Cell Biology Exam #3

¡Supera tus tareas y exámenes ahora con Quizwiz!

What kind of bond connects the base pairs?

hydrogen bonding

Transcription

process by which RNA is formed from a DNA template

Translation

process by which proteins are synthesized in the cytoplasm from an mRNA template

gene expression

production of a functional product using the information encoded in a gene

rRNA

provide structural support and catalyze the chemical reaction in which amino acids are linked to one another

Are RNAs longer or shorter than DNA?

shorter

Is RNA single or double stranded?

single

Which of the following DNA strands can form a DNA duplex by pairing with itself at each position?

5′-AAGCGCTT-3′

Transcription regulators bind gene regulatory sequences through:

B) Non-covalent bonds between amino acid R groups on the surface of the protein and specific nitrogenous bases in the major groove of DNA.

Which of the following statements about the protein quality control system in the ER is false?

B) Proteins that are misfolded are degraded in the ER lumen

Which eukaryotic RNA polymerase is responsible for the synthesis of most mRNAs?

B) RNA polymerase II

9. A change in nucleotide sequence that does not affect amino acid sequence is said to be _________, whereas a change that causes an amino acid substitution is said to be _________.

B) Synonymous; nonsynonymous

Which of the following eukaryotic pre-initiation complex factors recognizes the promoter TATA box?

B) TFIID

Which of the following is not true concerning transcription factor motifs?

B) The HLH motif has two β-pleated sheets separated by a loop

What do you predict would happen if you replace the Lac operator DNA from the Lac operon with the DNA from the operator region from the tryptophan operon?

B) The Lac operon will not be transcribed when tryptophan levels are high

The DNA from two different species can often be distinguished by a difference in the ______________________

Ratio of A + T to G + C

tRNA

carries amino acids to the ribosome

mRNA

carries instructions from DNA

Which region of the nucleolus is associated with ribosome assembly?

A) Granular component

During translation initiation, which initiation factor is a GTP-binding protein required for attachment of the

B) IF2D) eIF2 E) B and D

______ vesicles internalize materials from the plasma membrane via receptor-mediated endocytosis, while _______ move materials from the Golgi towards the RER.

) Clathrin-coated; COPI-coated

Concerning pre-RNA processing, which of the following is not true?

) Complexes that process hnRNAs assemble on the N-terminal domain of RNA polymerase II.

After isolating the rough endoplasmic reticulum from the rest of the cytoplasm, you purify the RNAs attached to it. Which of the following proteins do you not expect the RNA from the rough endoplasmic reticulum to encode?

) Peripheral proteins on the cytoplasmic face of the lipid bilayer

An example of constitutive heterochromatin would be_______.

A) Centromeres B) Telomeres D) A and B

What technique is used to determine DNA binding sites for transcription factors genome-wide?

A) Chromatin immunoprecipitation

In terms of DNA structure and composition, which of the following is not true?

A) Contain the purines A and C, and pyrimidines G and T

Which enzymes or complexes are not associated with mRNA stability and degradation?

A) Deadenylase B) Decapping enzyme C) 5'-3' exonuclease D) Exosome E) All of the above are associated with mRNA stability and degradation

All of the following concerning the human genome are true except:

A) Gene duplication may arise from unequal crossing over events, and leads to the evolution of multigene families. B) Trinucleotide repeat expansion diseases can occur in introns, coding exons, and untranslated regions (UTRs). C) The human genome consists of around 20,000 genes. D) The most common type of genetic variability in humans is from single nucleotide differences. E) All of the above are true.

With respect to genome structure and stability, all of the following statements are true except:

A) Genome complexity in terms of size can be determined from DNA renaturation. B) Gene families are represented in the non-repeated fraction of eukaryotic DNA. C) Retrotransposons have an RNA intermediate and require reverse transcriptase. D) Movement of transposons require the enzyme transposase. E) All of the above are true.

During the formation of heterochromatin from euchromatin, what is the order of events that generally occurs at the level of the histone?

A) Histone deacetylation; histone methylation; HP1 protein binds to histones

Which of the following statements concerning the lac operon is not true?

A) It is a type of repressible operon.

Which of the following statements concerning endocytosis and phagocytosis is incorrect?

A) LDL particles are routed to the lysosome via pinocytosis

What statement concerning histone modification is generally true?

A) Methylation of amino acids is linked to a heterochromatin state. B) Acetylation of amino acids is linked to a euchromatin state E) A and B

Which of the following statements concerning human diseases is not correct?

A) Progeria is linked to mutations in the lamin A/C gene B) Tay-Sachs disease is a type of lysosomal storage disease C) Huntington's disease is based on a trinucleotide repeat expansion D) miRNAs are linked to the development of cancer E) All of the above statements are correct

In terms of DNA structure and composition, which of the following is not true?

A) Pyrimidines are G and

Which eukaryotic RNA polymerase is responsible for the synthesis of most rRNAs?

A) RNA polymerase I

What family of G-proteins determines the specificity of interaction of vesicles with the correct target membrane?

A) Rabs

You are interpreting data on a DNA chip or microarray. You expose the chip to a mixture of two cDNA populations: one from cells that were not treated with a glucocorticoid hormone (untreated controls; labeled with a red fluorescent dye) and a population from cells that were treated with glucocorticoid hormones (glucocorticoid-treated; labeled with green fluorescent dye). You look at a spot on the chip representing the gene for phosphoenolase, a gene that is expressed in these cells and is repressed when glucocorticoid is added. What color should the spot representing the phosphoenolase gene be?

A) Red

During ribosome docking at the rough endoplasmic reticulum, which of the following act as G proteins to

A) SRP B) SRP receptorD) A and B

What GTP-binding protein plays a regulatory role in the formation and disassembly of the COPII coat?

A) Sar1

RNA-RNA hybridization is involved an all of the following processes except:

A) Secondary structure formation in rRNAs and tRNAs B) Recognition of Shine-Dalgarno sequence in bacterial mRNAs C) Recognition of 5' and 3' hnRNA splicing sites by the spliceosome D) Correct tRNA association with mRNA codons during translation E) All of the above are reliant upon RNA-RNA hybridization

What of the following is a function of the smooth endoplasmic reticulum?

A) Steroid hormone synthesis B) Detoxification of organic compounds C) Sequestering calciumE) A, B, and C

Inner membrane mitochondrial proteins use this complex during transport from the cytosol.

A) TOM complex B) TIM22 complex D) A and B

Mitochondrial matrix proteins use this complex during transport from the cytosol.

A) TOM complex C) TIM23 complex E) A and C

Which of the following is not true concerning protein processing?

A) The SER is continuous with the nuclear membrane & the starting point of the biosynthetic pathway.

Which model suggests that the Golgi cisternae are transient structures that form at the cis face of the stack by fusion of membranous carriers from the ER and ERGIC and that each cisterna travels through the Golgi complex from the cis to the trans end of the stack, changing in composition as it progresses?

A) The cisternal maturation model

Which of the following is NOT true concerning transcription factor motifs?

A) The leucine zipper motif has a leucine at every 7th amino acid of an α-helix B) The HLH motif has two α-helical segments separated by a loop C) The zinc finger motif has zinc ions held in place by 2 cysteines and 2 histidines D) The leucine zipper and HLH motifs can have basic amino acid regions that interact with DNA E) All of the above are true

In Drosophila, the cytoplasmic localization of bicoid and oskar transcripts to determine the correct development of the anterior-posterior axis is an example of:

A) Translational-level control

Regulation of ferritin to help detoxify the presence of intracellular iron is an example of:

A) Translational-level control

Amino acids are charged onto their respective t-RNAs through the activity of _______.

Aminoacyl-tRNA synthetases

What DNA sequence is repeated in human telomeres?

B) 5'-TTAGGG-3'

You have a piece of DNA that includes the following sequence: 5′-ATAGGCATTCGATCCGGATAGCAT-3′ 3′-TATCCGTAAGCTAGGCCTATCGTA-5′ Which of the following RNA molecules could be transcribed from this piece of DNA?

B) 5′-AUAGGCAUUCGAUCCGGAUAGCAU-3′

How are most eukaryotic transcription regulators able to affect transcription when their binding sites in enhancers are far from the promoter?

B) By looping out the intervening DNA between their binding site and the promoter

DNA methylation to maintain DNA silencing generally occurs at which base?

B) Cytosine

Which region of the nucleolus is associated with the location of rDNA?

B) Fibrillar center

With respect to genome structure and stability, all of the following statements are true except:

B) Gene families are represented in the moderately repeated fraction of eukaryotic DNA.

Most eukaryotic cells only express 20-30% of the genes they possess. The formation of hetero- chromatin maintains the other genes in a transcriptionally silent state. Which histone modification directs the formation of the most common type of heterochromatin via recruitment of HP1 proteins?

B) H3 lysine 9 methylation

Fred Griffith studied two strains of Streptococcus pneumonia, one that causes a lethal infection when injected into mice, and a second that is harmless. He observed that pathogenic bacteria that have been killed by heating can no longer cause an infection. But when these heat-killed bacteria are mixed with live, harmless bacteria, this mixture is capable of infecting and killing a mouse. What did Griffith conclude from this experiment?

B) The heat-killed pathogenic bacteria "transformed" the harmless strain into a lethal one.

All of the following concerning bacterial transcription are true except:

B) Transcriptional termination is always a rho-dependent process.

If you want to engineer a cytoplasmic protein to become a resident RER protein, which of the following amino acid sequences would you need to add?

C) A signal sequence to its N-terminus and a KDEL sequence to its C-terminus

Adaptor molecules are essential for the assembly of clathrin-coated vesicles. The adaptor protein ________ is the essential adaptor used in the endocytic pathway, while ______ is important for those vesicles to be formed at the trans Golgi network.

C) AP2: GGA

What GTP-binding protein plays a regulatory role in the formation and disassembly of the COPI coat?

C) ARF1

Which of the following pairs of codons might you expect to be read by the same tRNA as a result of wobble?

C) CAC and CAU

Which of the following statements is true?

C) Chaperone proteins in the mitochondria matrix facilitate the movement of proteins across the outer and inner mitochondrial membranes.

Which G protein mediates the release of clathrin-coated vesicles from the plasma membrane during receptor-mediated endocytosis?

C) Dynamin

Consider two genes that are next to each other on a chromosome, as arranged in the figure below. Which of the following statements is true?

C) Gene A and gene B can be transcribed at different rates, producing different amounts of RNA within the same cell.

You have discovered a new hn-RNA from a human cell line and want determine the protein product that is made from the message. The sequence of this hn-RNA is as follows: 5' cgcaugaccaccaccaccauggggggucaugccaacuaauucccucacagggcauucuaaacuuuaa 3' What is the predicted protein sequence from this mRNA? Remember to splice out the intron and locate

C) Met-Gly-Gly-His-Ser-Lys-Leu

You have discovered a new hn-RNA from a human cell line and want determine the protein product that is made from the message. The sequence of this hn-RNA is as follows: 5' cgcaugaccaccaccaccauggggggucaugccaacuaauucccucacagggcauucuaaacuuuaa 3' What is the predicted protein sequence from this mRNA? Remember to splice out the intron and locate the correct start codon within the Kozak sequence.

C) Met-Gly-Gly-His-Ser-Lys-Leu

Your friend works in a biotechnology company and has discovered a drug that blocks the ability of Ran to exchange GDP for GTP. What is the most likely effect of this drug on nuclear transport?

C) Nuclear transport receptors would be unable to release their cargo in the nucleus

DNA packaging from the lowest level of organization to the highest level is:

C) Nucleosome, 30-nm fiber, supercoiled loop, mitotic chromosome

During the unfolded protein response, the protein ______ is activated to cause an inhibition of protein translation, while the protein _____ is cleaved to act like a transcription factor to turn on 'helper' genes.

C) PERK; ATF6

A defect in the lamin A/C gene leads to what disease?

C) Progeria

During eukaryotic pre-mRNA processing, which enzyme is involved in the last step in the formation of the 5' Cap?

C) RNA methyltransferase

Which of the following is not true concerning protein processing?

C) Secreted proteins (e.g. neurotransmitters) are synthesized on 'free' ribosomes.

Which of the following eukaryotic pre-initiation complex factors is not correctly paired with its function?

C) TFIIB: Helps recruit RNA polII to the complex, similar to σ factor in prokaryotic transcription

Which of the following is not true about the glycosylation of proteins in the ER?

C) The oligosaccharide 'tree' is made up entirely of glucose.

Concerning pre-RNA processing, which of the following is not true?

C) mRNAs have 3' methyladenine caps and 5' polyG tails.

In the fusion event between vesicle and target membranes, ______ found in the target membrane interact with ______ found on vesicles to pull the two lipid bilayers together.

C) tSNAREs; vSNAREs

f you want to engineer a cytoplasmic protein to become a nuclear protein, which of the following amino acid sequences would you need to add?

D) A Lys-Lys-Lys-Lys-Lys sequence to its N-terminus

What biological process involves surrounding internal organelles like mitochondria with a double membrane for subsequent degradation through the lysosome?

D) Autophagy

______ vesicles move materials from the ER "forward" to the ERGIC and Golgi complex, while _______ move materials from the ERGIC and Golgi "backward" towards the ER.

D) COPII-coated; COPI-coated

Which of the following is not associated with mRNA stability and degradation?

D) Chaperones

You are a virologist interested in studying the evolution of viral genomes. You are studying two newly isolated viral strains and have sequenced their genomes. You find that the genome of strain 1 contains 25% A, 45% G, 20% C, and 10% T. You report that you have isolated a virus with a single-stranded DNA genome. Based on what evidence can you make this conclusion?

D) Double-stranded genomes have equal amounts of A and T

During eukaryotic pre-mRNA processing, which enzymes are involved in modification of the 3' end?

D) Endonuclease and polyA polymerase

Which of the following statements concerning endocytosis and phagocytosis is incorrect?

D) Engulfment of particles by phagocytosis is driven by microtubule formation in the cell

The N-terminus of which histone is generally the most extensively modified by chemical modification?

D) H3

What specific tag added to proteins in the cis-Golgi will route lysosomal enzymes to the lysosome?

D) Mannose 6-phosphate

Which of the following statements concerning DNA is true?

D) Most proteins interact with DNA along its major groove.

After isolating the rough endoplasmic reticulum from the rest of the cytoplasm, you purify the RNAs attached to it. Which of the following proteins do you not expect the RNA from the rough endoplasmic reticulum to encode?

D) Peripheral proteins on the cytoplasmic face of the lipid bilayer

These amino acids line the channel of the nuclear pore to provide a hydrophobic environment.

D) Phenylalanine; glycine

You have a segment of DNA that contains the following sequence: 5′-GGACTAGACAATAGGGACCTAGAGATTCCGAAA-3′ 3′-CCTGATCTGTTATCCCTGGATCTCTAAGGCTTT-5′ You know that the RNA transcribed from this segment contains the following sequence: 5′-GGACUAGACAAUAGGGACCUAGAGAUUCCGAAA-3′ Which of the following choices best describes how transcription occurs?

D) The bottom strand is the template strand; RNA polymerase moves along this strand from 3′ to 5′

All of the following concerning bacterial transcription are true except:

D) Transcription occurs 5' to 3' parallel to the template strand.

To mark proteins that will be degraded through the proteasome, what modification occurs to the protein?

D) Ubiquitination of lysine residues

In terms of eukaryotic DNA fractions, satellite DNAs are found in the ________ fraction and histone

E) Highly repeated; moderately repeated

What is the order of events that occur for the routing of a protein with a nuclear localization signal into the nucleus? I. Association of protein complex with Ran-GTP II. Movement of protein complex through the nuclear pore III. Importin α/β association with protein IV. Transport of importin β to the cytosol via Ran-GTP V. Interaction of protein complex with cytoplasmic filament of the nuclear pore

E) III; V; II; I; IV

Which enzyme transfers an oligosaccharide to proteins via N-linked glycosylation at the ER?

E) Oligosaccaryltransferase

Formation of clathrin-coated vesicles during receptor-mediated endocytosis is initiated by which of the following molecules?

E) PI(4,5)P2

Where would the protein from the previous question be found in the cell?

E) Peroxisome

All of the following concerning protein translation are true except:

E) The Kozak sequence is used in bacteria to locate the correct initiation codon.

All of the following concerning protein translation are true except:

E) The Shine-Dalgarno sequence is used in eukaryotic cells to locate the correct initiation codon.

Which of the following is not true concerning transcription factors?

E) Transcription factors generally act as monomers.

During translation initiation in eukaryotes, which initiation factor is a GTP-binding protein required for attachment of the first aminoacyl-tRNA?

E) eIF2

What organelles make up the endomembrane system?

ER, Golgi, endosomes, lysosomes and vaculoues

What makes RNA different from DNA?

It has a ribose sugar not a deoxyribose sugar

What kind of bond connects the chain together?

Phosphodiester bonds

In terms of DNA structure and composition, which of the following is not true?

Pyrimidines are G and T

Which uses Uricil instead of Thymine, DNA or RNA?

RNA

Which of the following statements concerning DNA is true?

The melting temperature of DNA increases as its GC content increases

How many kinds of RNA are there?

three


Conjuntos de estudio relacionados

Embalming Theory II Final (FSE 212)

View Set

ATI Targeted Med Surg - Cardiovascular

View Set