ch. 13 learning curve

Having more than two sets of chromosomes in the genome called: a. polyploidy. b. diploidy. c. haploidy. d. aneuploidy. e. extraploidy.

a. polyploidy.

DNA supercoils that result from overwinding produce _____ supercoils. a. positive b. negative c. neutral d. charged e. constant

a. positive

Whole genome sequencing is often approached by a shotgun sequencing technique in which large genomes are: a. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order. b. digested in a few specific spots, large fragments are sequenced, and the overlapping sequences are assembled in order. c. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from largest to smallest. d. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled from smallest to largest. e. All of these choices are correct.

a. randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order.

Cellular division within eukaryotic cells requires DNA to condense into the: a. 30 nm fiber. b. 1400 nm fiber. c. 300 nm fiber. d. 2 nm fiber. e. 44 nm fiber.

b. 1400 nm fiber.

DNA transposable elements are a class of transposable elements that uses: a. tandem repeats as an intermediate. b. DNA as an intermediate. c. RNA as an intermediate. d. protein as an intermediate. e. ribosomes as an intermediate.

b. DNA as an intermediate.

_____is the process by which researchers identify various types of sequences. a. Chromosome condensation b. Genome annotation c. The C-value paradox d. Karyotype synthesis e. Comparative genomics

b. Genome annotation

An individual's genome sequence can reveal his or her disease susceptibilities and drug sensitivities, which allows treatments to be tailored to the individual. This approach is called: _________

personalized medicine.

A cell in which viral reproduction occurs is called a: a. host cell. b. daughter cell. c. sex cell. d. somatic cell. e. None of the answer options is correct.

a. host cell.

"Shotgun" sequencing involves aligning many small sequences from a genome based on sequence similarities. T or F?

True

Except for twins and other multiple births, the genome sequence is different in every individual. T or F?

True

There is no correlation between genome size and complexity of an organism. T or F?

True

Viruses that invade bacteria are called: a. bacteriophages. b. macrophages. c. mosaicphages. d. adenoviruses. e. prokaryphages.

a. bacteriophages.

Repeated sequences within eukaryotic genomes may be represented as long repeated sequences next to each other, and are called _____ repeats. Repeated sequences in eukaryotic genomes can also be spread throughout the genome, and are called _____ repeats. a. tandem; dispersed b. dispersed; tandem c. overlapping; adjacent d. adjacent; overlapping e. None of the answer options is correct.

a. tandem; dispersed

The size of a genome is measured by: a. the number of base pairs. b. gene size. c. the number of chromosomes. d. the size of organism. e. All of these choices are correct.

a. the number of base pairs.

Which of the following is not a type of sequence identified by gene annotation? a. topoisomerase b. single copy gene c. simple sequence repeat d. noncoding RNA e. tandem repeat

a. topoisomerase

Retrotransposons are a class of transposable elements that: a. uses RNA as an intermediate. b. replicate and transpose via DNA replication and repair. c. uses DNA as an intermediate. d. uses protein as an intermediate. e. uses ribosomes as an intermediate.

a. uses RNA as an intermediate.

In the eukaryotic DNA sequence below, each bold sequence consists of a simple-sequence repeat. How are the highlighted regions organized relative to each other? ATTAT*CATCATCATCATCAT*TTACTAATCCT*CATCATCATCATCAT*GGAATCTA*CATCATCATCATCAT* a. as tandem repeats b. as dispersed repeats c. as inverted repeats d. as long terminal repeats e. as short terminal repeats

b. as dispersed repeats

All of the genetic material transferred from a parent to an offspring is known as a: a. karyotype. b. genome. c. open reading frame. d. mRNA. e. nucleoid.

b. genome.

DNA is wrapped around histones, which contain many copies of the positive amino acids lysine and arginine. These positive amino acids neutralize the negative charge of the _____ of the DNA wrapped around the histone. a. nitrogenous base b. phosphate group c. All of these choices are correct. d. hydroxyl group e. ribose sugar

b. phosphate group

In the eukaryotic DNA sequence below, which type of repeat is highlighted? ATTATTTACTAATCCT*CATCATCATCATCAT*GGAATTCATAATGCTAATGG a. tandem repeat b. simple sequence repeat c. dispersed repeat d. long terminal repeat e. short terminal repeat

b. simple sequence repeat

Which of the following statements is true regarding sequence motifs? a. Sequence motifs are found in DNA but not in RNA. b. Sequence motifs in DNA are found only upstream of protein-coding regions. c. An open reading frame is a type of sequence motif. d. Sequence motifs in RNA provide no information about sequence motifs in DNA. e. None of the answer options is correct.

c. An open reading frame is a type of sequence motif.

Which of the following statements is true regarding a genome? a. Genomes always contain DNA. b. Genomes are composed of chromosomes. c. Genomes are "heritable," or passed from parents to offspring. d. Only prokaryotic and eukaryotic organisms possess genomes. e. All of these choices are correct.

c. Genomes are "heritable," or passed from parents to offspring.

Sequence assembly is accomplished by: a. aligning the fragments in the laboratory by running them through gel electrophoresis. b. aligning the fragments on paper. c. aligning the fragments by using a complex computer program. d. aligning the fragments by joining histones. e. None of the answer options is correct.

c. aligning the fragments by using a complex computer programpersonalized medicine.

The most likely origin of human HIV1 virus is a related virus that infects: a. sheep. b. cows. c. chimpanzees. d. horses. e. cats.

c. chimpanzees.

In the eukaryotic DNA sequence below, the bold repeat is a tandem repeat. It is also what other kind of repeat? *CACACACACACACACACACACACACACACACACACACA* a. long terminal repeat b. transposon repeat c. simple sequence repeat d. dispersed repeat e. short terminal repeat

c. simple sequence repeat

In the eukaryotic DNA sequence below, which type of repeat is bold? ATTATTTACTAATCCT*CATCATCATCATCAT*GGAATTCATAATGCTAATGG a. dispersed repeat b. tandem repeat c. simple sequence repeat d. long terminal repeat e. short terminal repeat

c. simple sequence repeat

Only 2.5 percent of the human genome actually codes for proteins. The other 97.5 percent includes: a. noncoding RNA. b. repetitive DNA. c. introns. d. All of other answer options are correct.

d. All of other answer options are correct.

Transposable elements are: a. proteins that can move outside of the nucleus. b. proteins that can move into the nucleus. c. DNA sequences that can insert themselves into RNA. d. DNA sequences that can insert themselves into new positions within the genome. e. None of the answer options is correct.

d. DNA sequences that can insert themselves into new positions within the genome.

DNA supercoils that result from underwinding produce _____ supercoils. a. charged b. positive c. neutral d. negative e. constant

d. negative

Repeated sequences make genome sequencing challenging for of all of the following reasons except: a. repeated sequences are typically longer than the short sequences obtained by automated sequencing. b. there is no easy way to determine how many copies of the same repeat are present within one chromosome. c. short repeats may fold back upon themselves to form a double-stranded structure that is not easily sequenced. d. the long repeats often have mutations that are not easily sequenced. e. All of these choices are correct.

d. the long repeats often have mutations that are not easily sequenced.

Knowing an individual's DNA sequence may be beneficial because it makes it possible to predict: a. susceptibility to disease. b. response to medications. c. physical differences. d. the occurrence of a disease. e. All of these choices are correct.

e. All of these choices are correct.

Which of the following are sequence motifs? a. open reading frame b. hairpin structures c. promoters d. coding region e. All of these choices are correct.

e. All of these choices are correct.

Which one of the following statements about virus classification is not correct? a. Viruses are classified based on whether their genetic material is double-stranded DNA or RNA. b. Viruses are classified based on whether their genetic material is partially double-stranded or partially single-stranded. d. Viruses are classified based on whether the single-stranded DNA or RNA that serves as their genetic material has a positive or negative sense. e. All of these choices are correct.

e. All of these choices are correct.

Imagine that a researcher discovers a new type of virus. This virus contains single-stranded RNA with "negative" sense. Which of the following statements is true regarding this virus? a. This virus must use reverse transcriptase to produce mRNA. b. Based on the presence of single-stranded RNA, this virus likely behaves as an adenovirus. c. According to the Baltimore system, this virus would be classified as a type VII virus. d. This virus will likely have a larger genome compared to a DNA-containing type II virus. e. None of the answer options is correct.

e. None of the answer options is correct.

The C-value paradox is the disconnect between genome size: a. and gene size. b. within the same species. c. and gene ratio. d. and protein ratio. e. and organismal complexity.

e. and organismal complexity.

The region of DNA sequences before the start of a gene is often called the promoter. One type of promoter is called the TATA box. Many species' promoters are TATA boxes or a variation of the TATA box. DNA sequences that are similar in different organisms are called _____ sequences. a. transposable b. convergent c. conjugate d. adjoined e. conserved

e. conserved

What was the goal of the Human Genome Project? a. identifying every gene in the human somatic cell b. identifying every gene in the human sex cell c. sequencing every protein in the human sex cell d. identifying every protein in the human somatic cell e. sequencing every gene in the human cell

e. sequencing every gene in the human cell

This enzyme is responsible for breaking the backbone on the DNA double helix. a. ligase b. transcriptase c. polymerase d. supercoilase e. topoisomerase II

e. topoisomerase II

All DNA sequences are transcribed into RNA. T or F?

false

In eukaryotes, genome size is a good predictor of gene number and organismal complexity. T or F?

false