BIOL1012 Exam 2

Define hematocrit

% volume of blood occupied by cells (almost all of them are red blood cells, so another measure of RBC count.)

Define plasma

-Liquid portion of blood -Contains water, solutes, and proteins

What is the difference between a gene and a chromosome?

A gene is a short segment of DNA that contains the code or blueprint for one or more proteins; a chromosome is a rod-shaped bundle of tightly coiled DNA and proteins found in the nucleus. Chromosomes contain many many genes

Are antibiotics effective against bacteria and viruses? Why?

Antibiotics are effective against bacteria, NOT viruses. Antibiotics kill bacteria by interfering with processes that do not occur in viruses

What type of immunity are B cells involved in?

Antibody-mediated immunity

What could be the product of an error in translation? A. An inaccurate DNA sequence being passed on to daughter cells. B. An incorrect mRNA sequence being used in protein synthesis. C. A misfolded protein that does not function correctly. D. All of these can be the product of an error in translation. E. None of these can be the product of an error in translation.

C. A misfolded protein that does not function correctly.

Which of the following is NOT part of the first line of immune defense, barriers? A. Skin B. Mucous C. Antibodies D. Tears E. Digestive Enzymes

C. Antibodies

Relate cellular respiration to the movement of blood in the body. Why do we need blood flowing to all of our tissues?

Cellular respiration is the process by which cells in the body obtain energy by breaking down glucose and other organic molecules and using oxygen. This process occurs within the mitochondria of cells and involves the production of ATP (adenosine triphosphate), which is the energy currency of the cell. Cellular respiration requires oxygen and produces carbon dioxide as a byproduct. The movement of blood in the body is vital for several reasons related to cellular respiration and overall bodily functions: 1. Oxygen Delivery: Blood carries oxygen from the lungs (where oxygen is obtained during breathing) to all the body's tissues and cells. Oxygen is necessary for cellular respiration to occur efficiently. In the tissues, oxygen is exchanged for carbon dioxide, a waste product of cellular respiration, which is then transported back to the lungs for removal from the body. 2. Nutrient Transport: In addition to oxygen, blood transports nutrients obtained from the food we eat to cells throughout the body. These nutrients are essential for various cellular processes, including energy production through cellular respiration. 3. Waste Removal: Blood helps in the removal of waste products generated by cells, including carbon dioxide and other metabolic byproducts. Efficient removal of these waste products is crucial to maintaining the proper pH and chemical balance within cells, which is necessary for cellular respiration and other metabolic processes. 4. Hormone Distribution: Blood transports hormones, signaling molecules that regulate various physiological processes in the body. Hormones play a significant role in metabolism, including the regulation of cellular respiration. 5. Temperature Regulation: Blood helps regulate body temperature. By carrying heat away from active tissues and redistributing it, blood helps maintain a stable internal body temperature conducive to the proper functioning of enzymes involved in cellular respiration and other metabolic processes. In summary, the circulatory system ensures that oxygen, nutrients, hormones, and other essential substances are efficiently transported to cells, while waste products are removed. This efficient transport and waste removal are critical for the cells to e

Given a DNA sequence and codon table, predict the mRNA sequence and protein sequence that is encoded by a short segment of DNA.

Transcription: During transcription, DNA is used as a template to synthesize complementary RNA. In RNA, adenine (A) pairs with uracil (U) instead of thymine (T). To transcribe a DNA sequence into mRNA, replace all occurrences of 'T' in the DNA sequence with 'U'. Translation: In translation, mRNA is read in groups of three nucleotides, known as codons. Each codon corresponds to a specific amino acid. To translate an mRNA sequence into a protein sequence, refer to the codon table to find the corresponding amino acid for each codon.

What is the process by which DNA is processed into RNA?

Transcription: RNA polymerase unwinds the DNA and synthesizes a complementary RNA strand to the template strand of DNA

Name the mRNA base pair using the codon table found in the Theme 2 figure link. C G T A

mRNA base pairing G C A U

Define serum

plasma with protein removed

List the functions of RNA polymerase

**RNA polymerase** is a key enzyme responsible for synthesizing RNA molecules from DNA templates. It plays a central role in the process of transcription, which is essential for gene expression. There are several types of RNA polymerase in cells, each with specific functions. Here are the general functions of RNA polymerase: 1. **Initiation of Transcription:** RNA polymerase recognizes and binds to specific regions of DNA called promoters, which indicate the starting point for transcription. The binding of RNA polymerase to the promoter marks the initiation of transcription. 2. **DNA Unwinding:** Once bound to the promoter, RNA polymerase unwinds the DNA double helix near the transcription start site. This unwinding exposes the DNA template strand, allowing RNA synthesis to begin. 3. **Elongation of RNA Strand:** RNA polymerase moves along the DNA template strand, catalyzing the addition of ribonucleotide triphosphates (rNTPs) complementary to the DNA template. The enzyme forms phosphodiester bonds between the ribonucleotides, resulting in the elongation of the RNA molecule. 4. **Proofreading and Error Correction:** RNA polymerase has proofreading mechanisms to correct errors that may occur during transcription. Incorrectly added nucleotides are removed, and the correct ones are inserted. 5. **Termination of Transcription:** RNA polymerase recognizes specific termination signals on the DNA template, which mark the end of the gene. The enzyme and the newly synthesized RNA molecule are then released from the DNA template. 6. **Synthesis of Different Types of RNA:** Different types of RNA polymerases (RNA polymerase I, II, and III in eukaryotes) transcribe specific classes of genes. RNA polymerase I synthesizes rRNA, RNA polymerase II synthesizes mRNA and some small nuclear RNAs (snRNAs), and RNA polymerase III synthesizes tRNAs and other small RNAs. 7. **Regulation of Gene Expression:** RNA polymerase activity is tightly regulated to control gene expression. Various regulatory proteins and molecules can influence the activity of RNA polymerase, allowing cells to adjust the transcription of specific genes in response to internal and external signals. In summary, RNA polymerase is responsible for the synthesis of

List the functions of rRNA

**Ribosomal RNA (rRNA)** is a type of RNA that is a structural and functional component of ribosomes, the cellular organelles where proteins are synthesized. rRNA plays several crucial roles in the process of protein synthesis. Here are its main functions: 1. **Ribosome Structure:** rRNA provides structural support to ribosomes. Together with proteins, rRNA forms the two subunits of ribosomes: the large subunit and the small subunit. These subunits come together during protein synthesis and facilitate the bonding of amino acids to form polypeptide chains. 2. **Catalytic Activity:** Certain regions of rRNA within the ribosome act as ribozymes, which are RNA molecules with enzymatic activity. These ribozymes catalyze the formation of peptide bonds between adjacent amino acids during protein synthesis. The catalytic activity of rRNA ensures the proper bonding of amino acids in the growing polypeptide chain. 3. **Binding of mRNA and tRNA:** rRNA helps in the binding and positioning of mRNA (messenger RNA) and tRNA (transfer RNA) within the ribosome. It ensures that the mRNA is correctly read, and the appropriate tRNA molecules carrying specific amino acids are accurately positioned for peptide bond formation. 4. **Peptide Bond Formation:** rRNA facilitates the formation of peptide bonds between amino acids during translation. It stabilizes the reaction intermediates and helps in the proper alignment of the reacting molecules, enabling the efficient synthesis of polypeptides. 5. **Catalysis of Translocation:** rRNA participates in the movement of tRNA and mRNA through the ribosome during the elongation phase of translation. It assists in the translocation of tRNA molecules from the A site (aminoacyl site) to the P site (peptidyl site) and eventually to the E site (exit site) of the ribosome. 6. **Binding of Proteins:** rRNA provides binding sites for various proteins that are involved in the assembly and function of ribosomes. These proteins help stabilize the structure of the ribosome and assist in its enzymatic activities. 7. **Quality Control:** rRNA, along with associated proteins, monitors the accuracy of translation. If errors occur, such as the incorporation of incorrect amino acids into the polypeptide cha

List the functions of tRNA

**Transfer RNA (tRNA)** is a type of RNA molecule that plays a critical role in protein synthesis, acting as an intermediary between the mRNA (messenger RNA) code and the amino acids. Here are the functions of tRNA: 1. **Amino Acid Carrier:** Each tRNA molecule is specific to a particular amino acid. tRNAs carry amino acids to the ribosomes, where they are assembled into polypeptide chains during protein synthesis. 2. **Recognition of mRNA Codons:** The tRNA contains a region called the anticodon, which is complementary to a specific mRNA codon. By base-pairing between the anticodon and the codon, tRNA ensures that the correct amino acid is added to the growing polypeptide chain. 3. **Anticodon-Codon Interaction:** During translation, tRNA molecules recognize the codons on mRNA through base pairing between their anticodons and the codons on the mRNA. This recognition is essential for the accurate placement of amino acids in the growing protein chain. 4. **Peptide Bond Formation:** tRNA molecules help in the formation of peptide bonds between adjacent amino acids. The ribosome facilitates the transfer of the growing polypeptide chain from one tRNA molecule to another, forming a chain of amino acids. 5. **Ribozyme Activity:** The 3' end of tRNA contains a specific sequence, CCA, to which the corresponding amino acid is attached. This site acts as a ribozyme, catalyzing the formation of peptide bonds between amino acids during translation. 6. **Flexibility in Wobble Base Pairing:** The pairing of the third base in the codon (the "wobble position") with the anticodon is less strict, allowing some tRNAs to recognize more than one codon. This flexibility helps in accommodating the degeneracy of the genetic code. 7. **Quality Control:** tRNAs play a role in quality control mechanisms during translation. If the wrong amino acid is attached to a tRNA or if there is a mismatch between the anticodon and the codon, the tRNA can be edited or removed to prevent errors in protein synthesis. 8. **Regulation of Translation:** tRNAs can be subject to regulatory mechanisms that influence the rate of translation. Various factors, including tRNA modifications, can affect the efficiency of translation and protein synthesis. In sum

Explain where, when and why mRNA transcription and protein translation would happen in a cell.

**mRNA Transcription:** **Where:** mRNA transcription occurs in the cell nucleus (in eukaryotes) or in the nucleoid region (in prokaryotes). In eukaryotic cells, DNA is located within the cell nucleus, which is separated from the cytoplasm by the nuclear membrane. Transcription takes place in the nucleus, where the enzyme RNA polymerase reads the DNA template and synthesizes a complementary mRNA molecule. **When:** mRNA transcription happens when the cell needs to produce specific proteins. Cells carefully regulate transcription based on signals received from the internal and external environment. For instance, during the growth and development of an organism, different genes are transcribed at different times to produce the proteins necessary for each stage of development. Transcription also occurs during cellular processes like tissue repair and immune responses. **Why:** mRNA transcription is essential because it converts the genetic information encoded in DNA into a format (mRNA) that can be used for protein synthesis. By controlling which genes are transcribed, cells can produce specific proteins in response to changing conditions. This regulation allows cells to adapt to their environment, respond to signals, and perform specialized functions. For example, muscle cells transcribe genes for muscle proteins, while immune cells transcribe genes for immune-related proteins. **Protein Translation:** **Where:** Protein translation occurs in the cytoplasm of both prokaryotic and eukaryotic cells. In eukaryotes, after mRNA is transcribed in the nucleus, it undergoes processing (such as splicing and addition of a 5' cap and a poly-A tail) and is then transported to the cytoplasm, where ribosomes and other translation machinery are located. In prokaryotes, which lack a nucleus, transcription and translation can occur simultaneously in the same cellular compartment. **When:** Protein translation takes place when the cell needs to produce specific proteins based on the instructions carried by the mRNA. Like transcription, translation is tightly regulated. Cells can initiate or halt translation in response to various signals, such as hormones, nutrient availability, or cellular stress. For example, when a cell is da

Compare and contrast the functions of B cells, Helper T cells and Cytotoxic (killer) T cells in the adaptive immune response. Which ones directly kill cells? Which secrete important immune molecules, and what do those molecules do? Which are primarily responsible for neutralizing intracellular pathogens? For pathogens outside of cells but inside the body?

1. B Cells: Function: B cells are primarily responsible for humoral immunity, involving the production and secretion of antibodies (immunoglobulins). B cells recognize antigens directly and, when activated, differentiate into plasma cells, which secrete antibodies. Antibodies can neutralize pathogens, mark them for destruction, or activate the complement system. Direct Cell Killing: B cells do not directly kill cells. Secreted Molecules: B cells secrete antibodies, which can neutralize extracellular pathogens, opsonize pathogens for phagocytosis, and activate the complement system. Responsibility: B cells are essential for neutralizing extracellular pathogens (e.g., bacteria, toxins) and pathogens circulating in bodily fluids. 2. Helper T Cells (CD4+ T Cells): Function: Helper T cells play a central role in coordinating the immune response. They recognize antigens presented by APCs and secrete cytokines, which regulate the activity of other immune cells. They help B cells produce antibodies and assist cytotoxic T cells in their functions. Direct Cell Killing: Helper T cells do not directly kill cells. Secreted Molecules: Helper T cells secrete cytokines (e.g., interleukins) that regulate the activity of other immune cells, enhancing immune responses. Responsibility: Helper T cells are crucial for activating and coordinating immune responses, facilitating the functions of B cells, cytotoxic T cells, and other immune cells. 3. Cytotoxic (Killer) T Cells (CD8+ T Cells): Function: Cytotoxic T cells recognize antigens presented on infected host cells and directly kill these cells. They induce apoptosis (programmed cell death) in infected or abnormal cells, including virus-infected cells and cancer cells. Direct Cell Killing: Cytotoxic T cells directly kill infected or abnormal host cells. Secreted Molecules: Cytotoxic T cells release cytotoxic granules containing perforin and granzymes, which induce apoptosis in target cells. Responsibility: Cytotoxic T cells are primarily responsible for killing cells infected with intracellular pathogens (e.g., viruses) and eliminating cancerous or abnormal cells. Neutralizing Intracellular Pathogens: Cytotoxic T Cells: Cytotoxic T cells are responsible for neutralizing intracel

Describe the steps in blood,, or organ donation, including organ donation lists, matching, transplantation and immune therapy.

1. Person needing an organ is identified and placed on a waiting list. 2. The genotype of the person needing the organ is tested. Blood typing, HLA Antigen Matching 3. Donors (living or deceased) are identified based on genetic similarity to the recipient and other factors Organ size, geographic location 4. Recipient receives pre-transplantation treatment 5. Organ transplant happens 6. Recipient takes anti-rejection drugs for the rest of their life to prevent their immune system from destroying the organ 7. Sometimes the donated organ is rejected by the recipient's immune system anyway and the process starts over 1. Blood donors give blood if they meet the requirements 2. Blood is separated into these components - red blood cells, platelets and plasma. The white blood cells are removed from the blood to prevent them from attacking the recipient's body. 3. Donated blood is typed (ABO, Rh) 4. Donated blood is screened for about 10 diseases and pathogens (viruses and bacteria) 5. Blood components are stored (time varies depending on component) 6. Blood components are injected into patients needing blood.

A. Trace the flow of blood from the biceps to the spleen in this diagram (on the next page) or list the order of the structures the blood would flow through. B. What are the two circuits called? C. Which blood vessels contain oxygenated vs. deoxygenated blood? D. Which blood vessels does gas exchange occur in? In which direction does oxygen and carbon dioxide move in these vessels?

A. Biceps, brachial vein, vena cava, right atrium, right ventricle, pulmonary artery, lungs (pulmonary capillaries are in them), pulmonary vein, left atrium, left ventricle, aorta, splenic artery, spleen B. The two circuits are called the systemic and pulmonary circuits. The pulmonary circuit contains the pulmonary artery, pulmonary capillaries, and pulmonary veins. C. Oxygenated: Pulmonary vein, left atrium, left ventricle, aorta, all systemic arteries; Deoxygenated: all systemic veins, vena cava, right atrium, right ventricle, pulmonary artery D. Gas exchange occurs in capillaries. In pulmonary capillaries in lungs, oxygen moves into capillaries from air in alveoli and carbon dioxide moves out of the blood into the air in the alveoli. In the systemic capillaries (all others except in lungs) oxygen moves out of blood into tissues and carbon dioxide moves into the blood from the tissues.

Where is the oxygen concentration highest? A. Pulmonary vein B. Superior vena cava C. Right atrium D. Pulmonary artery E. Leaving tissue capillary beds

A. Pulmonary vein

Which of the following statements about B cells and T cells is TRUE? A. They are both primarily involved in the adaptive immune response B. They are both primarily involved in the innate immune response C. B cells are able to store the "memory" of past pathogens while T cells are not D. Both B and T cells directly kill pathogens E. Both B and T cells make antibodies that travel through the blood

A. They are both primarily involved in the adaptive immune response

Which of the following statements about vaccines is FALSE? A. Vaccines activate only the body's nonspecific immune responses B. Vaccines support the body's ability to make antibodies C. Vaccines are typically given before an individual is exposed to a pathogen D. Vaccines can be used against viruses and bacteria E. Vaccinations can help people whose immune systems are not functioning to protect themselves against pathogens

A. Vaccines activate only the body's nonspecific immune responses

The ultimate function of breathing is to A. deliver oxygen to cells, where it takes part in the reactions of cellular respiration that liberate energy from nutrient molecules and get rid of carbon dioxide B. inflate the lungs, which forces oxygen molecules into the bloodstream. C. deliver carbon dioxide to cells, where it takes part in the reactions of cellular respiration that liberate energy from nutrient molecules and get rid of oxygen D. deliver oxygen to cells, where it takes part in the reactions of cellular respiration that liberate energy from waste molecules. E. deliver oxygen to cells during the day and deliver carbon dioxide at night.

A. deliver oxygen to cells, where it takes part in the reactions of cellular respiration that liberate energy from nutrient molecules and get rid of carbon dioxide

Define antigen and give examples of some possible antigens

An antigen is a molecule or molecular structure that is recognized by the immune system as a potential threat, leading to an immune response. Antigens can trigger the production of antibodies or activate specific immune cells, such as T cells. Antigens are typically foreign substances, such as parts of bacteria, viruses, or other pathogens, but they can also be non-pathogenic molecules, including allergens. Examples of antigens include: Proteins and Peptides: Proteins on the surface of pathogens, such as viral capsids or bacterial cell wall proteins, can serve as antigens. Specific amino acid sequences (peptides) within these proteins can also be antigens. Carbohydrates: Certain carbohydrates on the surface of bacteria and other microbes can act as antigens. Blood group antigens are examples of carbohydrate antigens found on the surface of red blood cells. Lipids: Lipids from bacterial cell membranes or viral envelopes can function as antigens. Lipopolysaccharides (LPS) found in the outer membrane of Gram-negative bacteria are lipid antigens. Nucleic Acids: Specific sequences of DNA or RNA from pathogens can be recognized as antigens. Viral nucleic acids are often targeted by the immune system during viral infections. Haptens: Small molecules that are not inherently immunogenic but can become antigens when they bind to larger carrier molecules. For example, certain drugs and chemicals can act as haptens. Allergens: Substances like pollen, dust mites, pet dander, or certain foods that trigger allergic reactions. Allergens are antigens that induce allergic responses in sensitive individuals. Tumor Antigens: Abnormal proteins or protein fragments present on the surface of cancer cells. The immune system can sometimes recognize these antigens and mount an immune response against cancer cells. Autoantigens: Proteins or other molecules normally present in the body but mistakenly recognized as antigens by the immune system in autoimmune disorders. Examples include components of cells, tissues, or organs targeted in autoimmune diseases like rheumatoid arthritis or type 1 diabetes. In summary, antigens can encompass a wide variety of molecules, both foreign and self, that can trigger immune responses. The immune syste

Define organ donor

An organ donor is an individual who voluntarily and willingly donates their organs, tissues, or cells, either while alive (living donor) or after death (deceased donor), to be used for transplantation into another person's body. Organ donation is a selfless act that can save or significantly improve the lives of individuals suffering from organ failure or severe tissue damage due to various medical conditions. Organs that can be donated include the heart, kidneys, liver, lungs, pancreas, and small intestine, among others. Tissues such as corneas, skin, bones, tendons, and blood vessels can also be donated.

Define organ recipient

An organ recipient is an individual who undergoes a surgical procedure to receive one or more organs, tissues, or cells from a living or deceased donor. Organ transplantation is a medical procedure in which a failing or damaged organ in the recipient's body is replaced with a healthy organ from a donor. The organ recipient is the person who receives and benefits from this life-saving or life-improving procedure.

Apply the four pillars of biomedical ethics to cases involving blood, bone marrow, and organ transplantation.

Autonomy: Autonomy refers to the right of individuals to make their own decisions about their healthcare, even if those decisions are not in their best interest according to medical professionals. Respecting a patient's autonomy means involving them in the decision-making process, providing all relevant information about their condition and treatment options, and respecting their choices, values, and preferences. Beneficence: Beneficence means doing good or promoting the well-being of the patient. Healthcare providers have a moral obligation to act in the best interest of the patient and to promote their health and welfare. This principle emphasizes the importance of balancing risks and benefits, maximizing possible benefits, and minimizing potential harm. Non-Maleficence: Non-maleficence, often stated as "do no harm," emphasizes the importance of not causing harm to patients. Healthcare providers must avoid treatments or interventions that may harm the patient or outweigh the potential benefits. This principle underscores the need to balance the benefits of a treatment against its risks and potential harm. Justice: Justice in healthcare ethics refers to the fair distribution of healthcare resources, treatments, and services. This principle emphasizes the importance of providing equal and fair treatment to all individuals, regardless of their background, social status, or financial means. It addresses issues of equity, access to healthcare, and the fair allocation of limited resources.

Compare and contrast B cell receptors, T cell receptors and Antibodies, and describe how they interact with antigens.

B Cell Receptors (BCRs), T Cell Receptors (TCRs), and Antibodies: 1. B Cell Receptors (BCRs): Location: BCRs are membrane-bound antibodies found on the surface of B cells. Structure: BCRs consist of two identical heavy chains and two identical light chains, forming a Y-shaped structure. Function: BCRs recognize antigens on the surface of pathogens, leading to the activation of B cells. When activated, B cells can differentiate into plasma cells, which produce antibodies. Interaction with Antigens: BCRs directly bind to antigens on the surface of pathogens. Once bound, the B cell internalizes the antigen, processes it, and presents it to helper T cells, leading to further immune responses. 2. T Cell Receptors (TCRs): Location: TCRs are found on the surface of T cells. Structure: TCRs consist of two different chains, either alpha and beta chains (αβ T cells) or gamma and delta chains (γδ T cells). Function: TCRs recognize antigens presented by antigen-presenting cells (APCs) on major histocompatibility complexes (MHC) molecules. This interaction is essential for the activation of T cells and their differentiation into various effector cells. Interaction with Antigens: TCRs specifically recognize antigens presented by APCs. CD4+ T cells interact with antigens presented on MHC class II molecules, while CD8+ T cells interact with antigens presented on MHC class I molecules. 3. Antibodies (Immunoglobulins, Ig): Location: Antibodies can be membrane-bound (as BCRs on B cells) or secreted (in blood and tissue fluids). Structure: Antibodies consist of two identical heavy chains and two identical light chains, forming a Y-shaped structure similar to BCRs. Function: Antibodies neutralize pathogens, mark them for destruction (opsonization), and activate the complement system. They can also participate in allergic and hypersensitivity reactions. Interaction with Antigens: Antibodies recognize antigens with high specificity. They can bind to antigens directly, leading to neutralization, or they can bind to antigens on the surface of pathogens, tagging them for destruction by immune cells or complement proteins. Interaction with Antigens: BCRs: BCRs directly bind to antigens on the surface of pathogens, leading to the activa

Last year you were exposed to a virus, got sick, and got better again. We'll call this the virus "familiar virus". Last week you were exposed both to the familiar virus and a virus you had not encountered before- we'll call this the "new virus". Which of the following is an accurate description of the difference in your immune response to the familiar virus and the new virus? A. Your blood was already full of all the antibodies you needed against the familiar virus, so when you encountered the two viruses, you only had to make antibodies against the new virus. B. Since your B cells had a stored memory of the familiar virus, your body was able to more quickly produce antibodies against the familiar virus, whereas it took longer to begin making antibodies against the new virus. C. Since your body had previously encountered the familiar virus, it was unable to get through your first line of defense, while the new virus was able to get through your first line of defense D. Both A and B are accurate E. Both B and C are accurate

B. Since your B cells had a stored memory of the familiar virus, your body was able to more quickly produce antibodies against the familiar virus, whereas it took longer to begin making antibodies against the new virus.

Gas exchange takes place in the respiratory system in the _____. A. trachea B. alveoli C. bronchi D. pleura E. larynx

B. alveoli

Define the roles of the IRB, and IACUC in ethical research.

Both the Institutional Review Board (IRB) and the Institutional Animal Care and Use Committee (IACUC) play crucial roles in ensuring ethical standards and the welfare of human subjects and animals, respectively, in research studies. ### **Institutional Review Board (IRB):** 1. **Ethical Review:** The primary role of the IRB is to conduct ethical review and oversight of research involving human subjects. It ensures that research protocols adhere to ethical guidelines, including informed consent, confidentiality, and protection of participants' rights and welfare. 2. **Informed Consent:** The IRB reviews and approves the informed consent process, ensuring that participants are fully informed about the research, its risks, benefits, and their rights. Researchers must obtain informed consent from participants before involving them in any study. 3. **Risk-Benefit Assessment:** The IRB assesses the risks and benefits of research studies to participants. Studies with high potential risks must have corresponding high potential benefits to justify the risks to participants. 4. **Continuing Review:** The IRB conducts periodic reviews of ongoing research to ensure that ethical standards are maintained. Studies are re-evaluated at regular intervals, and the IRB can require modifications or halt studies if ethical concerns arise. 5. **Vulnerable Populations:** The IRB pays special attention to research involving vulnerable populations, such as children, prisoners, pregnant women, and mentally incapacitated individuals, ensuring their additional protection and informed consent procedures. ### **Institutional Animal Care and Use Committee (IACUC):** 1. **Ethical Oversight:** The IACUC is responsible for ensuring the ethical and humane use of animals in research. It reviews and approves research protocols involving animals, ensuring compliance with ethical guidelines and regulations. 2. **Animal Welfare:** The IACUC assesses the welfare of animals, including their housing, feeding, and overall care. It ensures that research procedures minimize discomfort, pain, and distress to animals. Alternatives to animal use, such as computer modeling or in vitro studies, are encouraged when appropriate. 3. **Protocol Review:** The IACUC

Relate cellular respiration to breathing. What are the reactants and the products?

Cellular respiration is the process through which cells break down organic molecules, typically glucose, to produce energy in the form of ATP (adenosine triphosphate). This process occurs within the mitochondria of cells and is essential for the survival and functioning of all aerobic organisms, including humans. The overall reaction for cellular respiration is: C6H12O6 (glucose) + 6 O2 (oxygen) → 6 CO2 (carbon dioxide) + 6 H2O (water) + energy (as ATP) In this equation: - Glucose (C6H12O6) is a carbohydrate, which serves as the primary energy source for cellular respiration. - Oxygen (O2) is the vital gas required for aerobic respiration. Oxygen is inhaled from the atmosphere and transported to cells via the bloodstream. - Carbon Dioxide (CO2) is a waste product of cellular respiration. It is produced when glucose is oxidized to release energy. Carbon dioxide is transported back to the lungs through the bloodstream and is exhaled from the body during breathing. - Water (H2O) is another product of cellular respiration. It is formed during the metabolic reactions that take place within the mitochondria. - Energy (as ATP): The primary purpose of cellular respiration is to generate ATP, the energy currency of the cell. This energy is used to power various cellular processes and activities. Relation to Breathing: Breathing, or respiration, is the process by which organisms exchange gases with their environment. In the context of cellular respiration: 1. Inhalation: During inhalation, oxygen-rich air is drawn into the lungs. Oxygen from the inhaled air diffuses into the bloodstream in the lungs, where it binds to hemoglobin in red blood cells. These oxygenated red blood cells are then transported to body tissues through the circulatory system. 2. Cellular Respiration: Within the cells, oxygen is used in the process of cellular respiration to oxidize glucose and produce ATP. This process occurs in the mitochondria, where glucose and oxygen are broken down to produce carbon dioxide, water, and energy in the form of ATP. 3. Exhalation: Carbon dioxide, a waste product of cellular respiration, is transported back to the lungs through the bloodstream. In the lungs, carbon dioxide diffuses from the blood into the air sac

Describe the functions of complement proteins, interferon proteins, and cytokines

Complement proteins, interferon proteins, and cytokines are essential components of the immune system that play diverse roles in the body's response to infections and other challenges. Here's a description of their functions: 1. Complement Proteins: Complement proteins are a group of proteins that form part of the immune system's innate defense mechanisms. They have several functions, including: Opsonization: Complement proteins can coat pathogens, marking them for phagocytosis (engulfment and digestion) by phagocytes like macrophages and neutrophils. Cell Lysis: Complement proteins can form a membrane attack complex (MAC) on the surface of pathogens, leading to the disruption of their cell membranes and lysis, or bursting. Inflammation: Complement activation results in the release of peptides that promote inflammation, attracting immune cells to the site of infection. Clearance of Immune Complexes: Complement proteins assist in the removal of immune complexes (antibodies bound to antigens) from the bloodstream. Enhancement of Phagocytosis: Complement proteins can enhance phagocytosis by facilitating the recognition and engulfment of pathogens by phagocytes. 2. Interferon Proteins: Interferons are signaling proteins that play a crucial role in the antiviral immune response. When cells are infected with viruses, they produce interferons, which have several functions, including: Antiviral Defense: Interferons inhibit viral replication within infected cells and help neighboring cells resist viral infection. They achieve this by activating various antiviral proteins and inhibiting the translation and transcription of viral RNA. Stimulating Immune Responses: Interferons enhance the activity of natural killer (NK) cells and stimulate the adaptive immune response, contributing to the elimination of infected cells. Modulating Inflammation: Interferons can modulate the inflammatory response by regulating the activity of immune cells, thus influencing the balance between pro-inflammatory and anti-inflammatory signals. 3. Cytokines: Cytokines are a broad category of small proteins or glycoproteins that function as signaling molecules in the immune system. They are secreted by various cells and have diverse functions, in

Describe the components of a vaccine for a viral disease and a vaccine for a bacterial disease.

Components of a Vaccine for a Viral Disease: Antigen: The vaccine contains a harmless version of the viral antigen or a piece of the virus (such as a protein or genetic material) that triggers an immune response without causing the disease. The antigen trains the immune system to recognize and remember the virus. Adjuvants: Adjuvants are substances added to enhance the body's immune response to the vaccine. They help stimulate a stronger and longer-lasting immune response to the antigen. Stabilizers: Stabilizers maintain the effectiveness of the vaccine by preventing its components from reacting with each other or the environment. Common stabilizers include sugars (like sucrose or lactose) and proteins (like gelatin). Preservatives: Preservatives prevent contamination of the vaccine by bacteria or fungi. Thimerosal, a mercury-containing compound, is a common preservative used in multidose vials of vaccines. Growth Medium: Some vaccines, particularly live attenuated vaccines, are grown in cells. The growth medium provides essential nutrients for the virus to replicate in the laboratory setting. Buffer: Buffers maintain the vaccine's pH level, ensuring its stability and efficacy. Inactivating Agents: For inactivated or killed vaccines, chemicals or heat are used to inactivate the virus, making it non-infectious while retaining its immunogenicity. Components of a Vaccine for a Bacterial Disease: Antigen: Similar to viral vaccines, bacterial vaccines contain antigens derived from the bacteria, such as proteins or sugars from the bacterial cell wall. These antigens stimulate the immune system to recognize and combat the bacteria. Toxoids: Toxoids are inactivated toxins produced by certain bacteria. Toxoid vaccines, like the tetanus and diphtheria vaccines, are designed to induce immunity against the harmful effects of bacterial toxins. Adjuvants: Adjuvants are added to enhance the immune response to the bacterial antigens, making the vaccine more effective. Stabilizers: Stabilizers ensure the vaccine remains effective during storage and transportation by preventing degradation of its components. Preservatives: Preservatives prevent bacterial or fungal contamination in multidose vials of vaccines, ensuring their sa

Figure 4 shows a codon table. Met is circled. Which of the following statements is FALSE? A. Met is the abbreviation for an amino acid. B. The RNA codon for Met is AUG C. Met is the first amino acid added to all growing proteins in humans. D. The DNA sequence coding for Met is TUC. E. Mutation of the first nucleotide base in the codon for Met to a G would cause Val to be added to a growing protein.

D. The DNA sequence coding for Met is TUC

A foreign substance that elicits a response from the adaptive immune system is a(n)___ A. antibody. B. provirus. C. antibiotic. D. antigen. E. Macrophage.

D. antigen.

Which cell type in the blood transports oxygen? A. plasma cells B. leukocytes C. thrombocytes D. erythrocytes E. lymphocytes

D. erythrocytes

When you donate plasma, you are donating all of the following components EXCEPT A. blood proteins like those involved in blood clotting or the immune response. B. nutrients like glucose and amino acids. C. waste products like urea and carbon dioxide. D. white blood cells that are involved in defense. E. hormones that may be circulating in your blood at the time of donation.

D. white blood cells that are involved in defense.

Explain why differences in the phenotypes of two cells in a person are based on differences in gene expression, and not in differences in the DNA sequences found in the cells

Differences in the phenotypes of two cells in a person are primarily based on differences in gene expression rather than differences in the DNA sequences found in the cells. This phenomenon is a consequence of the complex and dynamic regulation of gene expression in cells, which allows them to perform specific functions and respond to various internal and external signals. Here's why gene expression plays a central role in determining cellular phenotypes: Gene Regulation: Cells have a vast array of regulatory mechanisms that control when and to what extent specific genes are transcribed and translated into proteins. These mechanisms include transcription factors, epigenetic modifications (such as DNA methylation and histone modifications), and non-coding RNAs. Differences in the activity of these regulatory elements can lead to variations in gene expression between cells, even if their DNA sequences are identical. Cell Differentiation: During development, cells differentiate into various cell types with distinct functions. This differentiation is primarily driven by differences in gene expression patterns. Stem cells, for example, have the potential to differentiate into different cell types based on the genes they express. As cells mature and specialize, their gene expression profiles become more specific, leading to diverse cellular phenotypes. Environmental Influences: Cells within an organism are exposed to different microenvironments and signals. These signals, such as hormones, growth factors, and nutrients, can influence gene expression. Cells respond to these signals by adjusting their gene expression profiles, allowing them to adapt to specific conditions or stimuli. Consequently, cells in different tissues or environments can exhibit distinct phenotypes despite having the same genetic information. Epigenetic Modifications: Epigenetic changes, which involve modifications to DNA or histones without altering the underlying DNA sequence, can be heritable and play a critical role in gene regulation. These modifications can be influenced by environmental factors and can lead to differences in gene expression patterns between cells. Post-Transcriptional and Post-Translational Modifications: Gene expression

Which of the following statements about antibodies is FALSE? A. They are produced by B cells B. They bind to specific antigens C. They circulate in the blood D. They are also called immunoglobins E. They are produced by T cells

E. They are produced by T cells

List the important functions of red blood cells

Erythrocytes Carry oxygen to all cells in the body

What are erythrocytes? What are leukocytes? What are thrombocytes? What are their functions?

Erythrocytes are red blood cells that carry oxygen to all cells in the body; leukocytes are white blood cells that carry out immune functions and fight infections; thrombocytes are platelets involved in blood clotting

Describe fever and the inflammatory response

Fever: Fever is an elevated body temperature, usually in response to an infection, illness, or other medical conditions. It is part of the body's natural defense mechanisms and is regulated by the hypothalamus in the brain. When the immune system detects the presence of pathogens, such as bacteria or viruses, certain immune cells release signaling molecules called pyrogens. These pyrogens trigger the hypothalamus to raise the body's set-point temperature, leading to fever. Fever has several important functions: Enhanced Immune Response: Fever can enhance the activity of immune cells, such as white blood cells, and increase the production of antibodies, helping the body fight off infections more efficiently. Inhibition of Pathogen Growth: Many pathogens have optimal growth temperatures. Fever can inhibit the growth of these pathogens, making it more challenging for them to replicate and spread in the body. Increased Metabolic Rate: Fever increases the metabolic rate, which can enhance various physiological processes, including the repair and regeneration of tissues. While fever is generally beneficial, excessively high temperatures can lead to discomfort and, in severe cases, may cause complications. It's important to monitor fever and seek medical attention if it becomes concerning, especially in vulnerable populations such as young children and the elderly. Inflammatory Response: The inflammatory response is a complex biological reaction that occurs when the body is threatened by infection, injury, or harmful substances. It involves a series of events that aim to eliminate the cause of cell injury, clear out damaged cells and tissues, and initiate tissue repair. The key characteristics of the inflammatory response include: Redness (Rubor): Increased blood flow to the affected area leads to redness and warmth. This increased blood flow delivers immune cells, oxygen, and nutrients to the site of injury or infection. Swelling (Tumor): Blood vessels become more permeable, allowing fluids, proteins, and immune cells to leak into the tissues. This accumulation of fluid causes swelling. Heat (Calor): Increased blood flow also generates heat, contributing to the warmth experienced at the site of inflammation. Pain (

Where does gas exchange take place? What gasses are being exchanged? Relate this to oxygenated and deoxygenated blood

Gas exchange in the human body occurs in the lungs, specifically within tiny air sacs called **alveoli**. Alveoli are surrounded by tiny blood vessels called **capillaries**. It is in these capillaries that the exchange of gases takes place. Gases being exchanged: 1. Oxygen (O2): During inhalation, oxygen from the inhaled air diffuses across the thin walls of the alveoli and into the bloodstream. Here, it binds to hemoglobin in red blood cells and is transported to body tissues for use in cellular respiration. 2. Carbon Dioxide (CO2): Carbon dioxide, which is a waste product of cellular respiration, is carried in the bloodstream in the form of bicarbonate ions and dissolved CO2. When the blood reaches the capillaries surrounding the alveoli, CO2 diffuses out of the blood and into the alveoli. It is then exhaled from the body during exhalation. Relation to Oxygenated and Deoxygenated Blood: 1. Oxygenated Blood: Oxygenated blood refers to blood that has been to the lungs and has picked up oxygen. In the lungs, oxygen diffuses into the bloodstream in the capillaries surrounding the alveoli. This oxygen-rich blood is then pumped out of the heart's left ventricle to be distributed to the body's tissues and organs, where oxygen is released to support cellular respiration. 2. Deoxygenated Blood: Deoxygenated blood refers to blood that has delivered oxygen to body tissues and has picked up carbon dioxide, becoming oxygen-depleted. Deoxygenated blood returns to the heart through veins and is pumped into the lungs' capillaries surrounding the alveoli. In the lungs, carbon dioxide diffuses out of the blood into the alveoli to be exhaled, and oxygen from the inhaled air diffuses into the blood, converting the deoxygenated blood back into oxygenated blood. This continuous cycle of gas exchange ensures that the body's tissues receive a constant supply of oxygen while simultaneously removing carbon dioxide, maintaining the balance necessary for cellular respiration and overall physiological functions.

List ways that gene expression can be regulated in human cells.

Gene expression in human cells can be regulated through a variety of mechanisms that control when, where, and to what extent specific genes are transcribed and translated into proteins. These regulatory mechanisms are fundamental for cellular differentiation, development, and response to environmental signals. Here are several ways in which gene expression can be regulated in human cells: Transcriptional Regulation: Promoter Elements: Proteins, known as transcription factors, can bind to specific DNA sequences in the promoter region of genes, enhancing or inhibiting transcription. Enhancers and Silencers: Distant regulatory elements called enhancers can enhance gene transcription, while silencers inhibit it. Transcription factors and other regulatory proteins bind to these elements to modulate gene expression. Epigenetic Modifications: DNA methylation and histone modifications (such as acetylation, methylation, and phosphorylation) can alter chromatin structure, making genes more or less accessible to the transcriptional machinery. Post-Transcriptional Regulation: RNA Interference (RNAi): Small RNA molecules, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), can bind to target mRNA molecules, leading to their degradation or inhibition of translation. Alternative Splicing: Pre-mRNA can be spliced in different ways, leading to the production of multiple mRNA isoforms from a single gene. This allows cells to generate diverse proteins from a single gene. mRNA Stability: The stability of mRNA molecules can be regulated, determining their lifespan and, consequently, the duration of protein production. Post-Translational Regulation: Protein Modification: Proteins can undergo various modifications, including phosphorylation, glycosylation, acetylation, and ubiquitination. These modifications can affect protein stability, activity, localization, and interactions with other molecules. Protein Degradation: Proteins can be targeted for degradation by the proteasome or lysosomes, controlling their levels and functions within the cell. Regulatory RNAs: Long Non-Coding RNAs (lncRNAs): lncRNAs can regulate gene expression by interacting with chromatin, transcription factors, or other RNAs, influencing transcr

Define gene expression

Gene expression refers to the process by which the information encoded in a gene is used to produce a functional gene product, such as a protein or RNA molecule. It involves the transcription of DNA into RNA (in a process called transcription) and the translation of RNA into a protein (in a process called translation). Gene expression is a fundamental biological process that allows cells to carry out specific functions by producing the necessary proteins and RNAs. Here's a breakdown of gene expression: 1. Transcription: In the first step of gene expression, a specific segment of DNA serves as a template for the synthesis of a complementary RNA molecule. This process is called transcription and is carried out by an enzyme called RNA polymerase. The resulting RNA molecule, known as messenger RNA (mRNA), carries the genetic information from the DNA to the ribosomes, the cellular machinery where proteins are synthesized. 2. RNA Processing (in eukaryotes): In eukaryotic cells, the initial RNA transcript (pre-mRNA) undergoes several modifications before it becomes mature mRNA. These modifications include the removal of non-coding regions called introns and the splicing together of coding regions called exons. Additionally, a protective cap is added to the 5' end of the mRNA, and a poly-A tail is added to the 3' end. These modifications are essential for the stability and proper functioning of the mRNA. 3. Translation: Mature mRNA is then translated into a specific sequence of amino acids, forming a polypeptide chain, which eventually folds into a functional protein. This process occurs on ribosomes, where transfer RNA (tRNA) molecules recognize specific codons (three-nucleotide sequences) on the mRNA and bring the corresponding amino acids to the ribosome. The ribosome catalyzes the formation of peptide bonds between the amino acids, creating the polypeptide chain. Gene expression is tightly regulated and can be influenced by various factors, including environmental cues, developmental signals, and cell type-specific factors. Cells can also control gene expression by regulating the transcription and translation processes. Proper regulation of gene expression is essential for the normal functioning and development o

What is the difference between the genotype and phenotype of an organism?

Genotype is an organism's particular set of genes represented by alleles/traits/ Phenotype is an organism's observable physical and functional traits of an organism

What does it mean to find a "match" between an organ donor and a recipient?

In order to minimize the rejection of a donated organ, an organ has to have matching antigens as the recipient or else the immune system may see the organ as foreign and attempt to destroy it.

Compare and contrast specific consent, general consent, and informed consent.

In the context of research involving human subjects, different types of consent serve varying purposes and provide different levels of participant protection. Here's a comparison and contrast of specific consent, general consent, and informed consent: ### **1. Specific Consent:** - **Definition:** Specific consent refers to obtaining explicit permission from participants for specific aspects of the research. It is focused on a particular procedure, intervention, or data collection method. - **Purpose:** Specific consent is used when researchers need to clarify certain procedures or interventions that are not covered in the general or informed consent. For example, specific consent might be obtained for a specific medical procedure or for the use of identifiable data for a particular purpose. - **Scope:** Limited to a particular aspect of the study, ensuring participants are aware of and agree to specific elements of the research process. ### **2. General Consent:** - **Definition:** General consent involves obtaining permission from participants for a broad range of potential future research studies. It does not specify particular studies but allows researchers to use participants' data or samples for a variety of research purposes. - **Purpose:** General consent is often used in long-term research projects or biobanking initiatives where it is impractical to seek consent for every single study that might use the stored data or samples. - **Scope:** Covers a wide array of potential research studies, offering flexibility for researchers while ensuring participants are aware that their data or samples might be used in unspecified future research. ### **3. Informed Consent:** - **Definition:** Informed consent is the process of providing detailed information to participants about the research study. Participants are informed about the study's purpose, procedures, potential risks and benefits, alternatives, confidentiality measures, and their right to withdraw. - **Purpose:** Informed consent ensures that participants fully understand the nature of the research, enabling them to make voluntary and informed decisions about participation. - **Scope:** Comprehensive and covers all aspects of the

Define consent as it applies to research using human subjects, and identify cases where consent is ethically or unethically obtained

In the context of research using human subjects, consent refers to the voluntary and informed agreement by an individual to participate in a research study. Informed consent is a fundamental ethical requirement and legal obligation in research involving human participants. It ensures that individuals are fully aware of the nature, purpose, risks, and potential benefits of the research before they decide to participate.

Identify where blood is oxygenated vs. deoxygenated

In the human circulatory system, blood is oxygenated and deoxygenated at different locations: 1. Oxygenated Blood: Blood is oxygenated in the lungs. In the lungs, oxygen from the air we breathe diffuses into the bloodstream through tiny air sacs called alveoli. Here, red blood cells pick up oxygen and release carbon dioxide, which is then exhaled from the body. The oxygenated blood is then pumped out of the heart's left ventricle to be distributed to the rest of the body. 2. Deoxygenated Blood: Blood becomes deoxygenated after it has delivered oxygen to the body's tissues. Deoxygenated blood, which is rich in carbon dioxide, returns to the heart through veins. The superior vena cava carries deoxygenated blood from the upper part of the body, and the inferior vena cava carries deoxygenated blood from the lower part of the body. This deoxygenated blood enters the right atrium of the heart and is then pumped into the right ventricle. From the right ventricle, the blood is pumped to the lungs where it releases carbon dioxide and picks up fresh oxygen, starting the oxygenation process again. In summary, oxygenation occurs in the lungs, where blood picks up oxygen, and deoxygenation occurs in the body's tissues, where oxygen is delivered and carbon dioxide is picked up.

What are some causes of a patient having too many white blood cells?

Infection, autoimmune disease, blood or bone cancer

What is the difference between informed consent and specific consent?

Informed consent: participants know what the study is about, informed about and understand the potential risks and benefits of participating in the study. Specific consent: participants agree to the use of their data only to answer specific question(s), in a specific period of time, and only by specific researchers.

Compare and contrast innate and adaptive immunity. What cells are involved in each response? Which type of immunity is faster/slower, lasts longer/shorter, is specific/non-specific. What categories of microbial molecules are recognized in each type of immunity?

Innate Immunity: Non-Specific: Innate immunity provides immediate but general defense against a wide range of pathogens without prior exposure. It is non-specific because it doesn't distinguish between different pathogens. Speed: Innate immunity responds rapidly, typically within hours of infection or injury. Duration: Innate immunity is relatively short-lived and doesn't provide long-term protection. Cells: Cells involved in innate immunity include macrophages, neutrophils, dendritic cells, natural killer (NK) cells, and various epithelial cells. Adaptive Immunity: Specific: Adaptive immunity is highly specific. It recognizes and targets specific pathogens based on their unique antigens. It is acquired and improved upon exposure to pathogens. Speed: Adaptive immunity takes several days to develop upon the first exposure to a pathogen. However, during subsequent exposures, the response is faster due to immunological memory. Duration: Adaptive immunity can be long-lasting, providing immunity against specific pathogens for years or even a lifetime, especially due to the presence of memory cells. Cells: Cells involved in adaptive immunity include B cells (which produce antibodies) and T cells (which include helper T cells, cytotoxic T cells, and regulatory T cells). Comparison of Recognition: Innate Immunity: Recognizes broad classes of pathogens based on generic structures, such as lipopolysaccharides, flagellin, or double-stranded RNA. Adaptive Immunity: Recognizes specific antigens, which are usually proteins or glycoproteins unique to each pathogen. Categories of Microbial Molecules Recognized: Innate Immunity: Recognizes pathogen-associated molecular patterns (PAMPs) present on a wide range of pathogens. These include components like lipopolysaccharides, peptidoglycans, and nucleic acids found in many microbes. Adaptive Immunity: Recognizes antigens, which are specific molecules present on the surface of pathogens. B cells recognize antigens directly, while T cells recognize antigens presented on infected host cells. Summary: Innate immunity is non-specific, acts rapidly, but doesn't provide long-term immunity. It recognizes generic features shared by many pathogens. Adaptive immunity is highly specific, ta

List the important functions of white blood cells

Leukocytes Immune system cells, fight infections

List the functions of mRNA

Messenger RNA (mRNA) is a crucial molecule in the process of gene expression, serving as a template for protein synthesis. Its primary function is to carry genetic information from DNA to the ribosomes, where this information is translated into proteins. Here are the main functions of mRNA: 1. **Transcription Template:** mRNA is synthesized during the transcription process in the cell nucleus. It carries the genetic code from a specific gene in the DNA to the cytoplasm where proteins are synthesized. 2. **Genetic Information:** mRNA carries the information needed to determine the sequence of amino acids in a protein. Each set of three nucleotides on mRNA, called a codon, corresponds to a specific amino acid or a signal to start or stop protein synthesis. 3. **Translation:** mRNA serves as a template for translation, where the sequence of codons is read by ribosomes. Ribosomes use the information encoded in mRNA to synthesize a specific sequence of amino acids, forming a polypeptide chain, which folds into a functional protein. 4. **Start and Stop Signals:** mRNA contains specific start codon (AUG) and stop codon sequences (UAA, UAG, UGA). These signals indicate the beginning and end of a protein-coding sequence, guiding the ribosomes during translation. 5. **Transcription Regulation:** mRNA levels can be regulated to control gene expression. Cells can adjust the amount of mRNA produced from a particular gene in response to various signals and environmental cues, influencing the production of specific proteins. 6. **Alternative Splicing:** In eukaryotes, pre-mRNA undergoes splicing to remove non-coding regions (introns) and connect coding regions (exons). This process results in different mRNA variants from a single gene, leading to the production of multiple protein isoforms with diverse functions. 7. **mRNA Editing:** mRNA molecules can be edited after transcription, leading to changes in the sequence of the encoded protein. This process, known as RNA editing, can result in the incorporation of non-standard amino acids into the protein. 8. **mRNA Stability:** The stability of mRNA molecules can vary. Some mRNAs are quickly degraded, while others are more stable, allowing cells to fine-tune the levels of spec

Translate this mRNA sequence into the correct amino acids:CGAAUGCCUGCUAUAAGAGGUUAAUCU

Met-Pro-Ala-Ila-Arg-Gly-(translation STOPs here); remember that translation always starts with a Met amino acid

Describe the secondary immune response in the adaptive immune system. How is it different from the primary immune response?

Occurs when a person is exposed to the same antigen 2+ times. The response of B- and T- cells after a repeated encounter with the same antigen is more rapid because of the activation of previously generated memory cells. The response is stronger because clonal expansion in the first response led to many many memory cells with the exact same receptors being generated, and they can all start responding immediately

Define organ rejection

Organ rejection refers to the process by which a recipient's immune system recognizes a transplanted organ as foreign or non-self and attempts to attack and destroy it. When a person receives an organ transplant, their immune system may identify the transplanted organ or tissue as a threat and mount an immune response against it. This response can lead to the body rejecting the transplanted organ. Organ rejection occurs due to differences in antigens, which are specific molecules or markers on the surface of cells. The recipient's immune system recognizes these antigens as foreign and activates an immune response to destroy the transplanted organ. Despite efforts to match donors and recipients based on blood type and tissue compatibility, the immune system may still recognize certain differences, triggering rejection. There are different types of organ rejection: 1. **Hyperacute Rejection:** This type of rejection occurs immediately after transplantation, within minutes to hours. It is typically a result of pre-existing antibodies in the recipient's blood that react strongly with antigens on the transplanted organ. Hyperacute rejection is rare due to rigorous pre-transplant testing to identify and avoid incompatible matches. 2. **Acute Rejection:** Acute rejection happens within the first few months after transplantation. It is the most common type of rejection and occurs when the recipient's immune system recognizes the transplanted organ as foreign. Acute rejection can often be treated with increased immunosuppressive medications to suppress the immune response. 3. **Chronic Rejection:** Chronic rejection is a slow and gradual process that can occur over months or years. It involves the ongoing immune response against the transplanted organ, leading to damage and scarring of the organ's tissues. Chronic rejection can eventually cause the transplanted organ to fail. To prevent rejection, transplant recipients are prescribed immunosuppressive medications (also known as anti-rejection or anti-rejection drugs) that suppress the immune response and lower the chances of the body attacking the transplanted organ. However, finding the right balance of immunosuppression is crucial, as too much suppression can increa

List the functions of the following cells in the innate immune system: phagocytes, natural killer cells.

Phagocytes: Phagocytes are a group of immune cells that engulf and digest pathogens, dead cells, and cellular debris. They play a crucial role in the early defense against infections and help maintain tissue homeostasis. There are different types of phagocytes, including neutrophils, macrophages, and dendritic cells. Here are their functions: Engulfment: Phagocytes recognize and engulf pathogens, such as bacteria, viruses, and fungi, through a process called phagocytosis. Digestion: Once pathogens are engulfed, phagocytes use enzymes and other substances to break down the pathogens into harmless components. Antigen Presentation: Dendritic cells, a type of phagocyte, present antigens from engulfed pathogens to T cells, initiating adaptive immune responses. Tissue Cleanup: Phagocytes remove dead cells, cellular debris, and foreign substances from tissues, contributing to tissue repair and maintenance. Inflammation Regulation: Phagocytes release chemical signals that modulate inflammation, helping to resolve immune responses after the threat has been eliminated. Natural Killer (NK) Cells: Natural Killer cells are a type of lymphocyte, a white blood cell, that plays a critical role in the innate immune response against infected or abnormal host cells, including cancer cells. Here are their functions: Identification of Abnormal Cells: NK cells recognize cells that display abnormal or missing self-antigens, a common feature of infected cells and cancer cells. Inducing Cell Death: NK cells can induce apoptosis (programmed cell death) in target cells by releasing cytotoxic granules containing perforin and granzymes. Perforin creates pores in the target cell membrane, allowing granzymes to enter and trigger apoptosis. Immune Regulation: NK cells help regulate immune responses by interacting with other immune cells and releasing cytokines, influencing the activity of surrounding immune cells. Viral Defense: NK cells play a role in defense against certain viral infections, particularly those affecting cells that downregulate MHC class I molecules, making them vulnerable to NK cell recognition. In summary, phagocytes are responsible for engulfing and digesting pathogens and cellular debris, while NK cells specialize in i

Compare and contrast the primary and secondary responses to a pathogen. Which is faster and stronger? Why? What measurements can be used to measure the differences in the two responses?

Primary and Secondary Immune Responses: 1. Primary Immune Response: First Exposure: The primary immune response occurs when the immune system encounters a specific pathogen (or antigen) for the first time. Latency: It takes several days for the immune system to mount a substantial response during the primary immune response. Effector Cells: During the primary response, the body produces effector cells (such as plasma cells and cytotoxic T cells) specific to the encountered pathogen. Antibody Production: Antibody production starts, and antibody levels rise gradually. The peak antibody levels reached during the primary response are lower compared to the secondary response. Memory Cells: After the primary response, memory B cells and memory T cells are formed. These cells "remember" the specific pathogen and facilitate a faster and stronger response upon re-exposure. 2. Secondary Immune Response: Subsequent Exposure: The secondary immune response occurs upon re-exposure to the same pathogen, after the immune system has encountered it before. Rapid and Stronger Response: The secondary response is much faster and stronger than the primary response. Effector Cells: Memory B cells and memory T cells are activated. Memory B cells quickly differentiate into plasma cells, producing large quantities of antibodies. Memory T cells are rapidly activated, leading to a swift and robust cytotoxic response. Antibody Production: Antibody production is rapid, and the peak antibody levels reached during the secondary response are significantly higher than in the primary response. Duration: The secondary response is prolonged and results in a more prolonged immunity compared to the primary response. Comparison: Speed: The secondary response is faster because memory cells are already present and do not need time to be generated. Strength: The secondary response is stronger due to the rapid and robust activation of memory cells, leading to higher antibody levels and a more potent cytotoxic response. Duration: The secondary response provides longer-lasting immunity due to the presence of memory cells. Measurements of Differences: Antibody Levels: The concentration of specific antibodies in the bloodstream can be measured. In the seco

List the 3R's of animal research and briefly describe each.

Reduce: involves reducing the number of animals in an experiment or maximizing the information obtained per animal Refine: involves modifying the experiment to minimize pain or suffering Replace: involves avoiding or "replacing" the use of animals in an experiment

Describe the relationships between vaccination rates, disease transmission rates, and infection rates. How does increasing the vaccination rate for a disease affect the other two rates?

Relationships Between Vaccination Rates, Disease Transmission Rates, and Infection Rates: Vaccination Rates: Vaccination rates refer to the percentage of a population that has received a specific vaccine. Higher vaccination rates indicate a larger proportion of the population is immune to the targeted disease. Disease Transmission Rates: Disease transmission rates indicate how easily a disease spreads from person to person within a population. Diseases with high transmission rates can rapidly infect susceptible individuals, leading to outbreaks and epidemics. Infection Rates: Infection rates represent the number of new cases of a disease occurring in a specific population over a defined period. It is a measure of how many people are getting sick. Impact of Increasing Vaccination Rates: Reduced Disease Transmission Rates: Higher vaccination rates lead to a reduction in disease transmission rates. When a significant portion of the population is immune to a disease, there are fewer susceptible individuals for the pathogen to infect. This reduces the chances of the disease spreading, leading to lower transmission rates. Decreased Infection Rates: As disease transmission rates decrease due to higher vaccination rates, the infection rates also decline. Fewer people become infected because the disease has fewer opportunities to spread within the population. This results in a decrease in the number of new cases. Herd Immunity: Herd immunity (also known as community immunity) occurs when a high percentage of the population is vaccinated against a specific disease, providing indirect protection to those who are not immune, including individuals who cannot receive vaccines due to medical reasons. Herd immunity slows down the spread of diseases, making it difficult for outbreaks to occur, even among unvaccinated individuals. Threshold for Herd Immunity: The threshold for herd immunity varies for different diseases and is determined by the disease's basic reproduction number (R₀), which indicates how many people, on average, one infected person will further infect in a completely susceptible population. The higher the R₀, the higher the vaccination rate needed to achieve herd immunity and prevent outbreaks. Vaccination Ra

List the functions of ribosomes

Ribosomes are essential cellular organelles that play a central role in the process of protein synthesis. Their main functions include: 1. Protein Synthesis: Ribosomes are the sites of protein synthesis in cells. They read the genetic information encoded in mRNA (messenger RNA) and use this information to assemble amino acids into a polypeptide chain, forming a functional protein. 2. Translation: Ribosomes facilitate the translation of the genetic code from nucleic acid language (mRNA) to the language of proteins (amino acids). They ensure that the correct amino acids are added to the growing polypeptide chain in the order specified by the mRNA sequence. 3. Catalysis of Peptide Bonds: Ribosomes catalyze the formation of peptide bonds between adjacent amino acids. The ribosomal RNA (rRNA) molecules within the ribosomes act as ribozymes, enzymes made of RNA, which facilitate the chemical reaction of peptide bond formation. 4. Reading the Genetic Code: Ribosomes accurately read the sequence of codons on mRNA and match them with the appropriate amino acids carried by tRNA (transfer RNA) molecules. This process ensures that the correct amino acid sequence is produced according to the instructions in the mRNA. 5. Facilitating Protein Folding: Ribosomes provide a structured environment for the nascent polypeptide chain, allowing it to fold into its functional three-dimensional shape as it is synthesized. Proper protein folding is crucial for the protein's biological activity. 6. Quality Control: Ribosomes have mechanisms to detect and remove incorrectly synthesized polypeptides. If errors occur during translation, the ribosomes can target the incomplete or misfolded proteins for degradation, maintaining the quality of the cellular proteome. 7. Regulation of Gene Expression: Ribosomes can influence gene expression by regulating the translation of specific mRNAs. Regulatory proteins and non-coding RNAs can interact with ribosomal components, modulating the translation efficiency of target mRNAs. 8. Cellular Differentiation: Ribosomal activity can vary in different cell types and during different stages of development. Changes in ribosomal function and protein synthesis contribute to cellular differentiation, allowing

List the steps in mRNA transcription and protein translation.

Steps in mRNA Transcription: 1. Initiation: - RNA polymerase binds to the promoter region of the DNA, indicating the start of a gene. - DNA strands separate, exposing the template strand. 2. Elongation: - RNA polymerase synthesizes a complementary RNA molecule by adding RNA nucleotides according to the template strand of DNA. - Adenine (A) in DNA pairs with uracil (U) in RNA. Cytosine (C) in DNA pairs with guanine (G) in RNA. - RNA polymerase moves along the DNA, unwinding it and continuously adding nucleotides to the growing mRNA strand. 3. Termination: - Transcription continues until a termination signal on the DNA template is reached. - RNA polymerase and the newly formed mRNA molecule are released. - In eukaryotes, mRNA undergoes further processing, including the addition of a 5' cap and a poly-A tail, as well as the removal of introns (non-coding regions). Steps in Protein Translation: 1. Initiation: - The small ribosomal subunit binds to the mRNA molecule. - The initiator tRNA carrying methionine (or formylmethionine in prokaryotes) binds to the start codon (AUG) on the mRNA. - The large ribosomal subunit joins, creating a functional ribosome. 2. Elongation: - Aminoacyl-tRNA molecules, each carrying a specific amino acid, enter the ribosome. - The ribosome moves along the mRNA, reading the codons one by one. - Aminoacyl-tRNA molecules bind to the complementary mRNA codons via base pairing. - Peptide bonds form between adjacent amino acids, creating a growing polypeptide chain. - The ribosome moves to the next codon, and the process continues. 3. Termination: - Translation continues until a stop codon (UAA, UAG, or UGA) is reached on the mRNA. - Release factors bind to the stop codon, causing the polypeptide chain to be released from the ribosome. - The ribosomal subunits dissociate, and the mRNA is released for recycling. These steps in mRNA transcription and protein translation are fundamental processes in gene expression, allowing the genetic information stored in DNA to be converted into functional proteins within cells.

Describe the 3 Rs of animal research and identify examples of ethical and unethical use of them

The 3 Rs of animal research represent a set of principles aimed at promoting the ethical use of animals in scientific research. These principles were first introduced by British scientists W.M.S. Russell and R.L. Burch in 1959 in their book "The Principles of Humane Experimental Technique." The 3 Rs stand for Replacement, Reduction, and Refinement, and they guide researchers and institutions in conducting experiments with animals in a manner that is more ethical and humane. Here's what each of the 3 Rs entails: Replacement: Definition: Replacement refers to the idea of finding alternatives to the use of animals in research whenever possible. This could involve the use of non-animal models such as computer simulations, cell cultures, or mathematical models. Goal: The primary goal of replacement is to entirely replace animal experiments with methods that do not involve animals, thus avoiding the use of living animals for scientific purposes. Reduction: Definition: Reduction involves minimizing the number of animals used in experiments. This can be achieved through better experimental design, statistical methods, and sharing of data, ensuring that the minimum number of animals necessary to obtain meaningful results is used. Goal: The goal of reduction is to decrease the overall number of animals used in research studies, thereby reducing the total impact on animal populations. Refinement: Definition: Refinement focuses on enhancing animal welfare and minimizing any pain, distress, or suffering experienced by animals used in research. This includes improvements in housing, handling, anesthesia, and other procedures to make the animals' experience as comfortable as possible. Goal: The goal of refinement is to improve the conditions and procedures under which animals are used in research, ensuring that any unavoidable use of animals is done with the utmost consideration for their well-being.

List the four steps in an adaptive immune response, and describe the steps for B cells, Helper T cells and Cytotoxic T cells.

The adaptive immune response involves a series of steps that enable the immune system to recognize, target, and eliminate specific pathogens. Here are the four steps in an adaptive immune response, along with descriptions of how B cells, Helper T cells, and Cytotoxic T cells participate in each step: 1. Antigen Recognition: B Cells: B cells recognize antigens directly through their surface B cell receptors (BCRs). When a BCR binds to a specific antigen, the B cell is activated. Helper T Cells: Helper T cells recognize antigens presented on antigen-presenting cells (APCs) through their T cell receptors (TCRs). This recognition activates the helper T cell, initiating the immune response. Cytotoxic T Cells: Cytotoxic T cells recognize antigens presented on infected or abnormal host cells through their TCRs. This recognition activates the cytotoxic T cell, allowing it to directly target the infected cell. 2. Activation and Clonal Expansion: B Cells: Once activated, B cells undergo clonal expansion, where they proliferate and differentiate into plasma cells. Plasma cells produce large quantities of antibodies specific to the antigen that activated the B cell. Helper T Cells: Activated helper T cells release cytokines that stimulate B cells to differentiate into plasma cells, enhancing antibody production. Helper T cells also help activate cytotoxic T cells and macrophages, amplifying the immune response. Cytotoxic T Cells: Activated cytotoxic T cells undergo clonal expansion and differentiate into effector cytotoxic T cells, which are specialized in killing infected or abnormal host cells. 3. Effector Phase: B Cells: Antibodies produced by plasma cells bind to antigens on pathogens, neutralizing them, marking them for destruction (opsonization), or activating the complement system. Helper T Cells: Helper T cells continue to secrete cytokines, enhancing the activity of B cells, cytotoxic T cells, and other immune cells. They regulate and support the immune response. Cytotoxic T Cells: Effector cytotoxic T cells recognize and kill infected or abnormal host cells by inducing apoptosis (programmed cell death) in the target cells. 4. Contraction and Memory: B Cells: After the infection is cleared, most plasma cells und

Differentiate between systemic and pulmonary circuits. What is the function of each?

The cardiovascular system is responsible for transporting blood throughout the body, delivering oxygen and nutrients to tissues and organs while removing waste products. The circulatory system operates through two main circuits: the systemic circuit and the pulmonary circuit. Here's how they differ in terms of structure and function: 1. Systemic Circuit: Structure: - The systemic circuit is the larger of the two circuits and includes all the blood vessels carrying oxygenated blood away from the heart, except for the pulmonary veins. - It encompasses arteries, arterioles, capillaries, venules, and veins throughout the body, excluding the lungs. Function: - The primary function of the systemic circuit is to deliver oxygenated blood to the body's tissues and organs. - Oxygenated blood is pumped out of the left ventricle of the heart and flows through the aorta, which branches into smaller arteries, arterioles, and capillaries. - In capillaries, oxygen and nutrients are exchanged for carbon dioxide and waste products in tissues. - Deoxygenated blood returns to the heart via venules, veins, and the superior and inferior vena cava to be pumped into the lungs for oxygenation. 2. Pulmonary Circuit: Structure: - The pulmonary circuit includes the blood vessels carrying deoxygenated blood to the lungs for oxygenation and the pulmonary veins carrying oxygenated blood back to the heart. - It comprises the pulmonary arteries, arterioles, capillaries within the lungs, pulmonary venules, and pulmonary veins. Function: - The primary function of the pulmonary circuit is to oxygenate the blood and remove carbon dioxide. - Deoxygenated blood from the body returns to the right atrium of the heart via the superior and inferior vena cava. From the right atrium, it is pumped into the right ventricle. - The right ventricle then contracts and pumps the deoxygenated blood into the pulmonary arteries, which carry it to the lungs. - In the lungs, the blood releases carbon dioxide and picks up oxygen through the process of respiration, occurring in the pulmonary capillaries. - Oxygenated blood returns to the left atrium of the heart via the pulmonary veins. From there, it is pumped into the left ventricle and then into the systemic circu

Explain the central dogma of biology.

The central dogma of biology is a fundamental concept that describes the flow of genetic information within a biological system. It was first proposed by Francis Crick in 1957. The central dogma outlines the two-step process by which genetic information stored in DNA is used to build proteins, which are the functional molecules of cells. The central dogma can be summarized in three main steps: 1. DNA Replication: The process starts with DNA replication, during which the DNA molecule makes an exact copy of itself. This occurs before a cell divides, ensuring that each daughter cell receives a complete set of genetic information. DNA replication takes place in the cell nucleus and results in the formation of two identical DNA molecules, each consisting of one original (parental) strand and one newly synthesized (daughter) strand. 2. Transcription: The next step is transcription, during which the information encoded in a specific gene of the DNA is transcribed into a complementary RNA molecule. Transcription occurs in the cell nucleus and is carried out by an enzyme called RNA polymerase. The RNA molecule, known as messenger RNA (mRNA), is complementary to the DNA template strand. The mRNA carries the genetic information from the DNA to the ribosomes, the cellular machinery where protein synthesis occurs. 3. Translation: The final step is translation, in which the information carried by the mRNA is used to assemble a specific sequence of amino acids into a functional protein. Translation takes place in the cytoplasm of the cell, specifically on ribosomes. Transfer RNA (tRNA) molecules bring amino acids to the ribosome, where they are linked together in the correct order according to the instructions carried by the mRNA. This forms a polypeptide chain, which then folds into a functional protein. It's important to note that while the flow of genetic information from DNA to RNA to protein is the central dogma, there are exceptions and additional complexities in gene expression. For example, some RNA molecules (such as ribosomal RNA and transfer RNA) are involved in cellular processes without being translated into proteins. Additionally, there are processes such as reverse transcription (seen in retroviruses like HIV

Explain how DNA base pairs can be said to "code for" specific amino acids

The genetic code is the set of rules by which information encoded in DNA sequences is translated into proteins. This process involves two key steps: transcription, where a specific segment of DNA is copied into RNA, and translation, where the information in RNA is used to build a corresponding sequence of amino acids, forming a protein. In the genetic code, sequences of three nucleotides in DNA (known as codons) correspond to specific amino acids. These codons code for amino acids based on complementary base pairing between the DNA codon and its corresponding mRNA codon during transcription. There are 64 possible codons (4 nucleotides arranged in triplets), and they code for 20 different amino acids, along with start and stop signals for protein synthesis. Here's how it works: Complementary Base Pairing: In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). During transcription, DNA is used as a template to synthesize RNA. Adenine in DNA pairs with uracil (U) in RNA. For example, the DNA sequence "ATG" pairs with the complementary RNA sequence "AUG." Amino Acid Assignment: Each mRNA codon codes for a specific amino acid. There are exceptions, but most amino acids are encoded by multiple codons. For example, the codons "GCU," "GCC," "GCA," and "GCG" all code for the amino acid alanine. Some amino acids are specified by only one codon; for instance, the codon "AUG" codes for methionine and serves as the start codon for translation. Transfer RNA (tRNA) Recognition: During translation, transfer RNA (tRNA) molecules, each attached to a specific amino acid, recognize the mRNA codons through complementary base pairing. The tRNA molecules have anticodons, which are complementary to the mRNA codons. The correct amino acid is brought to the growing polypeptide chain on the ribosome by the tRNA that recognizes the corresponding codon. Peptide Bond Formation: The ribosome facilitates the formation of peptide bonds between adjacent amino acids, linking them into a polypeptide chain according to the sequence of mRNA codons. In summary, DNA base pairs can be said to "code for" specific amino acids because the sequence of nucleotides in DNA (and its corresponding mRNA) provides a template that

Trace the path of blood through the systemic and pulmonary circuits. You don't need to know the name of each structure- just the ones we specifically labeled- like the aorta, ventricles, atria, pulmonary artery, pulmonary vein

The human circulatory system operates through two interconnected circuits: the systemic circuit and the pulmonary circuit. Here's a detailed description of the path of blood through both circuits: Pulmonary Circuit: 1. Right Atrium: Deoxygenated blood from the body returns to the heart via the superior and inferior vena cava and enters the right atrium of the heart. 2. Right Ventricle: The right atrium contracts, forcing the blood through the tricuspid valve into the right ventricle. 3. Pulmonary Artery: When the right ventricle contracts, it pushes the deoxygenated blood through the pulmonary valve into the pulmonary artery. 4. Lungs: The pulmonary artery carries the deoxygenated blood to the lungs, where it branches into smaller arteries, arterioles, and eventually capillaries in the pulmonary alveoli (air sacs). 5. Pulmonary Capillaries: In the lungs, the deoxygenated blood releases carbon dioxide and picks up oxygen through the process of respiration in the pulmonary capillaries. 6. Pulmonary Veins: Oxygenated blood returns to the heart via the pulmonary veins. Systemic Circuit: 1. Left Atrium: Oxygenated blood from the lungs enters the left atrium of the heart via the pulmonary veins. 2. Left Ventricle: The left atrium contracts, forcing the blood through the mitral valve into the left ventricle. 3. Aorta: When the left ventricle contracts, it pushes the oxygenated blood through the aortic valve into the aorta, the body's largest artery. 4. Arteries: The aorta branches into smaller arteries, which further divide into arterioles and then into even smaller vessels, delivering oxygenated blood to various parts of the body's tissues and organs. 5. Capillaries: Arteries lead to capillaries within the tissues. In the capillaries, oxygen and nutrients are exchanged for carbon dioxide and waste products in a process called tissue perfusion. 6. Venules and Veins: Deoxygenated blood is collected in venules, which merge into veins. Veins gradually increase in size and carry the deoxygenated blood back to the heart. 7. Superior and Inferior Vena Cava: Veins from the upper body (superior vena cava) and lower body (inferior vena cava) return the deoxygenated blood to the right atriu

Summarize how each of the 3 lines of defense (physical barriers and internal defenses of the innate immune system, and the adaptive immune system) work to fight pathogens.

The immune system has three lines of defense to protect the body against pathogens such as bacteria, viruses, and other harmful invaders. These lines of defense include physical barriers and internal defenses of the innate immune system, as well as the adaptive immune system. Here's a summary of how each line of defense works: **1. First Line of Defense: Physical Barriers (Innate Immune System): Physical and Chemical Barriers: The skin and mucous membranes act as physical barriers that prevent pathogens from entering the body. Mucus, stomach acid, and enzymes in body fluids provide chemical barriers that inhibit the growth of pathogens. Normal Flora: Beneficial microorganisms residing on the skin and mucous membranes outcompete harmful pathogens, preventing their colonization. **2. Second Line of Defense: Internal Defenses (Innate Immune System): Inflammation: When tissues are injured or infected, cells release chemicals that trigger inflammation. Inflammatory responses increase blood flow to the affected area, enhance immune cell recruitment, and facilitate tissue repair. Phagocytosis: Phagocytes, such as macrophages and neutrophils, engulf and digest pathogens and debris. These cells are capable of recognizing common features of pathogens and are part of the innate immune system. Natural Killer (NK) Cells: NK cells can recognize and destroy infected or abnormal host cells, including cancer cells, without prior exposure to them. **3. Third Line of Defense: Adaptive Immune System: Antigen Recognition: T cells and B cells, specialized immune cells, can recognize specific antigens (molecules unique to pathogens) through their antigen receptors. T cells recognize antigens presented on the surface of infected cells, while B cells recognize antigens directly. Immunological Memory: After an initial exposure to a pathogen, some T cells and B cells become memory cells. Upon subsequent encounters with the same pathogen, these memory cells can mount a faster and stronger response, leading to a quicker elimination of the pathogen. Humoral Immunity (B Cells): B cells can differentiate into plasma cells, which produce antibodies (also known as immunoglobulins). Antibodies can neutralize pathogens and mark them for destruc

Describe how the immune system could reject a transplanted organ

The immune system plays a critical role in protecting the body from harmful invaders such as bacteria, viruses, and other foreign substances. When a person undergoes an organ transplant, their immune system can recognize the transplanted organ as foreign tissue and mount an immune response against it. This rejection process can occur due to differences in antigens, which are specific molecules or markers on the surface of cells. Here's how the immune system could reject a transplanted organ: Antigen Recognition: Every cell in the body has a unique set of antigens on its surface, which the immune system uses to recognize self from non-self. Antigens help the immune system distinguish between the body's own cells and foreign cells. When a person receives a transplant, the antigens on the transplanted organ might not perfectly match the recipient's antigens. T-cell Activation: T-cells are a type of white blood cell that plays a central role in the immune response. If T-cells encounter foreign antigens on the surface of transplanted cells, they become activated. This activation triggers an immune response, leading to the destruction of the transplanted cells. Antibody Response: B-cells are another type of white blood cell that produces antibodies. Antibodies are proteins that can specifically recognize and bind to foreign antigens. If B-cells recognize antigens on the transplanted organ as foreign, they produce antibodies against it. These antibodies can directly attack the transplanted cells or trigger other immune responses that lead to organ damage. Inflammation and Tissue Damage: The activation of immune cells and the production of antibodies can lead to inflammation and tissue damage in the transplanted organ. Inflammation can impair the function of the organ and, if left unchecked, can lead to rejection.

Predict signs and symptoms a person might experience if they were lacking one or more types of immune cells or immune functions listed above in 3-9

The signs and symptoms a person might experience if they lack specific immune cells or immune functions can vary widely based on the type of immune deficiency and its severity. Here are some general predictions for specific immune deficiencies: Lack of B Cells (Humoral Immune Deficiency): Recurrent Infections: B cells are essential for producing antibodies. Without functional B cells, individuals are more susceptible to bacterial infections, especially encapsulated bacteria (e.g., Streptococcus pneumoniae), leading to recurrent respiratory, ear, and sinus infections. Decreased Antibody Levels: Lack of antibodies can lead to reduced immunity against common pathogens, making individuals vulnerable to infections that others can fight off easily. Lack of T Cells (Cellular Immune Deficiency): Severe or Chronic Infections: T cells are crucial for fighting intracellular pathogens, including viruses and certain bacteria. Without functional T cells, individuals are prone to severe and chronic viral, fungal, and opportunistic bacterial infections. Conditions like HIV/AIDS lead to the depletion of CD4+ T cells, weakening the immune system significantly. Failure to Control Infections: T cells help control infections and prevent them from becoming chronic. In their absence, infections can become uncontrolled and potentially life-threatening. Lack of Phagocytes (Phagocytic Immune Deficiency): Chronic Bacterial Infections: Phagocytes, such as neutrophils and macrophages, are crucial for engulfing and destroying bacteria. Without functional phagocytes, individuals are susceptible to recurrent and chronic bacterial infections, particularly skin and respiratory infections. Delayed Wound Healing: Phagocytes play a role in wound healing by removing debris and preventing infections. Lack of functional phagocytes can lead to delayed wound healing and persistent infections at injury sites. Complement Deficiencies: Increased Susceptibility to Infections: The complement system helps in the opsonization and lysis of pathogens. Deficiencies can result in increased susceptibility to certain bacterial infections, especially Neisseria species (e.g., Neisseria meningitidis causing meningitis) due to impaired complement-mediated lysis and o

List the important functions of platelets

Thrombocytes Blood clotting

Predict signs and symptoms that could occur if a patient had too many, or too few, red blood cells, white blood cells or platelets

Too Many RBCs (Polycythemia): Headaches: Increased RBCs can lead to thicker blood, causing headaches and migraines. Blurred Vision: Thickened blood can affect blood flow to the eyes, leading to vision problems. Fatigue: Despite more RBCs, oxygen delivery to tissues might still be insufficient, leading to tiredness. High Blood Pressure: Increased blood volume due to excess RBCs can elevate blood pressure. Itchiness and Redness: Excess RBCs can lead to skin changes like redness and itching (pruritus). Too Few RBCs (Anemia): Fatigue: Insufficient RBCs mean less oxygen delivery, causing fatigue and weakness. Pale Skin: Reduced hemoglobin can result in paleness of the skin and mucous membranes. Shortness of Breath: Due to decreased oxygen-carrying capacity of the blood. Dizziness and Headache: Insufficient oxygen to the brain can cause dizziness and headaches. Cold Hands and Feet: Poor circulation can lead to cold extremities. White Blood Cells (WBCs): Too Many WBCs (Leukocytosis): Fever: Elevated WBC count often indicates infection, which can cause fever. Pain or Swelling: Inflammation due to increased WBCs can cause pain and swelling. Redness and Warmth: Inflammatory responses might lead to redness and warmth at the site of inflammation. Fatigue: Chronic inflammation due to high WBCs can cause general fatigue. Enlarged Lymph Nodes: WBC disorders can cause lymph node enlargement. Too Few WBCs (Leukopenia): Frequent Infections: Decreased WBC count weakens the immune response, leading to frequent infections. Slow Healing: Wounds and infections may take longer to heal. Recurrent Fever: Due to inability to fight off infections effectively. Mouth Ulcers: Reduced immunity can lead to oral health problems, including mouth ulcers. Unexplained Weight Loss: Chronic infections due to low WBCs can cause weight loss. Platelets: Too Many Platelets (Thrombocytosis): Blood Clots: Elevated platelets can increase the risk of abnormal blood clot formation. Headaches: Clots in blood vessels can cause headaches and migraines. Dizziness: Clots may affect blood flow to the brain, leading to dizziness. Chest Pain: Clots in coronary arteries can cause chest pain (angina). Weakness or Numbness: Clots affecting blood flow to limbs can caus

Define transcription

Transcription is the biological process through which information encoded in a DNA sequence is copied into a complementary RNA (ribonucleic acid) molecule. This process is a crucial step in the central dogma of molecular biology, where genetic information flows from DNA to RNA and then to proteins. Here's how transcription works: 1. Initiation: Transcription begins with the binding of an enzyme called RNA polymerase to a specific region of the DNA called the promoter. The promoter acts as a signal, indicating the start of a gene. Once RNA polymerase is attached to the promoter, it separates the DNA strands. 2. Elongation: RNA polymerase moves along the DNA template strand, synthesizing a complementary RNA molecule. As it moves, it adds RNA nucleotides (adenine, cytosine, guanine, and uracil) that are complementary to the DNA template. RNA polymerase catalyzes the formation of phosphodiester bonds between these nucleotides, creating a growing RNA strand. 3. Termination: Transcription continues until RNA polymerase encounters a specific sequence in the DNA called the terminator. At this point, RNA polymerase and the newly synthesized RNA molecule are released from the DNA template. In bacteria, termination often involves a hairpin loop structure in the RNA molecule that causes the RNA polymerase to dissociate from the DNA. The RNA molecule produced during transcription is a complementary copy of the DNA sequence and is known as messenger RNA (mRNA) in protein-coding genes. mRNA carries the genetic information from the DNA to the ribosomes, where it serves as a template for protein synthesis during the process of translation. In summary, transcription is the process of synthesizing an RNA molecule using a DNA template, enabling the transfer of genetic information from DNA to RNA for various cellular functions.

Define translation

Translation is the biological process through which the genetic information carried by messenger RNA (mRNA) is decoded and used to assemble a specific sequence of amino acids into a polypeptide chain or protein. This process occurs on ribosomes, cellular structures composed of RNA and proteins, and is a fundamental step in gene expression, where the information stored in DNA is transformed into functional proteins. Here's how translation works: 1. Initiation: Translation begins with the binding of a small ribosomal subunit to the mRNA molecule. The small subunit, along with transfer RNA (tRNA) molecules, helps in locating the start codon, the specific three-nucleotide sequence (AUG) that signals the beginning of the protein-coding region. The initiator tRNA, carrying the amino acid methionine, binds to the start codon. 2. Elongation: During elongation, the ribosome moves along the mRNA molecule in a 5' to 3' direction. Each mRNA codon (a three-nucleotide sequence) specifies a particular amino acid. The appropriate tRNA molecule, carrying the corresponding amino acid, binds to the mRNA codon through complementary base pairing. The ribosome catalyzes the formation of a peptide bond between the amino acids carried by adjacent tRNA molecules, creating a growing polypeptide chain. As the ribosome moves along the mRNA, it reads the codons one by one, adding the corresponding amino acids and forming the polypeptide chain. 3. Termination: Translation continues until a stop codon (UAA, UAG, or UGA) is encountered on the mRNA. Stop codons do not code for any amino acid but signal the end of protein synthesis. When a stop codon is reached, release factors bind to the ribosome, causing the newly synthesized polypeptide chain to be released. The ribosomal subunits and other translation components dissociate from the mRNA, and the synthesis of the protein is complete. The resulting polypeptide chain folds into its functional three-dimensional shape, becoming an active protein molecule. Proteins are the workhorses of cells, performing a wide variety of tasks, including catalyzing biochemical reactions, providing structural support, transporting molecules, and serving as signals. In summary, translation is the process by whi

What is the process by which mRNA is processed into proteins?

Translation: tRNA molecules read the mRNA transcript and bring the corresponding amino acids to the ribosome to build a polypeptide chain

List the important functions of serum

Transport of Nutrients Removal of Waste Products Maintaining Electrolyte Balance Regulation of pH Immune Response Clotting and Hemostasis Maintaining Blood Pressure Buffering Capacity Hormone Transport Temperature Regulation Coagulation Cascade

Explain why vaccination allows the body to have a secondary response to a pathogen even if it is the first time the body is infected with it.

Vaccination allows the body to mount a secondary response to a pathogen even if it is the first time the body is infected with it because vaccines are designed to mimic natural infections without causing the disease. When a vaccine is administered, it contains harmless fragments of the pathogen, such as proteins or sugars, or weakened or inactivated versions of the pathogen. These components are recognized as foreign by the immune system, triggering immune responses similar to those that occur during a natural infection. Here's how vaccination leads to a secondary response, even on the first encounter with the pathogen: Memory Cell Formation: After vaccination, the immune system generates memory cells, including memory B cells and memory T cells. These cells "remember" the specific antigens presented in the vaccine. Rapid Recognition: If the person is later exposed to the actual pathogen, the memory cells recognize the pathogen's antigens immediately. This recognition is much faster and more efficient than the response during the primary exposure. Faster and Stronger Response: Memory B cells can quickly differentiate into plasma cells that produce antibodies specific to the pathogen. Similarly, memory T cells rapidly activate and coordinate the immune response. This secondary response is faster, more robust, and of higher magnitude compared to the primary response. Increased Antibody Levels: During the secondary response, the immune system produces a larger quantity of specific antibodies. These antibodies can neutralize the pathogen, prevent its entry into host cells, mark it for destruction by immune cells, or activate the complement system. The higher antibody levels achieved during the secondary response provide stronger protection against the pathogen. Long-Lasting Immunity: Memory cells can persist in the body for years or even a lifetime. This long-lasting immunological memory ensures that if the person is re-exposed to the same pathogen in the future, the immune system can respond rapidly and effectively, often preventing the person from developing the disease or reducing the severity of the illness. In summary, vaccination primes the immune system by generating memory cells specific to the pathogen,

What structures does air pass through when breathing in? When breathing out? Be able to put in order (lungs, pharynx, larynx, bronchioles, bronchi, alveoli, trachea)

When breathing in, air passes through a series of structures in the respiratory system before reaching the lungs. The main structures involved in inhalation are: 1. Nostrils: Air enters the respiratory system through the nostrils. Hairs in the nostrils filter out large particles from the incoming air. 2. Nasal Cavities: After passing through the nostrils, the air travels through the nasal cavities. The nasal cavities are lined with moist mucous membranes that help humidify and filter the air further. Small hair-like structures called cilia also help trap particles and move them out of the respiratory system. 3. Pharynx (Throat): From the nasal cavities, air moves into the pharynx, which is a common passage for both air and food. The epiglottis, a flap-like structure, prevents food from entering the airway during swallowing. 4. Larynx (Voice Box): Below the pharynx is the larynx, which contains the vocal cords. The larynx plays a crucial role in speech production. 5. Trachea (Windpipe): The air then travels into the trachea, a tube reinforced with rings of cartilage to keep it open. The trachea conducts air further down into the respiratory system. 6. Bronchi: The trachea divides into two bronchi, one entering each lung. The bronchi continue to divide into smaller bronchial tubes, ultimately forming a network throughout the lungs. 7. Bronchioles: Bronchi further divide into smaller tubes called bronchioles, which eventually lead to tiny air sacs called alveoli. When breathing out, the process is essentially the reverse: 1. Alveoli: Oxygen in the inhaled air passes from the alveoli into the bloodstream, while carbon dioxide, a waste product of cellular respiration, passes from the bloodstream into the alveoli. 2. Bronchioles and Bronchi: Carbon dioxide-rich air travels back up the bronchioles and bronchi. 3. Trachea: Carbon dioxide-rich air moves up the trachea. 4. Larynx: The air passes through the larynx. 5. Pharynx: The air moves through the pharynx. 6. Nostrils: Finally, the air exits the body through the nostrils during exhalation. This entire process of inhaling and exhaling ensures the exchange of gases (oxygen and carbon dioxide) in the lungs, which is vital for cellular respiration and the body's overa

Describe the first response to a pathogen that is elicited by a vaccine. What types of immune responses occur? Think of both the innate and adaptive responses, and the responses by both B and T cells

When the body encounters a pathogen through vaccination, it initiates a series of immune responses to defend against potential infections. These responses involve both the innate and adaptive immune systems and include the activation of various immune cells, such as B cells and T cells. Here's a description of the first responses to a pathogen elicited by a vaccine: **1. Innate Immune Response: Recognition: Innate immune cells, such as dendritic cells and macrophages, recognize the presence of vaccine components (antigens) as foreign invaders. Phagocytosis: Phagocytic cells engulf and digest the vaccine particles, breaking them down into smaller fragments. Antigen Presentation: Dendritic cells process the antigen fragments and present them on their surface using molecules called major histocompatibility complexes (MHC). This process is essential for the activation of adaptive immune responses. Inflammatory Response: The innate immune system triggers inflammation at the injection site, recruiting immune cells and enhancing the immune response. 2. Adaptive Immune Response: B Cell Activation: Antigen-presenting cells, particularly dendritic cells, present antigen fragments to B cells. Activated B cells differentiate into plasma cells, which produce antibodies specific to the vaccine antigen. T Cell Activation: Antigen-presenting cells also present antigen fragments to helper T cells. Helper T cells become activated and secrete cytokines, enhancing both B cell and cytotoxic T cell responses. Cytotoxic T Cell Activation: Some antigens are processed and presented by infected cells. Cytotoxic T cells recognize these antigens on infected cells, leading to the destruction of infected cells. Antibody Production: Plasma cells produce antibodies that circulate in the bloodstream. These antibodies can neutralize the pathogen, mark it for destruction, or activate the complement system. Memory Cell Formation: Both memory B cells and memory T cells are formed. Memory B cells "remember" the antigen and can rapidly differentiate into plasma cells upon re-exposure. Memory T cells similarly remember the antigen and respond more swiftly upon re-infection, enhancing the immune response's speed and effectiveness. In summary, the fi