College Biology Mastering Chapters 8-12

¡Supera tus tareas y exámenes ahora con Quizwiz!

Pea flowers may be purple (P) or white (p). Pea seeds may be round (R) or wrinkled (r). What proportion of the offspring from the cross PpRr × PpRr are expected to have white flowers and wrinkled seeds? A) 1/16 B) 3/16 C) 9/16 D) 12/16 or 3/4

A) 1/16

According to scientists, about what percentage of men currently living in Central Asia may be descended from the Mongolian ruler Genghis Khan? A) 8% B) 4% C) 40% D) 25%

A) 8%

Since the first animal was produced using a fully differentiated cell, a number of observations have been made. Which of the following statements is true in regard to reproductive cloning? A) Cloned animals often develop chronic conditions that are usually only associated with old age B) Cloned animals are physically identical when compared to their parents C) The sheep Dolly is the only mammal that has been successfully cloned D) Cloned animals possess chromatin structure identical to that of t

A) Cloned animals often develop chronic conditions that are usually only associated with old age

During meiosis I, homologous chromosomes form a tetrad and crossing over occurs. What is the outcome of crossing over? A) Crossing over creates new combinations of genes present on a single chromosome B) Crossing over ultimately reduces the number of chromatids per chromosome C) Crossing over reduces the number of chromosomes present in the cell D) Crossing over creates new combinations of chromosomes through their independent alignment across the metaphase plate

A) Crossing over creates new combinations of genes present on a single chromosome

A gene made of __________ is transcribed into __________ and then translated to form a __________. A) DNA ... RNA ... protein B) DNA ... protein ... RNA C) RNA ... DNA ... protein D) protein ... RNA ... DNA

A) DNA ... RNA ... protein

What is the proper order of events in the expression of a eukaryotic protein? A) DNA unpacking, mRNA splicing, translation, protein folding B) transcription, mRNA splicing, protein modification, translation C) transcription, translation, addition of cap and tail to mRNA, DNA unpacking D) DNA unpacking, mRNA transport through nucleus, mRNA splicing, protein modification

A) DNA unpacking, mRNA splicing, translation, protein folding

Which of these is classified as an emerging virus that can have a direct impact on human health? A) Ebola B) pneumonia C) tobacco mosaic virus D) lambda

A) Ebola

Consider the photograph shown below. You can determine this is a plant cell rather than an animal cell because it has __________. A) Formed a cell plate B) Microtubules C) Separated duplicated chromosomes during mitosis D) Formed a cleavage furrow

A) Formed a cell plate

If one strand of DNA is CGGTAC, then the complementary strand would be A) GCCATG B) TAACGT C) GCCTAG D) GCCAUC

A) GCCATG

There is a mutation in the operator of the lac operon in a cell such that the lac repressor always stays bound to the operator. If lactose is added to the cell, what will happen? A) Lactose will bind to the repressor, and lac enzymes will not be produced B) Lactose will bind to the operator, and lac enzymes will be produced C) Lactose will not bind to the repressor, and lac enzymes will be produced D) Lactose will bind to the repressor, and lac enzymes will be produced

A) Lactose will bind to the repressor, and lac enzymes will not be produced

Cystic fibrosis is a genetic disease that results from a defective CFTR protein that alters ion flow through the cell membrane such that water does not cross the cell membrane. Gene therapy is being used to attempt to help cystic fibrosis patients. Which of the following steps is not needed to develop a gene therapy treatment for cystic fibrosis? A) Make antibodies to the defective CFTR protein to enhance the patient's immune system. B) Insert the RNA version of the CFTR gene into a virus. C) Re

A) Make antibodies to the defective CFTR protein to enhance the patient's immune system.

What is meant by the statement that "male bees are fatherless"? A) Male bees develop from unfertilized eggs B) The queen bee's mate dies before the male eggs hatch C) Male bees don't play a role in the rearing of bee young D) Male bees are produced by budding

A) Male bees develop from unfertilized eggs

Why do you think that adult stem cells are found in bone marrow and the lining of the small intestine specifically? A) These cells must be able to regenerate various types of cells throughout life B) Cell division must occur in these areas indefinitely C) These are the first tissues to develop in an embryo D) This is a mystery that must be solved before use of adult stem cells is possible

A) These cells must be able to regenerate various types of cells throughout life

Imagine you're counseling a couple who have undergone carrier screening for Tay-Sachs disease. The man is a carrier, and the woman does not carry the Tay-Sachs allele. How should you advise them? A) They should be informed that if they have a child, the child will not have Tay-Sachs disease but will have a 50% chance of being a carrier of the Tay-Sachs allele. B) They should be informed that if they conceive a child, the child will have Tay-Sachs disease. C) They should be informed that if they have a child, there is a 25% chance that the child will have Tay-Sachs disease. D) They should be informed that if they have a child, there is a 50% chance that the child will have Tay-Sachs disease.

A) They should be informed that if they have a child, the child will not have Tay-Sachs disease but will have a 50% chance of being a carrier of the Tay-Sachs allele.

It is possible for a cell to make proteins that last for months; for example, hemoglobin in red blood cells. However, many proteins are short-lived and may be degraded in days or even hours. Why do cells make proteins with such a short life? A) This enables cells to control the amount of protein present B) Only cancer cells, which can keep dividing, contain long-lasting proteins C) Most proteins are used only once D) Most cells in the body live only a few days

A) This enables cells to control the amount of protein present

Although in humans there are 22 pairs of autosomal chromosomes, only three different chromosomal trisomies are commonly seen in newborns. Of the remaining 19 autosomes, many trisomies have not been seen in newborns. Why not? A) Trisomy for the other autosomal chromosomes is often lethal, and the affected embryos are miscarried B) Trisomy for these autosomal chromosomes has no effect and therefore would never be noticed C) Trisomy for these other autosomal chromosomes occurs so rarely that it has never been documented D) These autosomal chromosomes do not contain the same type of DNA or protein that makes up chromosomes susceptible to trisomy

A) Trisomy for the other autosomal chromosomes is often lethal, and the affected embryos are miscarried

You are a medical student and are reviewing a case study about a past patient. The patient was 4 feet 8 inches tall at age 38, was unable to have children, and had cognitive impairments. The patient also had an irregular number of chromosomes. What diagnosis would you give the patient? A) Turner syndrome B) Down syndrome C) chronic myelogenous leukemia D) Klinefelter syndrome

A) Turner syndrome

Which of the following indicates Turner syndrome? A) XO B) XYY C) XXX D) XXY

A) XO

Proto-oncogenes have the potential to become oncogenes. Which of the following is most likely to lead to cancer? A) a mutation that causes the proto-oncogene to become overactive B) a mutation in a gamete C) a tissue injury D) a viral infection

A) a mutation that causes the proto-oncogene to become overactive

Emerging viruses that infect human cells can originate from __________. A) a virus spreading from one host species to humans B) lack of hygiene C) lambda viruses that were previously confined to bacterial populations that can now spread due to technological changes D) a rapidly mutating lytic phage

A) a virus spreading from one host species to humans

What is an allele? A) an alternative version of a gene B) a type of chromosome C) the dominant form of a gene D) a variety of pea plant used by Mendel

A) an alternative version of a gene

Insulin used for the treatment of diabetes in humans is now obtained from _____. View Available Hint(s)for Part A A) bacteria B) cows C) pigs D) archaea

A) bacteria

In female mammals, the inactive X chromosome in each cell A) becomes a Barr body B) can be activated if mutations occur in the active X chromosome C) is broken down, and its nucleotides are degraded and reused D) is absorbed and used in energy production

A) becomes a Barr body

A cell replicates its entire chromosomal DNA only __________. A) before it is about to divide B) to repair damage caused by mutation C) when the cell needs RNA D) when it makes protein

A) before it is about to divide

How is sex determined in most ants and bees? A) by the number of chromosomes B) by the size of the sex chromosome C) by the X-Y system D) by the Z-W system

A) by the number of chromosomes

Most human cancers are _____. A) caused by the accumulation of mutations B) caused by viruses C) inherited from both parents, like an autosomal recessive mutation D) inherited from one parent, like an autosomal dominant mutation

A) caused by the accumulation of mutations

Ultraviolet (UV) radiation is damaging because it __________. A) causes mutations in DNA B) prevents DNA transcription C) prevents DNA translation D) deactivates the enzymes needed for DNA replication

A) causes mutations in DNA

As a patch of scraped skin heals, the cells fill in the injured area but do not grow beyond that. This is an example of A) density-dependent inhibition B) anchorage independence C) growth factor inhibition D) density-independent inhibition

A) density-dependent inhibition

The 2009 H1N1 flu virus A) evolved through the genetic reshuffling of viruses that infect humans, birds, and pigs B) killed over 50 million people worldwide C) was an avian flu virus D) was spread by mosquitoes

A) evolved through the genetic reshuffling of viruses that infect humans, birds, and pigs

Plants are being engineered to produce their own insecticides; therefore, __________. A) farmers can reduce chemical use B) the plants provide humans who consume them with the same resistance C) the plants will require fewer nutrients D) the nutritional value of the plants will improve

A) farmers can reduce chemical use

Two identical twins are raised in different environments. They possess _____ genotypes and _____ phenotypes. A) identical ... variable B) identical ... dissimilar C) identical ... identical D) contrasting ... identical

A) identical ... variable

Eukaryotic cells spend most of their cell cycle in which phase? A) interphase B) telophase C) metaphase D) prophase

A) interphase

The regions of noncoding DNA shown below that separate the coding regions within a gene are called __________. A) introns B) exons C) redundant coding sections D) transcription factors

A) introns

If a chromosome fragment breaks off and then reattaches to the original chromosome but in the reverse direction, the resulting chromosomal abnormality is called a(n) A) inversion B) reciprocal translocation C) translocation D) deletion

A) inversion

After fertilization, the resulting zygote begins to divide by __________. A) mitosis B) meiosis C) binary fission D) schizogony

A) mitosis

A physical or chemical agent that changes the nucleotide sequence of DNA is called a(n) A) mutagen B) terminator C) anticodon D) prion

A) mutagen

Mr. and Mrs. Smith have three sons in elementary school. Two of their children are progressing normally, but their youngest son, Charles, has been much slower than his siblings in developing speech and language skills. His parents are concerned that he has a learning disability and decide to investigate further. Since some learning disabilities can be genetically based, their pediatrician recommends a chromosomal analysis. The results show that Charles has a trisomy of the sex chromosomes, diagnosed as XYY. A mistake during sperm formation resulted in an extra copy of the Y chromosome. The extra copy was passed on to Charles during fertilization. Most often, this chromosomal change causes no unusual physical features or medical problems, but those with trisomy of the sex chromosomes may have a higher-than-normal risk of delays in learning development.The problem that occurred during meiosis in sperm formation was A) nondisjunction involving a Y chromosome B) formation of diploid sperm C) an inversion of the X chromosome, preventing the pairing of sex chromosomes D) failure of the second meiotic division to take place

A) nondisjunction involving a Y chromosome

Consider the following sequence and explain what effect the mutation has on the protein that is translated. UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type) UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant) A) prematurely stops the translation of the protein B) no effect C) complete change in amino acid sequence after the mutation D) single amino acid change

A) prematurely stops the translation of the protein

The lac operon in Escherichia coli A) prevents lactose-utilizing enzymes from being expressed when lactose is absent from the environment B) prevents lactose-utilizing enzymes from being expressed when lactose is present in the environment C) prevents lactose intolerance D) promotes the expression of lactose-utilizing enzymes when lactose is absent from the environment

A) prevents lactose-utilizing enzymes from being expressed when lactose is absent from the environment

Because it is passed essentially intact from father to son, Y chromosome research has been particularly useful in improving our understanding of __________. A) recent human evolution B) pleiotropy C) chromosome disorders D) X-linked human diseases

A) recent human evolution

The chromosome theory of inheritance states that A) the behavior of chromosomes during meiosis and fertilization accounts for patterns of inheritance B) chromosomes that exhibit mutations are the source of genetic variation C) the behavior of chromosomes during mitosis accounts for inheritance patterns D) humans have 46 chromosomes

A) the behavior of chromosomes during meiosis and fertilization accounts for patterns of inheritance

Concerns have been raised as to the safety of genetically modified organisms (GMOs). Which of the following would be a concern when modifying a plant to be resistant to a broad-spectrum herbicide? A) the production of herbicide-resistant weeds B) a decrease in the use of herbicides C) a decrease in food production D) an increased shelf life of the fruit from the plants

A) the production of herbicide-resistant weeds

Which possible use of reproductive cloning is still considered by most to be an unresolved ethical issue? A) the reproductive cloning of humans B) the production of organs in cloned pigs for transplant into humans C) cloning mammals for the production of potentially valuable drugs D) the production of genetically identical animals for experimentation

A) the reproductive cloning of humans

The relationship between DNA and histones is most like A) thread wrapped around a spool B) the candy shell surrounding the chocolate in a piece of M&M candy C) an egg yolk inside of an egg D) a spoon cradling some peas

A) thread wrapped around a spool

The Y chromosomes of mammals contain genes that code for _____. A) both eye pigment and blood-clotting factor, among many other characters B) "maleness" and a few other characteristics C) blood-clotting factor, among many other characters D) eye pigment, among many other characters

B) "maleness" and a few other characteristics

If one parent is blood type AB and the other is type O, what fraction of their offspring is expected to have blood type A? A) 0 B) 0.5 C) 0.75 D) 1.0

B) 0.5

A human bone marrow cell in the prophase stage of mitosis contains 46 chromosomes. Therefore, there are a total of __________ sister chromatids in this cell. A) 46 B) 92 C) 23 D) 23 or 46, depending on whether you look at the beginning or end of prophase

B) 92

Polyploidy is involved in which of the following examples? A) OXO females B) A normal watermelon has 22 chromosomes but seedless watermelons have 33 chromosomes C) XYY males D) Some plants alternate between haploid and diploid phases.

B) A normal watermelon has 22 chromosomes but seedless watermelons have 33 chromosomes

Which of the following diseases is NOT caused by a prion? A) kuru in humans B) AIDS C) mad cow disease D) Creutzfeldt-Jacob disease in humans

B) AIDS

What is the preferred name of the technique used to determine if DNA comes from a particular individual? A) DNA technology B) DNA profiling C) DNA microarrays

B) DNA profiling

Which of the following options best depicts the flow of information when a gene directs the synthesis of a cellular component? A) DNA → tRNA → mRNA → protein B) DNA → RNA → protein C) RNA → DNA → RNA → protein D) protein → RNA → DNA

B) DNA → RNA → protein

Which is a genetically modified organism but not a transgenic organism? A) AquAdvantage salmon (Atlantic salmon that expresses Chinook salmon growth hormone) B) Flavr Savr peaches (peaches that express larger quantities of a peach stability enzyme) C) Roundup Ready soybeans (soybeans that express bacterial pesticide enzymes) D) Golden Rice (rice that expresses daffodil and bacteria beta-carotene synthesis enzymes)

B) Flavr Savr peaches (peaches that express larger quantities of a peach stability enzyme)

Why are lethal dominant alleles so much more rare than lethal recessive alleles? A) The types of mutations that create lethal dominant alleles are much less frequent than those that create lethal recessive alleles B) Lethal dominant alleles are harmful whether they are carried in homozygous or heterozygous form, so there is always strong selection against these alleles C) Less is known about lethal dominant disorders, so the rareness of these alleles is an artifact due to a lack of detection. D) The lethality associated with lethal dominant alleles is much more severe than that associated with lethal recessive alleles.

B) Lethal dominant alleles are harmful whether they are carried in homozygous or heterozygous form, so there is always strong selection against these alleles

Which of the following statements regarding cancer risk factors is false? A) Eating 20-30 grams of plant fiber daily and reducing the intake of animal fat can reduce your risk of developing colon cancer. B) Mutagens are usually not carcinogens. C) Factors that alter DNA and make cells cancerous are called carcinogens. D) X-rays and ultraviolet radiation are two of the most potent carcinogens.

B) Mutagens are usually not carcinogens.

Trisomy for most autosomes is fatal, yet trisomy or even tetrasomy (four copies) of the X chromosome is not. What is the explanation for this difference? A) The number of X chromosomes is always balanced by the number of Y chromosomes B) Only one copy of the X chromosome is functional within any given cell, regardless of the total number of X chromosomes C) There is a mechanism to keep only two X chromosomes functional, regardless of the total number D) The X chromosome does not carry any genes

B) Only one copy of the X chromosome is functional within any given cell, regardless of the total number of X chromosomes

Imagine a particular character (such as flower color) that is determined by a single gene. If this gene is present in two forms, how can you tell which allele is dominant and which is recessive? A) Perform a cross between two true-breeding individuals and observe the trait or traits expressed by the F2 individuals B) Perform a cross between two true-breeding individuals and observe the trait or traits expressed by the F1 individuals C) The trait that is most common in the population is the one determined by the dominant allele D) Cross one of the F1 individuals to either of the parents and observe the trait or traits expressed by their offspring.

B) Perform a cross between two true-breeding individuals and observe the trait or traits expressed by the F1 individuals

Anhydrotic dysplasia is a genetic disorder in humans that results in the absence of sweat glands in the skin. Some men have this defect all over their bodies, but in women it is usually expressed in a peculiar way. Women with this disorder typically have small patches of skin with sweat glands and other patches without sweat glands. This pattern of sweat-gland distribution can be explained by __________. A) alternative RNA splicing B) X chromosome inactivation C) a mutation D) a homeotic gene

B) X chromosome inactivation

A woman and her male partner have normal color vision. However, her father and her first son are colorblind. What is her genotype? Use C as the gene for colorblindness. A) XCXC B) XCXc C) XcXc D) XCY

B) XCXc

Consider the photograph of a karyotype. This is _____. A) a means of determining a person's phenotype B) a photograph of all a person's chromosomes C) an individual's physical traits D) all the possible gametes a person could produce

B) a photograph of all a person's chromosomes

The shape of a DNA molecule is most like A) beads on a string B) a twisted rope ladder C) a wooden ladder D) a set of railroad tracks

B) a twisted rope ladder

Cloning experiments with differentiated root cells from carrots revealed that __________. A) once cells differentiate, they can only express a specific combination of genes B) an entire plant can grow from a differentiated cell C) a cell from root tissue will grow new root tissue D) an entire plant can grow from an undifferentiated cell

B) an entire plant can grow from a differentiated cell

The stage of mitosis during which the chromosomes move toward separate poles of the cell is _____. A) metaphase B) anaphase C) cytokinesis D) telophase

B) anaphase

Golden rice has been genetically engineered. Golden rice differs from other rice varieties because it contains genes that will produce _____. A) vitamin D B) beta-carotene C) pesticide resistance D) herbicide resistance

B) beta-carotene

Asexual and sexual reproduction differ in that sexual reproduction _____. A) is the only way single-celled organisms can reproduce B) can produce great variation among the offspring C) will produce offspring identical to the parents D) is the only way multicellular organisms can reproduce

B) can produce great variation among the offspring

Karyotyping A) shows chromosomes as they appear in metaphase of meiosis II B) can reveal alterations in chromosome number C) examines points of crossing over D) reveals the presence of cancerous genes

B) can reveal alterations in chromosome number

Which of the following occurs during interphase? A) cytokinesis B) cell growth and duplication of the chromosomes C) a reduction in the size of the nuclear membrane D) separation of newly formed DNA to opposite ends of the cell

B) cell growth and duplication of the chromosomes

The presence of AB blood type illustrates the principle of A) incomplete dominance B) codominance C) pleiotropy D) polygenic inheritance

B) codominance

MicroRNA (miRNA) functions by binding to __________ and blocking translation. A) introns B) complementary mRNA sequences C) tRNA molecules D) the ribosome

B) complementary mRNA sequences

The mechanism that "breaks" the linkage between linked genes is A) pleiotropy B) crossing over C) independent assortment D) codominance

B) crossing over

A cleavage furrow forms in an animal cell during _____. A) G1 phase B) cytokinesis C) anaphase D) metaphase

B) cytokinesis

The coding regions of a gene are called A) promoters. B) exons. C) introns. D) enhancers.

B) exons.

Genetically modifying ________ cells may directly affect future generations. A) somatic B) gamete-forming C) skin D) bone marrow

B) gamete-forming

In humans, the cancer responsible for the greatest number of deaths annually is __________. A) prostate cancer B) lung cancer C) breast cancer D) colon cancer

B) lung cancer

Many useful products, mainly for medical purposes, are produced by cloning human genes into other organisms, which then mass-produce these compounds. Which of the following organisms has NOT been used to mass-produce pharmaceutical compounds used to treat human diseases? A) Escherichia coli B) mice C) goats D) Saccharomyces cerevisiae

B) mice

Any change in the nucleotide sequence of DNA is called a A) base substitution B) mutation C) frameshift

B) mutation

The production of genetically identical animals that are carrying recombinant human genes for pharmaceutical purposes, for example using goats to produce antithrombin, is called a __________. A) recombination B) pharm C) transplant D) transformation

B) pharm

One version of a gene may encode __________, whereas a different version of the same gene may encode __________. A) red eyes; white coat B) red eyes; white eyes C) white eyes; white coat D) white eyes; brown coat

B) red eyes; white eyes

The tortoiseshell pattern on a cat A) is a result of alleles on the Y chromosome B) results from X chromosome inactivation C) is the result of a homozygous recessive condition D) usually occurs in males

B) results from X chromosome inactivation

The genetic material is duplicated during A) G1 B) the S phase C) G2 D) the mitotic phase

B) the S phase

Maternal inheritance patterns from generation to generation cannot be analyzed by simply studying the X chromosome in the way that paternal inheritance patterns can follow the Y chromosome because A) the X chromosome is too large to analyze effectively B) the X chromosome is obtained from both the father and the mother C) one X chromosome is deactivated in females D) the X chromosome sometimes exchanges genetic information with the Y chromosome

B) the X chromosome is obtained from both the father and the mother

Cystic fibrosis is inherited in an autosomal recessive pattern. Males who have cystic fibrosis are usually sterile. Furthermore, the disease is often lethal before the age of reproduction. Even though people with the disease rarely reproduce, cases continue to arise because __________. A) mosquitoes can transfer the disease from person to person B) the harmful allele "hides" inside heterozygous individuals and one-fourth of the offspring of two heterozygotes should be afflicted C) people continue to make inappropriate lifestyle choices D) new mutations continually introduce this harmful condition into the population

B) the harmful allele "hides" inside heterozygous individuals and one-fourth of the offspring of two heterozygotes should be afflicted

In order for gene therapy to be permanent in the patient being treated, A) the defective gene must first be removed from all somatic cells. B) the normal gene must be transferred to somatic cells that can continuously multiply. C) the normal gene must be added to the germ line cells. D) the normal gene must first be treated with UV radiation to ensure noninfectivity.

B) the normal gene must be transferred to somatic cells that can continuously multiply.

In frogs, when the nucleus of an intestinal cell of a tadpole is transferred to an egg whose nucleus has been removed (nuclear transplantation), some of the eggs will develop into normal tadpoles. This demonstrates that _____. A) these cells could not dedifferentiate B) these cells have retained all of their genetic potential C) frogs have adult stem cells D) intestinal cells are not differentiated

B) these cells have retained all of their genetic potential

The directions for each amino acid in a polypeptide are indicated by a codon that consists of ________ nucleotides in an RNA molecule. A) five B) three C) four D) two

B) three

The transfer of genetic information from DNA to RNA is called A) translation B) transcription C) initiation D) elongation

B) transcription

What is the proper order of the following events in the expression of a eukaryotic gene? A) RNA processing, transcription, translation B) transcription, RNA processing, translation C) translation, RNA processing, transcription D) translation, transcription, RNA processing

B) transcription, RNA processing, translation

Varieties of plants in which self-fertilization produces offspring that are identical to the parents are referred to as A) monohybrid crosses B) true-breeding C) the F2 generation D) hybrids

B) true-breeding

Life on Mars is finally discovered and a new organism that has six different nucleotides that encode 30 different amino acids is found on this planet. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism? A) four-nucleotide sequence (64 combinations) B) two-nucleotide sequence (62 combinations) C) one-nucleotide sequence (61 combinations) D) three-nucleotide sequence (63 combinations)

B) two-nucleotide sequence (62 combinations)

Many genetic disorders can be detected before birth. Procedures include _____, which is noninvasive, or _____, which allows the chromosomes of the fetus to be examined. Alternatively, maternal blood samples can be taken and tested for _____. A) ultrasound imaging ... AFP ... amniocentesis B) ultrasound imaging ... chorionic villus sampling ... AFP C) amniocentesis ... ultrasound imaging ... chorionic villus sampling D) amniocentesis ... AFP ... chorionic villus sampling

B) ultrasound imaging ... chorionic villus sampling ... AFP

Exposure to which of the following substances increases cancer risk? A) increased intake of plant fiber B) ultraviolet (UV) light exposure C) proto-oncogenes D) vitamin C

B) ultraviolet (UV) light exposure

Which of the following is only associated with RNA? A) adenine B) uracil C) thymine D) deoxyribose

B) uracil

Cloning human genes into the plasmids of bacteria has enabled scientists to __________. A) identify carriers of genetic diseases B) use bacteria as "factories" for protein products C) use these bacteria to mass-produce mRNA for certain genes D) insert the corrected gene into patients who have certain genetic disorders

B) use bacteria as "factories" for protein products

In a standard monohybrid cross between purple-flowered and white-flowered peas, in which purple flowers are dominant, what fraction of the purple-flowered peas in the F2 generation would you expect to be true-breeding? A) 1/16 B) 1/4 C) 1/3 D) 1/2

C) 1/3

How many pairs of autosomes do humans have? A) 1 B) 2 C) 22 D) 23

C) 22

A human somatic cell contains __________ chromosomes. A) 2n B) 23 C) 46 D) 47

C) 46

What is the difference between a benign tumor and a malignant tumor? A) Benign tumors are a mass of essentially abnormal cells; malignant tumors are an abnormal mass of essentially normal cells B) Benign tumors will not kill you; malignant tumors will C) Benign tumors do not metastasize; malignant tumors do D) Benign tumors metastasize; malignant tumors do not.

C) Benign tumors do not metastasize; malignant tumors do

Two normal parents have three normal children: one son and two daughters. Their son and one of their daughters marry and also have normal children. Their second daughter, Mary, marries a man with a rare, recessive blood disorder. They have two children, and both children develop the blood disorder. What must be true of the genotypes of Mary's parents? A) Her father was heterozygous for the trait B) Her mother was heterozygous for the trait C) Either one of her parents or both of her parents were heterozygous for the trait D) Mary's parents were both homozygous for the trait.

C) Either one of her parents or both of her parents were heterozygous for the trait

During binary fission, each copy of the duplicating chromosome moves to opposite ends of the cell. What does this achieve? A) It causes the cell to elongate B) It ensures the formation of two complete nuclei around each of the chromosomes C) It ensures that each daughter cell receives one copy of the chromosome D) This keeps the separate chromosomes together

C) It ensures that each daughter cell receives one copy of the chromosome

When we say that an organism is haploid, we mean that _____. A) Its cells each have two sets of chromosomes B) Its cells each have one chromosome C) Its cells each have one set of chromosomes D) Its cells have one half of a chromosome

C) Its cells each have one set of chromosomes

Which of the following statements best describes cancer cells? A) They are more highly differentiated than normal cells. B) They will divide 20 to 50 times and then stop. C) Normal controls over cell division have been altered. D) Proto-oncogenes control their cell division.

C) Normal controls over cell division have been altered.

Radiation is a frequent method of sterilization. It is effective because it causes damage to DNA. However, prions, the agents that cause diseases such as mad cow disease, are unaffected by these treatments because they lack DNA. What is the definition of a prion? A) Prions are proteins folded into the correct configuration B) Prions are small carbohydrate molecules that do not encode DNA C) Prions are proteins that are folded incorrectly D) Prions are small RNA molecules that do not encode proteins

C) Prions are proteins that are folded incorrectly

What controls the way in which a zygote differentiates? A) Operons mature and control gene expression B) The DNA of genes that will not be expressed is degraded C) Selective genes are turned on and off, depending on the fate of the cell D) All the genes that will be expressed in the adult are made in the zygote

C) Selective genes are turned on and off, depending on the fate of the cell

How do retroviruses such as HIV differ from other viruses? A) They contain DNA that is used as a template to make RNA B) They can reproduce only inside living cells C) They contain the enzyme reverse transcriptase D) They have much simpler reproductive cycles than other RNA viruses

C) They contain the enzyme reverse transcriptase

Alternative RNA splicing has revealed inaccuracies in the one gene-one polypeptide hypothesis. Why? A) It really should be the one exon: one polypeptide hypothesis B) It shows that it takes more than one gene to code for most polypeptides C) Transcription of the same gene can lead to the production of different mRNAs and therefore different proteins D) It really should be the one intron: one polypeptide hypothesis

C) Transcription of the same gene can lead to the production of different mRNAs and therefore different proteins

The sex chromosome complement of a normal human female is A) XY B) YY C) XX D) XO

C) XX

Which of the following would be considered a transgenic organism? A) a bacterium that has received genes via conjugation B) a fern grown in cell culture from a single fern root cell C) a rat with rabbit hemoglobin genes D) a human given a corrected human blood-clotting gene

C) a rat with rabbit hemoglobin genes

Golden Rice is golden in color because it is rich in A) vitamin A. B) vitamin C. C) beta-carotene.

C) beta-carotene.

During the replication of DNA molecules, __________. A) the cell undergoes mitosis B) errors never occur C) both strands of the parent molecule act as templates D) only one strand of the parent molecule acts as a template

C) both strands of the parent molecule act as templates

The function of meiosis is to make __________. A) exact copies of the parent cell B) one cell with twice the number of chromosomes as the parent cell C) four cells with a haploid number of chromosomes D) four cells with the same chromosome number as the parent cell

C) four cells with a haploid number of chromosomes

Clones are derived _____. A) from the offspring of a genetically pure individual B) using recombinant DNA C) from a single ancestor cell D) from a single gamete

C) from a single ancestor cell

Two chromosomes in a nucleus that carry genes controlling the same inherited characteristics are A) sister chromatids B) complementary chromosomes C) homologous chromosomes

C) homologous chromosomes

HIV and phage lambda both __________. A) use reverse transcriptase to replicate B) derive their viral envelopes from the host's cell membrane C) integrate their DNA into the host's chromosome D) have an RNA genome

C) integrate their DNA into the host's chromosome

Colonoscopy is the examination of the large colon. It allows for visual diagnosis of ulcers and polyps, which may lead to colon cancer. A polyp _____. A) causes mutations that lead to colon cancer B) is a malignant tumor C) is a cluster of abnormal cells D) is likely to form after one exposure to a carcinogen

C) is a cluster of abnormal cells

Sex-linked conditions are more common in men than in women because A) men acquire two copies of the defective gene during fertilization B) most genes associated with the sex-linked conditions are linked to the Y chromosome, which determines maleness C) men need to inherit only one copy of the recessive allele for the condition to be fully expressed D) the sex chromosomes are more active in men than in women

C) men need to inherit only one copy of the recessive allele for the condition to be fully expressed

During which phase of mitosis do the chromosomes line up on a plane equidistant from the two spindle poles? A) anaphase B) telophase C) metaphase D) prophase

C) metaphase

The monomers of DNA and RNA are A) monosaccharides B) fatty acids C) nucleotides D) nucleic acids

C) nucleotides

Which of the following shows mitosis in the correct chronological order? A) anaphase, prometaphase, metaphase, prophase, telophase B) telophase, prophase, anaphase, prometaphase, metaphase C) prophase, prometaphase, metaphase, anaphase, telophase D) prometaphase, metaphase, prophase, telophase, anaphase

C) prophase, prometaphase, metaphase, anaphase, telophase

The cross-fertilization of two different, but true-breeding, varieties of pea plants will _____. A) be lethal B) produce an F2 generation C) result in hybrid plants D) yield the P generation

C) result in hybrid plants

Cancer of the colon is caused by A) a single somatic cell gene mutation. B) a physical rupture of the colon. C) several somatic cell gene mutations. D) a diet high in fiber and low in fat.

C) several somatic cell gene mutations.

Stem cells could be immensely important in the treatment of which of the following conditions in the near future? A) hardened arteries B) lung cancer C) spinal cord injuries D) loss of a limb

C) spinal cord injuries

A vaccine works by A) inhibiting bacterial replication. B) inhibiting viral replication. C) stimulating the immune system. D) preventing the translation of mRNA.

C) stimulating the immune system.

Imagine that we mate two black Labrador dogs with normal vision and find that three of the puppies are like the parents, but one puppy is chocolate with normal vision and another is black with PRA (progressive retinal atrophy, a serious disease of vision). We can conclude that A) the alleles for color and vision segregate dependently during gamete formation B) the same alleles that control coat color can also cause PRA C) the alleles for color and vision segregate independently during gamete formation D) both of the parents are homozygous for both traits.

C) the alleles for color and vision segregate independently during gamete formation

Which of the following takes place during translation? A) the conversion of genetic information from DNA nucleotides into RNA nucleotides B) the conversion of genetic information from the language of proteins to the language of enzymes C) the conversion of genetic information from the language of nucleic acids to the language of proteins

C) the conversion of genetic information from the language of nucleic acids to the language of proteins

In people with sickle-cell disease, red blood cells break down, clump, and clog blood vessels. Blood vessels and broken cells accumulate in the spleen. Among other symptoms, this leads to physical weakness, heart failure, pain, and brain damage. Such a suite of symptoms can be explained by __________. A) side effects of the drugs used to treat sickle-cell disease B) the polygenic nature of sickle-cell disease C) the pleiotropic effects of the sickle-cell allele D) a bacterial infection interacting with the sickle-cell allel

C) the pleiotropic effects of the sickle-cell allele

If protein production were an assembly line, a ribosome would be _____. A) a loose piece that needs to be put together B) the machines that move pieces to their appropriate locations C) the worker who puts all of the pieces together D) the foreman who barks out instructions

C) the worker who puts all of the pieces together

The advantage of being able to clone the gene for human insulin is that A) cow, pig, or horse insulin cannot keep a diabetic alive for more than 3 months. B) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin. C) there are too few cows, pigs, and horses to provide an adequate supply of their insulin. D) using human insulin increases the probability that, in the future, the person suffering from diabetes can be weaned from a dependence on insulin.

C) there are too few cows, pigs, and horses to provide an adequate supply of their insulin.

In humans, the agent responsible for the greatest number of cancers is _____. A) X-rays B) UV radiation C) tobacco D) dietary fat

C) tobacco

Both prokaryotic and eukaryotic cells use ________ to turn certain genes on or off. A) RNA polymerase B) activators C) transcription factors D) enhancers

C) transcription factors

Which genetically modified organism has not been developed by genetic engineers (at least, not yet)? A) transgenic salmon with a growth hormone gene that allows them to grow more quickly B) transgenic rice with genes for milk proteins C) transgenic corn with the gene for human insulin D) transgenic pigs with a roundworm gene that allows them to make more omega-3 fatty acids

C) transgenic corn with the gene for human insulin

Justin has type A blood and his wife Brittany has type B blood. Justin's parents both have type AB blood, and Brittany's parents also both have type AB blood. What are the chances that Justin and Brittany's son Theodore has type A blood? A) 100% B) 25% C) 75% D) 0%

D) 0%

A woman who is a carrier of hemophilia marries a man affected with hemophilia. What percentage of their sons and daughters is expected to have hemophilia? A) 100% of sons and 50% of daughters B) 50% of sons and 0% of daughters C) 0% of sons and 50% of daughters D) 50% of sons and 50% of daughters

D) 50% of sons and 50% of daughters

Snapdragons show incomplete dominance in their flowers. A pink snapdragon is crossed with a red snapdragon. What color(s) are the offspring? A) 50% red, 50% white B) 100% red C) 100% pink D) 50% red, 50% pink

D) 50% red, 50% pink

In Labrador retrievers, a common breed of dog, black coat is dominant to chocolate, normal vision is dominant to progressive retinal atrophy (PRA), and normal hip joint is dominant to hip dysplasia. All these genes assort independently. Two dogs that are heterozygous for alleles of all three genes are crossed. Using rules of probability (not a Punnett square), what is the chance that the first pup born to these dogs will be chocolate, have normal vision, and have normal hip joints? A) 1/64 B) 1/16 C) 3/32 D) 9/64

D) 9/64

________ marks the end of a gene and causes transcription to stop. A) A stop codon B) RNA ligase C) Methionine D) A terminator

D) A terminator

In the laboratory, cancer cells fail to show density-dependent inhibition of growth in cell culture. What is one explanation that could account for this? A) Cancer cells are unable to attach to a surface and grow B) Cancer cells continue to die at a rate that is equal to their growth C) Cancer cells have inactive receptors for growth factors D) Cancer cells continuously secrete growth factors into the cell culture medium

D) Cancer cells continuously secrete growth factors into the cell culture medium

Which of the following statements about DNA technology is false? A) DNA technology is now used to produce vaccines that are harmless mutants of a pathogen. B) DNA technology is now used to mass-produce human insulin. C) DNA technology is now used to mass-produce human growth hormone. D) DNA technology is now used to create cells that can identify and kill cancer cells.

D) DNA technology is now used to create cells that can identify and kill cancer cells.

An insect that has the genotype EeGGcc will have the same phenotype as an insect with the genotype __________. A) EEggcc B) eeggcc C) EEGGCc D) EEGgcc

D) EEGgcc

If independent assortment did not occur, which of the following would be true? A) Meiosis II would not be required to produce gametes, as meiosis I would be sufficient B) Each sperm and egg would carry more than one allele for a specific gene C) A dihybrid cross of heterozygous individuals would yield four different phenotypes D) Genes for two different traits would be inherited together as a pair

D) Genes for two different traits would be inherited together as a pair

What does the process of gene therapy involve? A) It is the successful treatment of all individuals affected by the disorder being treated. B) It treats the gametes of the affected individual so that their children will remain unaffected by the genetic disorder. C) It allows individuals to follow the natural progression of a genetic disorder, accompanied by psychological counseling, then treating with drugs only when the condition becomes life-threatening. D) It adds a functioning version of the

D) It adds a functioning version of the defective gene to the cells of an individual.

How was the hepatitis B vaccine produced? A) A harmless variant, a natural mutant, was used to stimulate an immune response. B) Animals, particularly mammals such as goats, were genetically engineered to produce hepatitis B proteins. C) Scientists injected animals with the hepatitis B virus and then harvested their antibodies. D) Microorganisms were genetically engineered to produce hepatitis B proteins.

D) Microorganisms were genetically engineered to produce hepatitis B proteins.

Which of the following statements regarding genetic testing is false? A) The screening of newborns can catch inherited disorders right after birth B) Carrier testing helps determine whether a person carries a potentially harmful disorder C) Genetic testing before birth requires the collection of fetal cells D) Most human genetic diseases are treatable if caught early

D) Most human genetic diseases are treatable if caught early

In giraffes, long necks (N), long legs (L), dark spots (D), and the ability to digest maize (M) are all dominant traits. What possible genotype could a long-necked, short-legged, light-spotted, maize-digesting giraffe have? A) NNLLDdMm B) nnLLddMM C) NNllddmm D) NnllddMM

D) NnllddMM

Within one chromosome, what is the relationship between the sequence of bases in DNA of one sister chromatid compared to the other? A) The sequence in one chromatid is complementary to the sequence in the other B) The sequences are unrelated C) The sequences are similar, but not identical D) The sequences are identical

D) The sequences are identical

Genetically modified organisms include microbes used in biotechnology that possess enzymes promoting antibiotic resistance. This could be a problem given the rise of antibiotic-resistant organisms. However, these engineered microorganisms do not pose a risk to public health. What do you think prevents them from spreading antibiotic resistance to pathogens outside the laboratory? A) Humans contain enzymes that would disable these microbes. B) These organisms would not transfer antibiotic resistan

D) These microbes have been designed so that conditions outside the laboratory would be unfavorable to their survival.

Which of the following represents a chromosomally normal human female? A) XXX B) X C) XXY D) XX

D) XX

Huntington's disease is an example of a genetic disorder caused by __________. A) a nonlethal dominant allele B) homozygous recessive alleles C) a late-acting recessive allele D) a late-acting lethal dominant allele

D) a late-acting lethal dominant allele

Linked genes are inherited together. This is because linked genes _____. A) govern traits that have nothing to do with one another B) govern traits (such as hair texture and hair color) that are functionally related C) have the same alleles residing on them D) are on the same chromosome

D) are on the same chromosome

Mature human neuron (nerve) cells and muscle cells A) continue to divide throughout their lifetime B) cease dividing after a predetermined number of cell generations C) become cancerous more easily than other cell types D) are permanently in a state of nondivision

D) are permanently in a state of nondivision

Embryonic stem cells differ from adult stem cells because they __________. A) are capable of many cell divisions B) can differentiate into many cell types C) are capable of being fertilized D) can differentiate into all cell types

D) can differentiate into all cell types

A transgenic animal is an animal A) containing genes from three or more species. B) that is the first of its kind to bear a particular allele. C) in which a genetic defect has been corrected using recombinant DNA therapy. D) containing a gene from another organism, typically of another species.

D) containing a gene from another organism, typically of another species.

Meiosis differs from mitosis in that _____ only occurs in meiosis. A) the fragmentation of the nuclear envelope B) cytokinesis C) the formation of a spindle D) crossing over

D) crossing over

The process by which the cytoplasm of a eukaryotic cell divides to produce two cells is called A) mitosis B) binary fission C) telophase D) cytokinesis

D) cytokinesis

In bacterial cells, binary fission involves __________. A) disintegration of the nuclear membrane B) prophase, metaphase, anaphase, and telophase C) formation of a cell plate D) distribution of a copy of the single parental chromosome to each daughter cell

D) distribution of a copy of the single parental chromosome to each daughter cell

Mendel's law of independent assortment states that A) genes are sorted concurrently during gamete formation B) chromosomes sort independently of each other during mitosis and meiosis C) independent sorting of genes produces polyploid plants under some circumstances D) each pair of alleles (chromosomes) segregates independently of the other pairs of alleles during gamete formation

D) each pair of alleles (chromosomes) segregates independently of the other pairs of alleles during gamete formation

Which of the following is a feature of plant cell division that distinguishes it from animal cell division? A) formation of a cleavage furrow B) lack of cytokinesis C) production of four (rather than two) new cells per mitotic division D) formation of a cell plate

D) formation of a cell plate

The type of mutation represented below is a(n) __________. The big red fly had one eye (wild type) The fbi gre dfl yha don eey (mutant) A) single base substitution B) addition of a codon C) deletion D) frameshift

D) frameshift

Which of the following would be most likely to lead to cancer? A) generation of multiple copies of a proto-oncogene that promotes cell division and activation of a tumor-suppressor gene B) failure of both a proto-oncogene that promotes cell division and a tumor-suppressor gene to produce proteins C) failure of a proto-oncogene that promotes cell division to produce a protein and generation of multiple copies of a tumor-suppressor gene D) generation of multiple copies of a proto-oncogene that pro

D) generation of multiple copies of a proto-oncogene that promotes cell division and inactivation of a tumor-suppressor gene

Human growth hormone is a secreted protein that stimulates growth and cell reproduction. In the 1960s it was discovered that this was an effective treatment for a form of dwarfism. However, before it was genetically engineered, it was _____. A) substituted with similar animal proteins B) not available C) synthesized chemically D) harvested from cadavers

D) harvested from cadavers

Which of the following is an example of incomplete dominance in humans? A) skin color B) ABO blood groups C) albinism D) hypercholesterolemia

D) hypercholesterolemia

A child with cystic fibrosis can be born to two parents who do not have the disease. This is because the disease _____. A) occurs in individuals who received more than one allele from one or both parents B) is caused by a dominant allele C) requires certain environmental conditions to be expressed D) is caused by a recessive allele

D) is caused by a recessive allele

Variation occurs when chromosomes are shuffled in _____. A) mitosis B) genetic drift C) mutation D) meiosis

D) meiosis

The term gene expression refers to the A) fact that individuals of the same species have different phenotypes B) fact that each individual of a species has a unique set of genes C) flow of information from parent to offspring D) process by which genetic information flows from genes to proteins

D) process by which genetic information flows from genes to proteins

Cancer is not usually inherited because A) the causes of cancer are not usually genetic B) the cancerous cells usually interfere with the ability to produce gametes C) people with cancer usually die before reproducing D) the chromosomal changes in cancer are usually confined to somatic cells

D) the chromosomal changes in cancer are usually confined to somatic cells

Hemophilia appears rarely in females. This is because __________. A) the female must possess the hemophilia allele on one X chromosome B) it only affects females with two X chromosomes C) it only affects males because they have only one X chromosome D) the female must possess the hemophilia allele on both X chromosomes

D) the female must possess the hemophilia allele on both X chromosomes

The "one gene-one enzyme" hypothesis states that A) the synthesis of each enzyme is catalyzed by one specific gene B) the function of each polypeptide is to regulate the synthesis of each corresponding gene C) the synthesis of each gene is catalyzed by one specific enzyme D) the function of an individual gene is to dictate the production of a specific polypeptide

D) the function of an individual gene is to dictate the production of a specific polypeptide

Two parents of mixed ethnicity have twins, one of which is born with very light skin and one of which is born with very dark skin. This is because of __________. A) exposure to sunlight B) the pleiotropic effects of skin color genes C) the inheritance of two linked skin color genes D) the polygenic nature of skin color genes

D) the polygenic nature of skin color genes

In a monohybrid cross, F2 refers to __________. A) the original mating pair B) the grandparents of the 1st generation C) the 1st filial generation D) the second filial generation, or the "grandchildren" of the original mating pair

D) the second filial generation, or the "grandchildren" of the original mating pair

The carcinogen known to cause the most cases and types of cancer is A) ultraviolet light. B) X-rays. C) alcohol. D) tobacco.

D) tobacco.

HIV does the greatest damage to A) pancreatic cells B) nervous tissue C) the adrenal glands D) white blood cells

D) white blood cells


Conjuntos de estudio relacionados

Module 1: Lesson 2 - The Fibonacci Sequence and the Golden Ratio

View Set

U.S. History Unit 4 Lesson 3 William Howard Taft Administration

View Set

Anatomy and Physiology Chapter 12

View Set

Cyber Sec 2 ch 4 test study guide

View Set

Microeconomic Theory Exam 3 Conceptual Question

View Set

MNGT 301 || Chapter 13 - Groups and Teams: Increasing Cooperation, Reducing Conflict

View Set