclear leukocytes.

Neutrophil

The introductory passage explains that the amyloid-β protein may function in the innate immune response. Which of the following best describes another example of innate immunity?

Nonspecific or innate immunity occurs when phagocytes respond to common features against a variety of pathogens. An example of innate immunity is when phagocytes refer to common features of pathogens rather than features that are unique to a specific pathogen. The latter is called adaptive or specific immunity.

If a person lacked the ability to form C5, what direct result of complement could still occur?

Opsonization

Which statement correctly identifies an activity of the innate immune system?

Phagocytes can recognize the LPS layer of any gram-negative cell.

According to the animation, antibodies interact with which innate defenses?

Phagocytosis and the complement system

differentiated lymphocytes, matured from one of the major types, produce immunoglobulins.

Plasma cell

In gene cloning, a fragment of interest is placed into an appropriate vector and then replicates within the host cell. Which of the following is NOT an advantage to using a plasmid inserted into an E. coli bacterium for cloning? View Available Hint(s)

Plasmids can hold large inserts of DNA.

You are interested in trying to determine the function of a particular gene in a common bacterium (meaning that it has a haploid genome). To do this, could you use a knockout mutation?

Possibly; it would depend on whether the gene was essential for survival and on whether you could create a diploid bacteria as well.

What cellular macromolecules make up the complement pathway?

Proteins

How is phagocytosis in the immune system different from protozoan phagocytosis?

Protozoan phagocytosis is used for feeding; phagocytosis by immune cells is used to fight infection.

In DNA replication in vivo, RNA primers are used. However, researchers used DNA primers instead in the lab because DNA primers are more stable. Why might this be the case?

RNA has a relatively short half life compared with DNA and does not need to be as stable to perform its functions in the cell.

What is the etiologic agent of typhoid?

Salmonella

Which of the following is an application that uses PCR?

Sequencing a gene, diagnosing a disease, and providing enough DNA for cloning into another organism

Which of the following virulence factors would be found in Staphylococcus aureus?

Staphylokinase

Which of the following microorganisms use M protein to avoid destruction of a phagocyte?

Streptococcus pyogenes

How are superantigens different from other types of exotoxins?

Superantigens cause an overstimulation of the host immune system.

leukocytes mature in the thymus and are involved in cell-mediated immunity.

T cell

Which of the following defense systems would be involved in fighting a viral pathogen?

T lymphocytes

Why is a special polymerase, such as Taq polymerase, required for PCR?

Taq polymerase is produced by an extremophile prokaryote and is able to work at relatively high temperatures.

For several months a graduate student has been working with a pure culture of a suspected bacterial pathogen in an attempt to determine whether it causes disease in various animal models. She had initially found that the organism was highly virulent in mice, but when she attempted to replicate her early experiments weeks later, all of the new experimentally infected mice survived. The student has brought her surprising findings to the lab's weekly research meeting. What advice could you give her?

The bacterial strain may have become attenuated.

Where are the complement proteins found in the body?

The blood serum

How does a capsule help certain bacteria evade detection by the immune system?

The capsule is composed of polysaccharides that are similar to those found in the host; thus, the immune system does not recognize it as foreign.

Which of the complement pathways was discovered first?

The classical pathway

How do the strands separate during PCR?

The high heat of the denaturation step breaks the hydrogen bonds between the two strands.

What is a thermocycler?

The machine that controls the heat of the reaction, cycling between the different temperatures of the different steps during PCR

What is a phagolysosome?

The structure that results from the fusion of a phagosome and a lysosome.

How is Streptococcus pneumoniae able to avoid destruction by a phagocyte?

Their capsules make them "slippery" to phagocytes.

Which of the following are functions of lectins?

They act as opsonins for phagocytosis, they attach to carbohydrates on some bacterial and viral surfaces, and they activate C2 and C4.

What direct effect do histamines and leukotrienes have on capillaries?

They allow capillary walls to open and become leaky.

How are immune cells able to detect foreign pathogens?

They are able to detect structures on the surfaces of foreign cells that are not found in the host.

Neutrophils are the most abundant phagocytic cells. How do they differ from other phagocytic cells?

They are common in pus and at the site of acute inflammation

First line defenses have what aspect in common with each other?

They are physical barriers against invading pathogens.

How do fibrinolysins enhance a pathogen's virulence?

They break down fibrin proteins that are involved in clot formation, allowing the cells to penetrate deep into damaged skin.

How do Shigella cells move between host cells?

They can polymerize actin molecules from the epithelial cells into tail-like structures that propel them from one cell to another.

What is the role of opsonins?

They create "handles" that make it easier for the pseudopods of phagocytes to attach to the microbe invader.

How do restriction enzymes cut DNA sequences?

They cut DNA at sites, called recognition sites, that have specific nucleotide sequences.

What is the function of the primers in PCR?

They provide a 3' end for the DNA polymerase.

A researcher wanted to determine the LD50 (lethal dose that kills 50% of the infected hosts) for a newly isolated bacterial pathogen. Mice were inoculated with diluted cultures containing between 101 and 107 cells. After two days, all of the mice had died EXCEPT for the uninoculated controls. Which of the following is the most likely explanation?

This pathogen is highly virulent in mice.

In general, how might recombinant DNA technology be used to prevent a genetic disorder caused by a mutation in a single gene?

To insert a desirable gene, remove an undesirable gene, or replace a defective gene with a functioning gene

What is the end goal of PCR?

To quickly increase the number of copies of a specific DNA sequence

What is the function of inflammation in response to a burn from a hot iron?

To repair the damaged tissue

Which of the following microorganisms actually grows inside the macrophage?

Tuberculosis bacterium

How can sepsis lead to hypotensive shock?

Vasodilation and increased vascular permeability occur on a large scale, resulting in a drop in blood volume and therefore a drop in blood pressure.

When a DNA gel is run, a standard sample with fragments of known size is often run in one well. Why is it important to use a standard sample?

When an electrophoresis gel is run, small differences in the environment (e.g., the gel composition and current) can influence how far the fragments travel. Having a standard sample allows one to compare the test fragments with fragments of known size that have been run under the same conditions.

Many restriction enzymes produce sticky ends, which are very useful for genetic engineering. What makes the ends sticky?

When the restriction enzyme cuts, it cuts the two strands of a double-stranded DNA molecule unevenly. This produces overhanging DNA nucleotides on each fragment. These overhanging fragments are complementary to each other or to other fragments produced using the same restriction enzyme.

the study of all intermediates and small molecules produced by reactions within an organism.

metabolomics

The exotoxin that functions by destroying cell membranes is called __________.

a cytolytic toxin

If a new bacterial pathogen entered a human body through an accidental needle stick, the first cell that would try to kill the pathogen would likely be

a phagocyte.

Antibodies are proteins that are made by __________.

activated B cells

Which of the following is considered an immunocompromised host?

an 85-year-old cancer patient a heart-transplant patient a patient born without any B cells

A pathogen must __________ in order for it to cause disease.

attach and multiply

Which of the following is similar to lymph?

blood plasma without red blood cells

Which of the following tissues is myeloid?

bone marrow

A patient admitted to the hospital with muscle weakness and paralysis is put on a ventilator because of breathing difficulties. It is determined that the symptoms are the result of a bacterial exotoxin. Which of the following is the most likely source of this toxin?

canned food

Clostridium perfringens causes gas gangrene, a serious infection of the muscle tissues that can lead to amputation. Clostridium are Gram-positive endospore-formers and obligate anaerobes that are killed when exposed to oxygen. Which of the following virulence factors would be most helpful to this organism in establishing an infection?

collagenase, an enzyme that destroys collagen, which is a major protein of connective tissues

The field of study that can reveal how genes function, reveal how organisms interact with the environment, and show evolutionary relationships is __________.

comparative genomics

An exotoxin that has the ability to kill or damage host cells is referred to as a(n)

cytotoxin

Pus is comprised of

dead phagocytes.

ingest antigens and present them to T lymphocytes in the lymph nodes.

dendritic cells

Reporter genes can be used to __________.

detect the absence of a genetic element. detect the presence of a genetic element detect if DNA was inserted in a vector

The cells used as hosts for cloning vectors are __________.

easy to grow and transform with engineered DNA

A pharmaceutical company that uses the Limulus amoebocyte lysate (LAL) assay to test water that is used to make sterile saline for intravenous administration is trying to detect small amounts of which of the following?

endotoxin

Endotoxins are comparatively different from exotoxins, because __________.

endotoxins are not secreted proteins exotoxins can affect sites distant from the infection site endotoxins are associated with more fatalities

Sarah has cloned a gene that codes for the protein EN. EN breaks down cellulose. She wants to collect a large concentration of this protein for research. Which vector should she choose for best results?

expression vector

Factors that enhance an organism's ability to adhere to host tissues include __________.

fimbriae

Which of the following features of Salmonella prevent it from being phagocytosed?

flagella

the study of the entire genetic makeup of an organism.

genomics

According to the animation, B cells interact directly with

helper T cells.

Prostaglandins function to _________ during an immune response.

induce fever by raising the body's temperature

Which of the following is most likely to cause disease?

injection of 10^5 cells of a highly virulent bacterial species into a mouse

Mucous membranes are a part of

innate defense

Benefits of transgenic plants include __________.

insect resistance

Where do Salmonella pathogens grow and replicate in the infected host?

inside phagocytes

The diphtheria exotoxin is an A-B toxin that __________.

is found only in Corynebacterium diphtheriae cells that have been infected with lysogenic bacteriophage β

Which choice below lists the steps necessary for genetic cloning in the correct order?

isolate DNA of interest; fragment the DNA; insert DNA into vector; insert vector into host; host replication of recombinant vector

In DNA cloning, fragments of DNA need to be joined together (e.g., to add a fragment into a vector). What common enzyme is used for this process?

ligase

Complement-coated pathogens can be __________.

lysed or opsonized as a result of complement binding, depending on the type of cell

Because C5 is absent in their sera, which of the protective effects of complement activation does not occur in response to infection with Neisseria meningitidis?

lysis of infecting microbes

Which of the following cell types is involved in innate immunity?

macrophages

A decrease in response time and increased concentration of antibody production after the primary immune response is due to __________.

memory B cells

lymphocytes function primarily in innate immunity against viruses and cancer cells.

natural killer cell

A patient who has been hospitalized with uncontrolled muscle spasms has probably been infected with bacteria that secrete a(n)

neurotoxin

Which of these immune system cells are phagocytes?

neutrophils

What must every pathogen do to cause disease? invade host tissue adhere to host tissue produce endotoxins none of these

none of these not all cells adhere to tissue to cause infection not all pathoges release exotoxins host tissue can be infected with out pathogen invasion

If an electrophoresis gel is run with RNA and then a DNA probe is used to identify the fragments of interest, what is the process called?

northern blotting

The ability to cause disease is __________.

pathogenicity

Phagocytes recognize pathogens through their use of __________.

pattern recognition receptors

PCR stands for

polymerase chain reaction

In Sanger sequencing and in many newer sequencing techniques, labeled precursors are used. What are these precursors?

primers or nucleotides that will be incorporated into the newly synthesized DNA

Secondary lymphoid organs include the __________.

spleen

A person who attended a picnic early in the day develops a very high fever and is unresponsive by the evening. This person most likely has been exposed to a(n)

superantigen

Karen stepped on a rusty nail while walking her dog barefoot. She needs to be treated to prevent damage by which exotoxin?

tetanus exotoxin

Antibodies from cellular immune responses are used in

the classical pathway.

Phagocytosis is defined as

the ingestion of solid material by a eukaryotic cell.

Diapedesis is

the migration of phagocytes through blood vessels to the site of tissue damage.

Both the innate and adaptive defenses of the immune system work to prevent

the penetration and colonization by pathogens, and the diseases they cause.

What might be a reason that a researcher would decide to use Northern blotting instead of Southern blotting?

to determine the extent to which a gene is being transcribed in a particular tissue

the study of all of the RNA produced by an organism.

transcriptonomics

If a restriction enzyme that recognizes GGCAT and cuts between the two guanine residues is mixed with DNA that has the sequence CCGATTATAATCCCGCGGCATATTAGGGCGG, how many pieces would the resulting product be?

two

Interferons function to fight which type of pathogen?

viral

Certain traits that allow pathogens to create infection and cause disease are termed

virulence factors

A patient is brought to the hospital with severe gastrointestinal distress, including cramps, dehydration and diarrhea. Which of the following symptoms would indicate that the pathogen is Vibrio cholerae?

voluminous watery diarrhea

When would endotoxins be released from a bacterial cell?

when the cell dies