Biology- Unit 2- Book & lecture notes - Genetics -ch 7, MS2, ch 8, MS3

Where is DNA found? What is DNA What is DNA made up of What is the simple unit (monomer) of DNA made up of

- DNA is found in the nucleus of a eukaryotic cells and in prokaryotic cells DNA is found in the ring. - deoxyribosenucleic acid - made up of four kinds of nitrogenous bases including adenine, guanine, thymine , cytosine - each base has a distinguish shape. A and G are larger - The DNA monomer is made up of A sugar phosphate, a base, and a phosphate - DNA is a deoxyribose sugar

The principle of base pairing in a double helix - in accordance with chargaff's rule: - complementary base pairs : TTATGGCACCGA - how many base pairs do every individual has

- The two strands of the double helix are held together by bonds between the bases In accordance with chargaff's rule: - A always pairs with T - G always pairs with C - complementary base pairs : AATACCGTGGCT - each individual has 3 billion base pairs

James Watson and Francis Crick - The double helix

- at the same time that Franklin developed her x-ray technique, Watson and crick were trying to determine DNAs structure using cardboard and wire models - franklin's images gave them just the information they needed to determine the structure The double helix -with the help of Franklin, Watson and crick determine that DNA was shaped like a double helix

What are some pros and cons of genetically modified organisms?

---The pros of GMO crops are that they may contain more nutrients, are grown with fewer pesticides, and are usually cheaper than their non-GMO counterparts. Food = Transgenic crops such as corn and soybeans usually contain genes for natural pesticides, which help the plants fight pests and reduce the amount of pesticide a farmer must use. Other varieties of GM crops contain herbicide-resistance genes, allowing farmers to spray herbicides on fields to kill weeds without at the same time killing the crops Medical = The drug insulin, used for treating diabetes, is commonly produced inside a genetically engineered bacterium—one into which the (human) insulin gene has been inserted. Through gene therapy—replacing a defective human gene with a healthy one—scientists hope to one day be able to treat, cure, or even prevent several inherited genetic disorders, including cystic fibrosis, Huntington's disease, and hemophilia. ---The cons of GMO foods are that they may cause allergic reactions because of their altered DNA and they may increase antibiotic resistance Health + environmental = Despite the many actual and potential benefits of genetic engineering, the practice inspires debate among scientists, environmentalists, and the general public alike. Some groups object to humans' meddling with the biology of organisms that have evolved naturally because they are afraid that eating GMOs might have negative effects on health. Others worry about the consequences to our environment

What is the structure of DNA, and how is DNA organized in cells?

A DNA molecule is made up of two strands of subunits linked together in long chains. each subunit—called a nucleotide—has three parts: a sugar, a phosphate group, and a base The rungs of the DNA ladder, made up of the bases, are the most useful part of DNA for profiling. There are four different possible nucleotide bases: adenine (A), thymine (T), guanine (G), and cytosine (C).

1 If only 1.5% of the 3 billion nucleotides in our haploid genome encodes 20,000 genes, what would you predict about the average length (in nucleotides) of a human gene? 2 How many genes are encoded in the genomes of each of the following organisms? (Hint: You may need to do some online research.) a - humans 3 What were some surprises in the human genome?

1 -130,000,000 base pairs per chromosome -if the 3 billion base pairs of the human genome is divided into 23 chromosomes, the average size of a human chromosome is listed above 2 a- the human genome contains about 25000 genes, and assuming that they re spread evenly over the 23 chromosomes, on average there are 25,000 ÷ 23 chromosomes for 10867 genes per chromosome 3 - The number of nucleotides was much smaller than expected. - The number of genes was much smaller than expected. - A small new chromosome was discovered. - The sequence is extremely similar between different people.

1 What is DNA? 2 Where can we find it? 3 Match complementary base pairs. 4 Who are Chargaff, Franklin, Watson, & Crick 5 Describe the Telomere Hypothesis. 6 What is gene expression?

1 Deoxyribonucleic acid, or DNA, is a molecule that contains the instructions an organism needs to develop, live and reproduce. These instructions are found inside every cell, and are passed down from parents to their children 2 In organisms called eukaryotes, DNA is found inside a special area of the cell called the nucleus. Because the cell is very small, and because organisms have many DNA molecules per cell, each DNA molecule must be tightly packaged. This packaged form of the DNA is called a chromosome 3 DNA base pairs are always adenine with thymine (A-T) and cytosine with guanine (C-G). 4 -Erwin Chargaff proposed two main rules in his lifetime which were appropriately named Chargaff's rules. The first and best-known achievement was to show that in natural DNA the number of guanine units equals the number of cytosine units and the number of adenine units equals the number of thymine units. - Rosalind Elsie Franklin, the brilliant chemist whose x-ray diffraction studies provided crucial clues to the structure of DNA and quantitatively confirmed the Watson-Crick DNA model. Rosalind Franklin discovered the density of DNA and, more importantly, established that the molecule existed in a helical conformation. Her work to make clearer X-ray patterns of DNA molecules laid the foundation for James Watson and Francis Crick's suggestion that DNA is a double-helix polymer in 1953. - In revealing the structure of DNA, James Watson and Francis Crick had solved one of the greatest mysteries of science—the chemical basis of inheritance. Their discovery would revolutionize biology and push forward the study of anthropology, evolution, and medicine. The discovery in 1953 of the double helix, the twisted-ladder structure of deoxyribonucleic acid (DNA). 5- - Telomeres are distinctive structures found at the ends of our chromosomes. They consist of the same short DNA sequence repeated over and over again. -Each time a cell divides, 25-200 bases are lost from the ends of the telomeres on each chromosome. - Hypothesis: Telomeres shorten with age (T cells, tissue with high cell turnover) - Therefore, telomere shortening is a cause of aging 6- - Gene expression is the process by which the instructions in our DNA are converted into a functional product, such as a protein. -When the information stored in our DNA is converted into instructions for making proteins or other molecules, it is called gene expression.

1 A protein is made up of a chain of _____. 2 What determines a protein's function? 3 Spidroin proteins are in an unfolded state in the spider's silk gland before they are extruded through the spinneret. In their unfolded state, will they have the same properties as spider fibers in a web? Explain your answer. 4 If the repeated alanines in spidroin were changed to amino acids with hydrophilic side chains, would they still cluster together away from water? Explain your answer.

1 amino acids 2 - the three-dimensional shape of the folded protein - the location of its gene on the chromosome - the sequence of amino acids 3 - No. Unfolded proteins do not have a three-dimensional shape and so will not be able to function, as the three-dimensional shape is critical for protein function. - No. They won't have the strength or elaciticity that the folded state would have. The folds called beta sheets give the silk its strength. 4 No. Hydrophilic side chains interact with water. They will not cluster together away from water, and the shape and functional properties of the changed protein will be altered.

1 Which of the following is not a nucleotide found in DNA? a - adenine (A) b - thymine (T) c - cytosine (C) d - guanine (G) e - uracil (U) 2 If the sequence of one strand of DNA is AGTCTAGC, what is the sequence of the complementary strand? 3 In addition to the base, what are the other components of a nucleotide? 4 The __________ chromosomes in a typical human cell are found in the __________. 5 Each chromosome contains

1 e - uracil (U) 2 TCAGATCG 3 phosphate and sugar 4 46; nucleus 5 DNA and proteins.

1 What technique did Rosalind Franklin use to examine the structure of DNA? 2 Which of the following statements about DNA structure is not true? a- DNA is a double helix. b - The phosphate groups are on the outside of the helix. c - The two strands run in opposite orientations. d - A pairs with A, T with T, C with C, and G with G. e - The helix has a constant diameter along its length 3 Describe the scientific contributions of Watson, Crick, Franklin, and Wilkins to the discovery of the structure of DNA.

1 x-ray diffraction 2 d - A pairs with A, T with T, C with C, and G with G. 3 Franklin carried out the key X-ray diffraction studies, as did Wilkins, who recognized that Franklin's data might be helpful to Watson and Crick. Watson and Crick synthesized existing information to build models that were consistent with the observed data. Franklin's experimental observations were critical in assembling the correct model, the one that accurately represented the structure of DNA.

12 Which STR will have migrated farthest through an electrophoresis gel? a - GAAG repeated twice b - GAAG repeated three times c - AGCT repeated five times d - GAAG repeated seven times e - AGCT repeated seven times 13 An individual's STR may vary from the same STR of another individual by 14 Which of the following represents genetic variation between individuals?

12 GAAG repeated twice 13 number of times a particular sequence is repeated. 14 the sequence of nucleotides along the length of each chromosome.

13 The insulin gene is normally expressed in specific cells in the pancreas, but not in a type of immune cell known as a B cell. On the other hand, B cells express large amounts of antibody proteins. What would you have to do get a B cell to express insulin? (Hint: Remember that all cells in an organism have the same set of chromosomes and associated genes.) 14 Why is recombinant protein production in yeast an efficient strategy? 15 What is the purpose of the vector in generating a transgenic organism? 16 Describe the recombinant gene that would be needed to create a transgenic spider that produces a yeast protein in its silk glands.

13 The regulatory sequence of the insulin gene would have to be replaced with a regulatory sequence of a gene normally expressed in B cells, such as antibody genes. The regulatory sequence of a gene normally expressed in B cells will permit expression of the insulin gene in B cells. 14 a. because yeast can easily be grown in large quantities b. because yeast can secrete large amounts of recombinant proteins into their growth medium 15 The vector is a "carrier" DNA molecule that carries the recombinant gene into the organism and its genome. 16 The recombinant gene would need a regulatory sequence from a spider silk gene and the coding sequence of the desired yeast gene.

17 "A gene contains many chromosomes. Each chromosome encodes a protein." Is this statement accurate? If not, explain why not, and rewrite the statement to make it correct. 18 What is the final product of gene expression? 19 Which person would have DNA that is least similar to yours? 20 How many STRs are typically used to create a profile in forensic investigations?

17 No, Chromosomes contain genes. Each gene encodes a protein. 18 a protein 19 your mother's brother 20 15

17 Why is it important that the transgenic yeast expressing recombinant spidroin proteins secrete the protein into their culture (growth) medium? (Hint: What has to happen to spidroin to convert it into actual silk?) 18 Melanin is a pigment expressed in skin cells; melanin gives skin its color. If you wanted to express a different gene in skin cells, which part of the melanin gene would you use? Why? If you wanted to produce melanin in yeast cells, what part of the melanin gene would you use? Why? 19 Lysozyme is a protein secreted in tears and saliva in all mammals. Amylase is a protein secreted in mammalian saliva. a - Describe the recombinant gene that you would assemble to express recombinant human lysozyme in the tears of goats. b - Describe the recombinant gene that you would assemble to express recombinant human amylase in goat saliva.

17 The spider silk proteins need to be spun into silk fibers. As yeast do not have spinning structures, they cannot spinand extrude silk fibers. Instead, the spider silk proteins are isolated from the yeast growth medium and then spun witha spinning apparatus. 18 In order to express a non-skin cell gene in skin cells, the gene must be controlled by a regulatory sequence from a skin cell gene. In this case, the regulatory sequence of the melanin gene would drive the expression of another gene in skin cells. In order to produce melanin in yeast cells, a yeast gene regulatory region should be connected to the melanin gene. 19 a.) In order to express human lysozyme in the tears of goats, the goat lysozyme gene regulatory sequence would be needed to drive the expression of the human lysozyme gene. b.) In order to express recombinant human amylase in goat saliva, the goat amylase gene regulatory region (which drives expression in goat salivary glands and saliva) would have to be connected to the human amylase coding sequence.

20 Why is transgenic technology needed to produce large quantities of spider silk? 21 Why is spider silk such a valuable product?

20 Spiders produce many kinds of silk, transgenic technology produces the kind that we use in order to build the material that goes into bulletproof vests, etc. Spiders, by themselves, can't produce enough silk on their own as quickly as neededIt is very time consuming, the process of extracting the silk from each spiderThe spiders could eat each other, get tired, who knows:) 21 Because it can be used to develop many products as it is stronger than steel and stretcher than spandex

Human cells have ---pairs of chromosomes; we inherit one chromosome of each pair from our mother and the other from our father, for a total of ---chromosomes.

23 46

The ----chromosome pair consists of the sex chromosomes, X and Y, which determine a person's sex. Men have ---, and pass on one or the other during reproduction. Women have ---, and therefore can only pass on an X.

23rd an X and a Y two Xs

DNA testing has helped the Innocence Project free more than ---people from prison since 1992, including ===who served time on death row

300 18

4 How did differing amounts of water in the DNA crystals help explain the x-ray diffraction patterns? 5 Summarize the structure of a DNA double helix.

4 The DNA stretched out in the presence of water, suggesting that the water must be interacting with and coating the molecule. As the charged phosphate groups are hydrophilic, and as the water was interacting with DNA on the surface of the DNA, the phosphate groups had to be on the outside of the molecule—a key insight. 5 The DNA double helix is arranged as antiparallel strands. Each strand has its phosphate groups oriented along the external backbone of the molecule, and the nucleotide bases oriented toward the interior of the helix. The bases from one strand pair with bases on the other strand according to specific rules: A pairs with T and G pairs with C. The helix has a constant diameter along its length.

5 "A gene contains many chromosomes. Each chromosome encodes a protein." Is this statement accurate? If not, explain why not, and rewrite the statement to make it correct. 6 What is the final product of gene expression? 7 For each structure or enzyme listed, indicate by N (nucleus) or C (cytoplasm) where it acts in the process of gene expression in a eukaryotic cell. _____ RNA polymerase _____ Ribosome _____ tRNA _____ mRNA

5 No. A true statement would be "A chromosome contains many genes. Each gene encodes a protein." (A gene is a small section of the DNA that makes up a chromosome) 6 . a protein 7 N__ RNA polymerase C__ Ribosome C__ tRNA It is made by transcription in the Nucleus, but acts in translation in the Cytoplasm.

6 You can detect DNA that is specifically from the X chromosome in a DNA sample from a person. Can you definitively determine the sex of that person (male or female) from the presence of the X chromosome? Explain your answer. 7 Human red blood cells are enucleated (that is, they do not have nuclei). Is it possible to isolate DNA from red blood cells? Why or why not? 8 DNA replication is said to be semiconservative because a newly replicated, double-stranded DNA molecule consists of

6 Both males and females have an X chromosome and you would have to check for the presence of a Y chromosome. 7 No, the genomic DNA is found only in nucleated cells. 8 one old strand and one new strand

7 How are genes expressed as proteins? 7.1-Work through the process 7.2- What are the key players? 7.3- Identify locations of different parts of the process 7.4- Figure out Codons

7- - Gene expression is a tightly regulated process that allows a cell to respond to its changing environment. - It acts as both an on/off switch to control when proteins are made and also a volume control that increases or decreases the amount of proteins made. 7.1 - There are two key steps involved in making a protein, transcription and translation. - Transcription is when the DNA in a gene is copied to produce an RNA transcript called messenger RNA (mRNA). - This is carried out by an enzyme called RNA polymerase which uses available bases from the nucleus of the cell to form the mRNA. - RNA is a chemical similar in structure and properties to DNA, but it only has a single strand of bases and instead of the base thymine (T), RNA has a base called uracil(U). -Translation occurs after the messenger RNA (mRNA) has carried the transcribed 'message' from the DNA to protein-making factories in the cell, called ribosomes. -The message carried by the mRNA is read by a carrier molecule called transfer RNA (tRNA). -The mRNA is read three letters (a codon) at a time. - Each codon specifies a particular amino acid. For example, the three bases 'GGU' code for an amino acid called glycine. - As there are only 20 amino acids but 64 potential combinations of codon, more than one codon can code for the same amino acid. For example, the codons 'GGU' and 'GGC' both code for glycine. - Each amino acid is attached specifically to its own tRNA molecule. - When the mRNA sequence is read, each tRNA molecule delivers its amino acid to the ribosome and binds temporarily to the corresponding codon on the mRNA molecule. - Once the tRNA is bound, it releases its amino acid and the adjacent amino acids all join together into a long chain called a polypeptide. - This process continues until a protein is formed. Proteins carry out most of the active functions of a cell. 7.2- - DNA (blueprint) - mRNA ( messenger) - ribosome (Contactor - translates directions) - tRNA ( builders) 7.3- - DNA = Nucleus - RNA polymerase = Nucleus - Ribosome = cytoplasm - tRNA = cytoplasm -mRNA = It is made by transcription in the Nucleus but acts in translation in the Cytoplasm. 7.4- - Sequence of three nucleotide bases which, together, code for an amino acid during the making of a protein. - mRNA codons are read from 5' to 3' , and they specify the order of amino acids in a protein from N-terminus (methionine) to C-terminus. Translation involves reading the mRNA nucleotides in groups of three; each group specifies an amino acid (or provides a stop signal indicating that translation is finished).

8 What is encoded by a single codon? 9 A gene has the sequence ATCGATTG. What is the sequence of the complementary RNA? 10 If a spider wasn't making the normal amount of its spidroin protein, would you suspect a problem in the regulatory or coding sequence of the spidroin gene? Explain your answer. 11 If you wanted to try to increase the amount of spidroin protein a spider produces, would you modify the regulatory sequence or the coding sequence? Explain your answer.

8 an amino acid 9 UAGCUAAC (remember in RNA there is no T thiamine. Instead it has U uracil) 10 It is likely that the regulatory region is not working properly. If the regulatory region is not working properly, the normal amount of protein won't be produced. As long as the coding sequence is normal, the protein that is produced will function, but there won't be enough of it. 11 In order to increase the amount of spidroin produced, the regulatory sequence should be altered to increase the level of gene expression.Altering the regulatory sequence in this way will increase the amount of mRNA, which in turn will increase the amount of protein produced.

8 What is a Genotype? a Phenotype? 9 Work through and example in action. 10 How can scientists get Medicine from Milk?

8/9- -Phenotype- When we describe how an organism, or living thing, looks we are describing its phenotype. Phenotype is the physical properties of an organism, everything you can observe from how they look to how they act. You can remember that phenotype is all about the physical because phenotype and physical both start with ''ph.'' - Genotype- what determines an organism's phenotype? It's mostly about genes. These different copies, or versions, of a gene are called alleles. Different combinations of alleles will make different phenotypes. The entire set of genes, including the specific alleles, found in an organism's DNA is known as its genotype . So an organism's genotype is the specific set of instructions it carries around in its cells. 10- -anti-thrombin prevent blood clots 1 - transgenics goats can produce massive amounts of the drug in a relatively short period of time 2- identify and cut out the gene that codes for the anti-thrombin then microinject hybrid gene into that goat embryo

9 Which of the following statements about PCR is true? a - DNA polymerase is the enzyme that copies DNA in PCR. b - Primers are not necessary for PCR. c - PCR does not require nucleotides. d - PCR does not generate a complementary DNA strand. e - PCR can make only a few copies of a DNA molecule. 10 Complete the statements below, and then number them to indicate the order of these two major steps necessary to copy a DNA sequence during PCR. Step # _____________ The enzyme _____________ "reads" each template strand and adds complementary nucleotides to make a new strand. Step # _____________ The two original strands of the DNA molecule can be separated by _____________. 11 Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA

9 a - DNA polymerase is the enzyme that copies DNA in PCR. 10 1. The two original strands of DNA molecule that can be separated by heat. 2. The enzyme polymerase "reads" each template strand and adds complementary nucleotides to make a new strand. 11 Step 1. The strands separate ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA Step 2. DNA polymerase adds complementary nucleotides, forming to new double helices

Human DNA sequences are about --- the same from to person to person (defining, in part, what makes us human, as opposed to some other species). In that last ---are unique sequence variations that give us our individuality—having brown eyes versus blue, for example, or light skin versus dark.

99.9% 0.1%

Protein AMINO ACIDS GENE GENE EXPRESSION

A macromolecule made up of repeating subunits called amino acids, which determine the shape and function of a protein. Proteins play many critical roles in living organisms The building blocks of proteins. There are 20 different amino acids. A sequence of DNA that contains the information to make at least one protein. The process of using DNA instructions to make proteins.

To understand how DNA replication works, note that the two strands of nucleotides in a DNA helix do not pair up randomly, but in a consistent pattern: These nucleotides pair preferentially because they are the right shape to form stable ----with each other. During DNA replication, each strand of DNA serves as a template for the creation of a new ---strand.

A pairs with T, and G pairs with C. hydrogen bonds complementary

TRANSFER RNA (tRNA) ANTICODON GENETIC CODE GENETICALLY MODIFIED ORGANISM (GMO) GENE THERAPY

A type of RNA that transports amino acids to the ribosome during translation. The part of a tRNA molecule that binds to a complementary mRNA codon. The set of rules relating particular mRNA codons to particular amino acids. An organism whose genome has been altered through genetic engineering techniques, often to contain a gene from another species. A treatment that aims to cure, treat, or prevent human disease by replacing defective genes with functional ones.

DNA PROFILE DNA REPLICATION COMPLEMENTARY HELICASE

A visual representation of a person's unique DNA sequence. The natural process by which cells make an identical copy of a DNA molecule. Fitting together; two strands of DNA are said to be complementary in that A in one strand always pairs with T in the other strand, and G always pairs with C. An enzyme that unwinds and unzips the DNA double helix during DNA replication.

GENETIC ENGINEERING VECTOR TRANSCRIPTION MESSENGER RNA (mRNA)

Altering or manipulating the DNA of organisms by modern laboratory techniques. A DNA molecule used to deliver a recombinant gene to a host cell. The first stage of gene expression, during which cells produce molecules of messenger RNA (mRNA) from the instructions encoded within genes in DNA. The RNA copy of an original DNA sequence made during transcription.

DNA POLYMERASE SEMI-CONSERVATIVE POLYMERASE CHAIN REACTION (PCR) GENOME

An enzyme that "reads" the nucleotide sequence of a DNA strand and incorporates complementary nucleotides into a new strand during DNA replication. DNA replication is said to be semiconservative because each newly made DNA molecule has one original DNA strand and one new DNA strand. A laboratory technique used to replicate, and thus amplify, a specific DNA segment. One complete set of genetic instructions encoded in the DNA of an organism.

what 2 bases have two hydrogen bonds between them? what 2 bases have three hydrogen bonds between them?

As and Ts Gs and Cs

Since 1994, the federal government has been collecting DNA profiles of offenders and storing this information in the ----a computer database that contains more than ---profiles from criminals convicted of specific crimes in all 50 states. Each profile consists of a banding pattern that represents ----specific STR regions scattered throughout our genomes Sharing the same number of repeated t any particular STR is relatively common- typically 5%-20% of peeps share the same pattern at any one STR site. But the combined pattern of STR repeats at multiple sites is unique each STR region has a unique name and chromosome location

Combined DNA Index System (CODIS), 10 million 15

genetic blueprint

DNA - everybody's DNA or blueprint is unique and the exception = identical twins

As with all organisms, the instructions to make proteins are encoded in the DNA, in genes. A gene is a sequence of DNA that provides instructions for making one or more proteins. These instructions come in the form of the particular ---making up the gene. Genes are found along the length of ---, with each specific chromosome carrying a unique set of genes.

DNA nucleotide sequence chromosomes

the blueprint of life. what does it store?

Deoxyribonucleic acid, or DNA biological information and serves as the instruction manual from which we are built.

Chargaff's Rule Rosalind Franklin

Erwin Chargaff - noticed that the percentage of guanine always equals the percentage of cytosine and that the percentage of adenine equals a percentage of thymine - however he didn't know why Rosalind Franklin - we knew DNA was essential to human life and Franklin was interested in figuring out DNA's structure - developed a technique to x-ray samples of DNA and develop these images on film - first to develop this and the picture of DNA

Erwin Chargaff's Work Provided a Clue to Base Pairing

Following a tip about the structure of bases, Watson and Crick were able to use a model to show that A-T pairs and G-C pairs were exactly the same width, explaining the consistent helix shape, and also accounting for Chargaff's finding that the amounts of A and T were equal to each other, as were the amounts of G and C

How does DNA profiling make use of genetic variation in DNA sequences?

Forensic scientists use these differences in STR lengths to distinguish between individuals. They purposely find STRs

What determines the shape of a protein molecule?

In cells, the amino acid chain of a protein folds into a distinct three-dimensional shape, or conformation, that underlies a protein's function The particular sequence of amino acids in a chain determines how the chain will fold. Interactions between amino acid side chains, and between these side chains and the surrounding water, influence the precise folding pattern. Amino Acid Sequence Determines Protein Shape and Function

How can organisms be genetically modified to produce recombinant proteins?

Organisms that have been genetically modified to contain genes from other species are called transgenic ("trans" means "across"—in this case, across species, from one to another). The method that scientists use to make a transgenic organism relies on the fact that every gene has two parts: a regulatory sequence and a coding sequence. Regulatory sequences are like on-off switches for genes: they determine when, where, and how much protein is produced from a gene. Coding sequences determine the identity of a protein: they specify the order, or sequence, of amino acids By combining the regulatory sequence of one species with the coding sequence of another, scientists can coax an unrelated organism to make the desired protein.

To create a DNA profile, scientists first use ---to increase the amount of DNA at multiple STR regions. Then they use a method called ----to separate the replicated STRs according to length. In gel electrophoresis, DNA is loaded into wells at the top of a thin ---and an ---is run through the gel from top to bottom. Because DNA is a ----, it will move through the gel along with the current. Shorter STRs—those with fewer numbers of repeats—are smaller and travel ===in the gel; longer ones ----

PCR gel electrophoresis gel electric current charged molecule farther do not travel as far.

Which part of a nucleotide (the sugar, phosphate, or base) can interact with water?

Phosphate and ribose sugar are very hydrophillic The simple answer is that nucleic acids will form double helicies in water (if they can) so as to get their more hydrophobic parts out of water. That being said, the bases are not necessarily hydrophobic, but they aren't as hydrophillic as the other parts.

CHAPTER 8 SUMMARY

Proteins are folded chains of amino acids that perform many functions in cells, such as transmitting signals, catalyzing chemical reactions, and generating force for movement. The order and identity of amino acids in a protein chain determine the shape and function of the protein. Genes provide instructions to make proteins. The process of using the information in genes to make proteins is called gene expression. Every gene has two parts: a coding sequence and a regulatory sequence. The coding sequence determines the identity of a protein; the regulatory sequence determines where, when, and how much of the protein is produced. Gene expression occurs in two stages, transcription and translation, which take place in separate compartments in eukaryotic cells. Transcription is the first step of gene expression, copying the information stored in DNA into mRNA. Transcription occurs in the nucleus. Translation, the second step of gene expression, uses the information carried in mRNA to assemble a protein. Translation occurs in the cytoplasm. Proteins are assembled by ribosomes with the help of tRNA, which delivers amino acids to the ribosome. The genetic code is the set of rules by which mRNA sequences are translated into protein sequences; the code is redundant and universal—shared by all living organisms. Through genetic engineering, genes from one species of organism can be inserted into the genome of another species of organism to make a transgenic organism. Transgenic organisms have numerous uses in biotechnology and health.

TRANSGENIC REGULATORY SEQUENCE CODING SEQUENCE RECOMBINANT GENE

Refers to an organism that carries one or more genes from a different species. The part of a gene that determines the timing, amount, and location of protein production. The part of a gene that specifies the amino acid sequence of a protein. Coding sequences determine the identity, shape, and function of proteins. A genetically engineered gene that contains portions of genes not naturally found together.

SHORT TANDEM REPEATS (STRs) GEL ELECTROPHORESIS

Sections of a chromosome in which short DNA sequences are repeated. A laboratory technique that separates fragments of DNA by size.

---are blocks of repeated DNA sequences found at points along our chromosomes. These sequences are noncoding, meaning they do not contain ---for making proteins.

Short tandem repeats (STRs) instructions

If a DNA molecule is 20%G, what is the %C? What is the %A?

So G + C = 40% of all bases, that means the rest of 60% are A-T pairs. Quantity of adenine A is the same as its pair thymine T so 60% = 30% A + 30% T. So this DNA molecule has 20% G, 20% C, 30% A and 30% T.

What were some of the challenges and surprises associated with sequencing the human genome?

Some found the idea absurd, especially given its then-estimated $3 billion price tag. Others thought the project a waste of time, and that efforts should be placed elsewhere. Some simply deemed the task impossible, given the state of sequencing technology at the time.

"On an equal weight basis, spider silk has a higher toughness than steel and Kevlar," But it's also flexible and elastic, which allows it to absorb the energy of whatever hits it. A rope of spider silk the diameter of a pencil could theoretically stop a jet landing on an aircraft carrier, though no one has tried that yet.

Strength (MPa) Spider silk is as strong as high-grade alloy steel and about half as strong as Kevlar. Extensibility (%) Silk is extremely elastic, and some silks are able to stretch up to four times their relaxed length. Toughness (MJ/m3) The combination of strength and extensibility make silks tougher than many engineered polymers like Kevlar.

One strand of a DNA molecule has the sequence ATGCTGA. What is the corresponding sequence on the second strand?

TACGACT

DEOXYRIBONUCLEIC ACID (DNA) CHROMOSOME NUCLEOTIDES DOUBLE HELIX

The molecule of heredity, common to all life forms, that is passed from parents to offspring. A single, large DNA molecule wrapped around proteins. Chromosomes are located in the nuclei of eukaryotic cells. The building blocks of DNA. Each nucleotide consists of a sugar, a phosphate group, and a base. The sequence of nucleotides (As, Cs, Gs, Ts) along a DNA strand is unique to each person. The spiral structure formed by two strands of DNA nucleotides held together by hydrogen bonds.

"junk science"

The only physical evidence linking Brown to the case was his teeth.---Kulakowski's bite mark studies show error rates—the rate at which experts have falsely identified bite marks as belonging to a particular person—as high as 91%. Hair analysis, another common type of evidence, can be equally unreliable

TRANSLATION RNA POLYMERASE RIBOSOME CODON

The second stage of gene expression, during which mRNA sequences are used to assemble the corresponding amino acids to make a protein. The enzyme that carries out transcription. RNA polymerase copies a strand of DNA into a complementary strand of mRNA. The cellular machinery that assembles proteins during translation. A sequence of three mRNA nucleotides that specifies a particular amino acid.

What are the steps of gene expression, and where in the cell do they occur?

The synthesis of a protein from the information encoded in a gene is called gene expression. When a cell makes the protein encoded by that gene, the gene is said to be "expressed" Genes that code for amino acid sequences are known as 'structural genes'. The process of gene expression involves two main stages: Transcription: the production of messenger RNA (mRNA) by the enzyme RNA polymerase, and the processing of the resulting mRNA molecule.

Why is knowing the sequence of the human genome important?

This epic text would be an indispensable medical tool. Scientists could, for example, scan the genome for genes that confer susceptibility to disease, which might lead to better treatments. It would enable diagnostic tests that could help predict the risk of developing certain diseases Comparing the human genome to the genomes of other organisms, for example, would shed light on our own evolution. The possible benefits to science were endless

Why were people wrongly convicted and placed on death row? Innocence Project lawyers have found several culprits:

dishonest witnesses, apathetic or overburdened lawyers, overzealous police officers, and mistakes in eyewitness identification.

What pieces of scientific knowledge were assembled in order to elucidate the structure of DNA?

When Crick and Watson came to the problem, they already knew, from the work of other scientists, that DNA was made up of nucleotides, each containing a sugar, a phosphate group, and one of four bases: adenine (A), thymine (T), cytosine (C), or guanine (G). The Double Helix, published in 1968. The sneak preview "gave several of the vital helical parameters." With that clue in hand, Watson and Crick then took a crucial conceptual step and suggested that the molecule was made of two chains of nucleotides. In 1952, Erwin Chargaff had found that any given DNA sample, no matter the organism, always contained equal amounts of adenine and thymine, and equal amounts of guanine and cytosine. This information was critical. As the helix had a smooth shape and a uniform thickness, and as the bases had to point toward the inside of the helix, the different-size bases somehow had to fit together in a way that allowed for a consistent width of the helix.

12 A change in DNA sequence can affect gene expression and protein function. What would be the impact of each of the following changes? How, specifically, would each change affect protein or mRNA structure, function, and levels? a - a change that prevents RNA polymerase from binding to a gene's regulatory sequence b - a change in the coding sequence that changes the amino acid sequence of the protein c - a change in the regulatory sequence that allows transcription to occur at much higher levels d - a combination of the changes in b and c

a.) If RNA polymerase cannot bind to the regulatory sequence, the gene will not be expressed. No mRNA will be produced, and therefore no protein. b.) A change in the coding sequence that changes the amino acid sequence of the protein can change the shape and function of the protein. There may be normal amounts of protein present, but the protein may not function. c.) A change in the regulatory sequence that increases the amount of gene expression will increase the amount of protein present because of the increased amount of mRNA present. The protein will function normally, but because there is now more of it, the overall activity may increase. d.) If the regulatory sequence is changed to increase levels of gene expression, more protein will be produced. But if the coding sequence is altered, the protein expressed will not function properly, resulting in an increase in the amount of nonfunctional protein.

During translation, the ribosome reads the mRNA transcript and translates it into a chain of ---. The sequence of nucleotides in the mRNA transcript specifies which amino acids should be joined together in the newly forming ---chain. Each of the 20 amino acids that occur in proteins is specified by a group of three mRNA nucleotides called a ---that functions like a word: for example, the codon GGU specifies the amino acid glycine. The actual building blocks of proteins—amino acids—are physically delivered to the ---by another type of RNA, called ---Each tRNA molecule serves as a kind of adaptor, with one end binding to a specific amino acid and the other end binding to the mRNA codon for that particular amino acid. The part that binds mRNA is called the ---because it base-pairs in a complementary fashion with the mRNA codon. When the amino acid-toting tRNA finds its mRNA codon match, it releases the amino acid to the ribosome, which adds it to the growing protein chain (

amino acids protein codon ribosome transfer RNA (tRNA). anticodon

Since nearly all cells contain DNA, scientists can collect evidence such as ---,---,--,--,---from a crime scene and extract DNA from it to identify a perpetrator

blood, skin, semen, saliva, or hair

15 A person has an STR with the sequence GACCT repeated six times on one chromosome and eight times on the other chromosome. The STR is amplified by PCR, and the PCR product is run on a gel. Which lane (A-D) in this gel shows the banding pattern you would expect to see? The marker lane (M) has DNA fragments starting at 10 nucleotides (at the bottom) and increasing in 10-nucleotide increments. 16 A series of statements is presented below. Mark each statement as true (T) or false (F). a - ____________ G pairs with T. b - ____________ Genetic information is passed on to the next generation in the form of DNA molecules. c - ____________ All DNA sequences encode information to produce proteins. d - ____________ Each person carries the same number of STR repeats on both maternal and paternal chromosomes. e - ____________ DNA evidence can be obtained from saliva left in a bite mark.

c (look at pg 156) 16 a - f, b- t, c - f, d - f, e - t

Analysys calculation Peeps sharing this profile 1 STR region 0.2 1 in 5 2 STR regions 0.2x0.2 = 0.04 1 in 25 3 STR regions 0.2x0.2x0.2 = .008 1 in 125 5 STR regions

calculation - 0.2 x0.2 x0.2 x0.2 x0.2 = 0.00032 Peeps sharing this profile - 1 in 3,125

To extract DNA from a forensic sample, scientists typically use ---to separate cells from other material, like fabric. Then, a device called a ---, which spins samples at high speeds to separate out materials from a mixture, is used to further extract DNA from cells. ----is usually the most painstaking step of the process because it can be difficult to obtain sufficient cells in a forensic sample to yield enough DNA for PCR.

chemicals centrifuge DNA extraction

What do all nucleotides have in common?

deoxytibose sugure and phosphate group characteristics of a twisting helix

The set of rules dictating which mRNA codons specify which amino acid is called the ---. Scientists have pieced together this code by systematically studying how changes to the letters of a codon alter the specified ---so that we now know what amino acid each codon stands for. Each codon specifies one and only amino acid. Two additional features of the genetic code stand out. (1) The code is ---: multiple codons specify the same amino acid. In many cases, a codon will differ at the third nucleotide position without changing the amino acid that is specified. (Note that while the code is redundant it is not ambiguous—the same codon will not specify more than one amino acid.) (2) The genetic code is ---, which means that it is the same in all living organisms. It is because the code is universal that a yeast cell carrying a spider gene can express that gene and produce spider silk

genetic code amino acid redundant universal

Transgenic organisms are examples of ----organisms whose genomes have been altered through modern genetic engineering techniques, sometimes to contain new genes.

genetically modified organisms (GMOs)—

Linus Pauling (1901-1994)

had been studying the structure of proteins and had built a molecular model showing that some proteins exist as a single-stranded, twisting helix

In a paternity test, how many of the child's STR bands should match bands from the father?

half

The steps of replication happen in a precise order: First, an enzyme called ---unwinds the helix, and the two strands "unzip" from each other. Then, the enzyme ---builds a new strand of DNA along each unzipped strand. ---nucleotides floating inside the cell's nucleus are added to each new strand in a sequence that is complementary to the nucleotide sequence on the original template strand, A pairing with T and C with G. The end result is two complete ---molecules of DNA. DNA replication is a remarkably accurate process that happens at mind-boggling speeds, the polymerase enzyme adding about---nucleotides per second and rarely making a mistake

helicase DNA polymerase Free double-stranded 1,000

Summary of DNA DNA is the ---molecule of all living organisms. DNA contains ---for building an organism. DNA sequences determine the genetic ---and---of individuals The DNA in a ----cell is packaged into chromosomes located in the nucleus. Humans have ---pairs of chromosomes in their cells—one chromosome of each pair inherited from the mother, the other from the father. DNA is a ---stranded molecule that forms a spiral structure known as a double helix. Each strand of DNA is made of nucleotides bonded together in a ----sequence. There are four distinct nucleotides in DNA: --- The two linear strands of a DNA molecule are bound together by hydrogen bonds between base pairs. Base pairing is ---, A with T and G with C. Complementary pairing of DNA strands guides DNA replication, a fundamental part of ---. ---enables scientists to vastly increase the number of copies of specific DNA sequences. Forensic scientists use ----DNA sequences known as STRs to create a DNA profile. STRs are blocks of ---sequences of DNA. People differ in the number of times the sequences are repeated along their chromosomes. A ---profile is more accurate and reliable than many other forms of evidence.

hereditary instructions uniqueness and relatedness eukaryotic 23 double- linear adenine (A), thymine (T), guanine (G), and cytosine (C). complementary cell reproduction PCR noncoding repeated DNA

Hair v. DNA sample The problem is that hair analysis, performed under a microscope, can reveal only certain characteristics: it can distinguish whether hair is ----or not, or show a person's ----(because of ethnic differences in hair texture); hair analysis can tell whether the hair has been ---,---in a certain way or pulled out, and where on the ---it came from. Hair samples can exclude a suspect, but not ----one. By contrast, each person's DNA is unique, and ---from person to person,

human ancestry dyed, cut body positively identify varies

with the exception of ----—no two people share the exact same order of DNA nucleotides

identical twins

Who were the major players in the discovery of the structure of DNA?

in 1953, JAMES WATSON AND FRANCIS CRICK -Watson and Crick met in 1951 at Cambridge University, in England. -Watson was an American scientist who had just accepted a research position at the university. -Crick was then a Ph.D. student, studying protein structure with a technique called x-ray crystallography. In revealing the structure of DNA, they had solved one of the greatest mysteries of science—the chemical basis of inheritance. Their discovery would revolutionize biology and push forward the study of anthropology, evolution, and medicine.

the polymerase chain reaction (PCR), used in forensics Here's how it works: To a small sample of DNA, scientists add ---,---,---, —short segments of DNA that act as ---and flag the section to which DNA polymerase should bind to begin replication. The DNA is first ---to separate the strands, and then ===to allow the primers to associate with the DNA and new nucleotides to be added by DNA polymerase. From a starting sample of just a few DNA molecules, PCR can make ---of copies of a specific region of the DNA in less than a few hours

nucleotides, the DNA polymerase enzyme, and primers guideposts heated cooled billions

DNA is found inside the ---where it exists in the form of ---

nucleus chromosomes

transcription begins in the ---of a cell when an enzyme called ---binds to DNA at a gene's regulatory sequence, located just ahead of the coding sequence. At that site, RNA polymerase separates the two strands of the DNA double helix and begins moving along ---. As it moves, the RNA polymerase reads the DNA sequence and synthesizes a ---strand according to the rules of base pairing. The same rules that govern DNA base pairing apply here, with one difference: RNA nucleotides are made with the base ---instead of thymine (T). So the complementary base pairs are C with G and A with U

nucleus RNA polymerase one DNA strand complementary mRNA uracil (U)

To Franklin, this suggested that water molecules were being attracted to the helix, coating it and causing it to stretch out. And, since water is a polar molecule (see Chapter 2), attracted to charged (hydrophilic) molecules, this further suggested that the charged, water-loving phosphate groups of DNA must therefore be on the ---of the helix—not, as others had suggested, on the ---. Franklin's contribution didn't end there. She also discovered other important facts about the structure of DNA. Working with a graduate student, Raymond Gosling, she found that her x-ray diffractions confirmed that the elongated form of DNA had all the characteristics of a ---

outside inside twisting helix

In each DNA strand, the ---of one nucleotide binds to the sugar of the next nucleotide to form a chain of interlinked nucleotides. The two strands of linked nucleotides pair up and twist around each other to form a spiral-shaped ---. The sugars and phosphates from the outside "---" of the helix and the bases point toward its center, forming internal "---," like steps on a twisting ladder. The bases in one strand associate with bases from the other strand through ---, which hold the DNA double helix together.

phosphate group double helix backbone rungs hydrogen bonds

---are one of the four main macromolecules that make up cells, along with carbohydrates, nucleic acids, and lipids. Proteins are the cell's ---molecules. They perform myriad functions inside cells, and in turn, help our bodies perform countless tasks—everything from contracting our muscles and sensing light to regulating blood sugar and fighting infections. Spiders use their silk proteins to build webs for trapping prey, sacs to protect eggs, and bungee cord-like draglines that catch them when they fall All proteins are made of the same building blocks, which are called ---. There are ---in cells. All amino acids have the same ----, but each of the 20 also has a unique chemical side chain that distinguishes it from all the others.

proteins workhorse amino acids 20 different amino acids basic core structure

The combination is called a ---, since it mixes and matches segments of genes that weren't naturally found together. Next, using genetic engineering techniques, which manipulate DNA, scientists ---the recombinant gene into a piece of DNA that can carry the recombinant gene into the yeast cell, and ultimately into a yeast chromosome. The carrier DNA molecule is called a ---. The final step is ---when the yeast protein machinery "reads" the instructions in the recombinant gene and synthesizes spider silk protein

recombinant gene insert vector gene expression

To identify perpetrators, forensic scientists examine the specific ===of nucleotide bases along one strand of a person's DNA

sequence

Once DNA from crime scene evidence is obtained, the next step is to analyze it. Figuring out the sequence of every nucleotide in the genome would be extremely time consuming and expensive. So instead, forensic scientists use a shortcut—they employ PCR to amplify specific segments of DNA and analyze just these segments. These segments are known as ---.

short tandem repeats

All life forms—from bacteria to plants to humans—use DNA as the ---of their biological information and transmit it to their offspring. DNA is the ---molecule of life, establishing the uniqueness of each of us.

storehouse hereditary

Watson and Crick published their paper on the structure of DNA in April 1953 in the prominent journal Nature. In it, with considerable understatement, they wrote: "It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material." Indeed, the model that Watson and Crick proposed solved at once both the ---and how this structure provides a ---: each strand of an unzipped helix serves as the template for the creation of a complementary strand, thus reproducing the original pattern (see Chapter 7). The mystery of heredity had finally been unlocked.

structure of DNA mechanism for DNA replication

Barry Bench. Bench was .

the brother of Kulakowski's former boyfriend

Epi-genetics

the study of environmental influences on gene expression that occur without a DNA change Genes turn "on" and "off" in response to experiences (such as exposure to carcinogens)

How is DNA copied in living cells, and how can DNA be amplified for forensics?

the way cells normally make more DNA is through a process called DNA replication. The process of DNA replication is essentially the same in all organisms. Forensic scientists make use of this natural cellular process when they need to amplify the DNA in a crime scene sample. The method they use, the polymerase chain reaction (PCR), is similar to DNA replication in cells—but it takes place in a test tube and only specific regions of the OG DNA sequence are amplified.

In the majority of criminal cases,

there is no DNA evidence.

In order to get from a gene to a protein, cells carry out two major steps: ---and---. Transcription is the process of using DNA to make a --- copy of the gene. Translation is the process of using this mRNA copy as a set of ---to assemble amino acids into a protein Why two separate steps? As the names "transcription" and "translation" imply, the process of gene expression is like copying a text and then converting it into another language. In this case, the text to be translated is a valuable, one-of-a-kind document: DNA. Just as you would be forbidden to borrow a rare manuscript from the library at school and would instead have to copy the text into your notebook or laptop, the cell cannot take DNA out of its "library"—the nucleus

transcription and translation messenger RNA (mRNA) instructions

Franklin's critical ====to Watson out of jealousy or disdain. But despite the controversy, Franklin's contribution to the discovery has never been completely ignored, and she is now recognized as having been a top-notch scientist: her notebooks show that without her thorough scientific research and original ideas, we would have had to wait much longer for what is still considered to be one of the most important discoveries in biology

x-ray diffraction photos

After serving more than 25 years in prison for a crime he didn't commit, Brown was ultimately cleared of all charges and released from prison in 2007.

yay