Biology - Homework ch 15

What enzyme is responsible for repairing thymine dimers using the energy of light?

DNA photolyase.

During the cell cycle, why is the change in DNA content from 2n to 4n gradual, but the change from 4n to 2n is abrupt?

DNA replication happens gradually over S phase, whereas cell division happens quickly in M phase.

Which of the following statements regarding the repair of thymine dimers is TRUE?

Excision repair can be used to repair thymine dimers as well as other types of damaged DNA.

After a tautomeric shift in adenine

adenine bonds with cytosine

What kind of bond do thymine dimers weaken?

hydrogen bonds

Slipped-strand mispairing requires that a DNA sequence be present

in multiple copies on both homologous chromosomes.

A _______ can alter the structure of a protein (but not the total number of amino acids) so that it now has abnormally high activity.

missense mutation

Which of the following statements about cancer is FALSE?

most cancer involve genetic changes that are passed from parent to offspring

You are examining a gene that normally has the sequence ACGATTTGGCGC But in the mutant fruit fly you have produced, you see the sequence ATGATTTGGTGT What likely caused this mutation?

mutations induced by HNO2

Cystic fibrosis is caused by mutation of the CFTR gene. There are many known mutations that result in a non-functioning protein. What kind of mutation is presented here in one example of a mutation that will cause the symptoms of cystic fibrosis?

nonsense

The nucleic acid sequence in mRNA is determined by

nucleotide sequence of DNA

A mutation causes a gene to become overactive, contributing to uncontrolled cell growth. Which term best describes this gene?

oncogene

The protein ________ checks for damaged DNA, thereby acting as a "quality control" for the cell.

p53

During slipped-strand mispairing, homologous chromosomes

pair up with each other, but out of register

The Ras protein normally regulates cell growth. A mutation that occurs in the gene encoding Ras can cause Ras to become overactive, which results in cancer. This means that Ras is an example of a/an

proto-oncogene.

The mutations observed by the Lederbergs were

spontaneous

When a tautomeric shift occurs, the resulting nulceotide is a(n) __________ of the nucleotide prior to the shift.

structural isomer

In light repair

the covalent bonds between the thymine dimers are broken

Tay Sachs disease is caused by a mutation in the HEXA gene. There are a number of mutations that are known to cause the symptoms of Tay Sachs. What kind of mutation is presented in this interactive?

Frameshift

Sequence the following steps in the development of cancer in an individual with xeroderma pigmentosum (XP).

1.Mutation in DNA repair enzyme gene 2.Exposure to UV light 3.Mutation of a tumor - suppressor gene 4.Benign growth 5.Malignant growth 6.Metastasis

Select the ABCC11 gene, the earwax gene. A mutation in this gene determines whether a person has wet earwax or dry earwax. Looking at the Template Strand, what type of mutation occurs?

A missense mutation resulting from a change in nucleotides from a C to a T

Which of the following mutagens might increase the incidence of slipped-strand mispairing?

A mutagen that stabilized single-stranded DNA

Which mutation would allow the cell to pass the G1 checkpoint when it should not?

A mutation in Rb, preventing it from associating with E2F.

What result is characteristic of slipped-strand mispairing mutation?

A protein that, starting at the point of the deletion, has incorrect amino acids and is of abnormal length

Mutations in the gene that codes for the protein p53 have been implicated in many types of cancer. The p53 protein has a diverse regulatory role, including stopping the cell cycle at G1/S checkpoint when there is damaged DNA, inducing NER mechanisms, and initiating apoptosis. Which of the following mechanisms might result in reduced levels of functional p53 in the cell?

A virus, such as HPV, inactivates p53

Consider the mutated sequence for Tay Sachs Disease. How many amino acids are changed by the insertion mutation?

All of the amino acids starting at the site of the insertion

Which of the following viruses can cause cancer?

All of the choices are correct.

Which of the following tumor-suppressor genes encode proteins that inhibit cell division when cell conditions are unfavorable?

All of these tumor-suppressor genes, so they all produce proteins that inhibit cell division

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?​ Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC ​Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

Base addition - frameshift

Why is breast cancer a very deadly form of cancer?

Because breasts contain numerous blood vessels and lymph nodes, so breast cancer can easily metastasize and spread throughout the body

Why are people afflicted with xeroderma pigmentosa likely to develop skin cancer?

Because they are born with a mutation in their DNA repair system and they cannot repair DNA that is mutated by UV radiation

Which of the following is not a reason why cells need to be able to repair damaged DNA?

Cells need to change base pairs to be able to express different types of proteins

Cancer progression can result from mechanisms other than mutation (change in the DNA sequence). Which of the following is not an example of such a mechanism?

Chromosomes could be lost during meiosis.

Which of the following synthesizes the new DNA strand?

DNA Polymerase

What characteristic of DNA makes nucleotide excision repair (NER) mechanisms possible?

DNA is a double helix so once the damaged region is recognized, it can be removed and synthesized based on the opposite strand.

At what phase of the cell cycle does p53 halt cell division if it senses DNA damage?

G1

Cells require certain nutrients to support cell division. There are not sufficient nutrients to support cell division

G1 Checkpoint

DNA is damaged and DNA content is 2n

G1 Checkpoint

DNA is damaged and DNA content is 4n

G2 Checkpoint

DNA replication is incomplete

G2 Checkpoint

To maintain the integrity of the DNA in the daughter cells, DNA is evaluated before cell division. At which checkpoint would DNA monitoring occur?

G2 Checkpoint

In a tautomeric shift

Hydrogen atoms move to form a base with altered hydrogen properties

Select the cell cycle impairments that you predict would lead to cancer. Recall that cancer arises from unregulated, repeated cell divisions. Choose all that apply.

Impaired degradation of cyclins Loss of function of important M phase checkpoint Proteins Loss of function of important G2 phase checkpoint proteins

When a tautomeric shift occurs, which of the following is TRUE?

In the new DNA strand, a purine is always replaced by a purine, and a pyrimidine is always replaced by a pyrimidine.

The rate of transcription for a gene is found to be affected by a mutation. Where would you expect the mutation to appear on the DNA?

In the promoter for the gene

Which of the following is not a mechanism by which viruses could cause cancer?

Infection by a virus could cause the immune system to kill the infected cells by apoptosis.

How does myc become active?

It dissociates from Rb.

One chromosome is not attached to the spindle apparatus

Metaphase Checkpoint

Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the b-globin gene?

Missense

Which mutation would allow the cell to divide when it should not and could possibly lead to cancer?

None of these will lead to cell proliferation

Sickle cell anemia is caused by a base substitution mutation in the HBB gene. Look at the Template DNA for the non-mutated strand and the mutated strand and find the site of the point mutation. Using the genetic code, what mutation could happen at this same site that would result in a silent mutation? (Note: a copy of the genetic code is provided in the supplemental information found by clicking on the circled "i" in the upper right corner of the interactive.)

None, both codons for Glu have an A as the second nucleotide

MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and an increased rate of cell division, then the mutated gene is called a(n)

Oncogene

CCR5 is a cell surface receptor protein of white blood cells that attracts them to specific tissue and organs to elicit an immune response. It is also the receptor to which R5 strains of HIV bind to and enter T cells. Between 5-14% of people from Northern European descent possess an allele known as CCR5-Δ32. In this allele, a 32 base pair section of the gene has been deleted. What phenotype would you predict for people carrying the CCR5-Δ32 allele?

People with CCR5-Δ32 will likely have impaired immune function, but will have resistance to HIV infection.

Which of the following statements about the repair mechanism involving photlyase is TRUE?

Photolyase is oxidized and the damaged DNA is reduced.

You isolate a cell and wish to determine its current cell cycle phase. You decide to do this by measuring cyclin levels. You find low but detectible levels of G1 cyclin and S cyclin, and no measurable M cyclin. In which cell cycle phase is this cell?

S

The following sequence of DNA is the normal, wild-type gene. 5' ATG CGG GTA GTT AGC CGA TAG 3'An insertion occurs during DNA replication, causing an additional guanine to be inserted into the nucleotide strand after the guanine shown in red. What effect will this have on the final protein?

The addition of the G will cause a frame shift, resulting in a premature stop codon and a truncated protein.

A mutation has occurred that prevents UvrA and UvrB from forming a complex. What result will this have on damaged DNA?

The damaged DNA will not be recognized

A mutation has occurred that has made UvrD nonfunctional. What result will this have on damaged DNA?

The damaged segment of DNA will be recognized and cut, but it will not be separated from the healthy strand.

The following sequence of DNA is part of the normal, wild-type gene. 5' ATG CGG GTA GTT AGC CGA TAG 3' A deletion occurs during DNA replication, causing the guanine shown in red to be removed from the nucleotide strand. What effect is this most likely to have on the final protein?

The deletion of the G will cause a frame shift, resulting in a premature stop codon and a truncated protein.

Evaluate the following statements and determine which is the most likely explanation for how the methylation of a guanine might induce mutations in the DNA?

The guanine will not properly hydrogen bond with cytosine across the double helix.

A pregnant mother recently had an ultrasound that indicated massive defects in the formation of her unborn baby's heart. Other oddities were noted in the spinal cord region, the kidneys, and the formation of the facial features. She had an amniocentesis to examine the baby's karyotype, and it was noted that there was a deletion of a small piece of one chromosome. The doctors advised her that her that she would likely miscarry. The parents consult you as a genetic advisor on the likelihood that a future pregnancy would exhibit similar phenotypes. What advice do you give this couple?

The mutation was probably a germ line mutation that only affected a single egg or sperm, so they should try to have more children

If a frameshift mutation causes a stop codon to be inserted into the DNA sequence,

The resulting protein will be too short and non-functional.

Which of the following is most likely to occur when a tumor-suppressor gene is mutated?

The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation.

Many genes that are associated with cancer can become mutated due to slipped-strand mispairing. These genes include p53, retinoblastoma, Wilms tumor, and the breast cancer gene BRCA1. What characteristic would you expect to find in all these genes?

They all have repetitive sequences in the gene.

The growth factors illustrated in this system are positive regulatory growth factors. Why are they considered "positive" growth factors?

They increase the rate of cell proliferation.

Cancers originate from a single cell.

True

Most oncogenes encode proteins that function in cell growth signaling pathways.

True

How does ultraviolet light result in the formation of thymine dimers?

Ultraviolet lightprovides the energy for covalent bond formation between two thymines

Which protein cuts the damaged DNA strand?

UvrC

Which protein has a helicase function?

UvrD

Which of the following could not result from mutations?

a fish in a stream dies from a poison that blocks cellular respiration

Slipped-strand mispairing may cause deletions resulting in

a frameshift mutation

A carcinogen is a chemical or treatment that

causes mutations that increases the likelihood of developing cancer

A nucleotide deletion in DNA replication

causes the amino acids inserted after the deletion to be incorrect

Many cells that have accumulated mutations are eliminated by ______

cell death.

Growth factor receptors are typically found in the

cell membrane

A mutation that causes a change in a single nucleotide in DNA

changes the corresponding nucleotide in mRNA, resulting in a different Codon

If a cell accumulates DNA damage during mitosis, the cell cycle can pause at a _________

checkpoint.

A _________ can cause fusion of two genes together, resulting in formation of a chimeric oncogene.

chromosomal translocation

A change in the number of _______ of a gene can cause too much protein to be made.

copies

UV light damages DNA by causing

covalent bonds to form between thymine nucleotides next to each other on the same DNA strand

How does UV light and other ionizing radiation damage DNA molecules?

creating thymine dimers between adjacent thymines in the DNA chain.

The proteins ________ work together to free the transcription factor that is bound by the retinoblastoma protein.

cyclin and cyclin dependent kinase (cdk)

If the protein retinoblastoma is ________, it can bind to and ________ the Myc protein.

dephosphorylated; inactivate.

Mutated forms of the Rb protein

do not bind to E2F thereby promoting uncontrolled cell division.

In the Ames test, mutagenicity is normally tested on a strain of bacterium (Salmonella typhimurium) that cannot synthesize the amino acid histidine. Therefore, these bacteria require histidine in the growth plate to survive. A researcher performs the Ames test to evaluate the mutagenicity of a newly synthesized compound and notices that Salmonella typhimurium is living on a histidine-free growth plate. What can be concluded from these results?

the newly synthesized compound induces a mutation in the bacteria and the bacteria produce histidine

The insertion of a ____________ into the promoter of a gene could result in increased expression of the gene, resulting in cancer.

virus

Which of the following statements about oncogenes is FALSE?

when Oncogenes are silenced, the cell cycle may be able to proceed even when it should not.

Oncogenes and tumor-suppressor genes have the shared property that

when either type of gene is mutated, cancer can result