Exam 1 Review
After the second ultracentrifuge for cell fractionation the pellet contains ____________ and the supernatant contains __________.
Inner and outer membranes, Cytoplasm
After the Density gradient (3rd) ultracentrifuge for cell fractionation the higher-density band contains ____________ and the lower-density band contains __________.
Outer membranes, Inner membranes
Steps to verify the predicted function of a gene from an uncultured organism
1. DNA is sequenced to identify gene of interest 2. the gene is inserted into a culturable organism (e.g., E. coli) 3. the gene is transcribed 4. mRNA is translated 5. the protein is purified 6. the protein is tested for predicted function
Label other
1. FM4-64 lipophilic dye 2. labeled antibody to aquaporin 3. Fusion reporter of GFP and ATP synthase 4. Labeled antibody to beta-galactosidase
What are the four phases of the bacterial growth curve?
1. Lag phase 2. Log phase 3. Stationary phase 4. Death phase
Rank the following from coldest growth to hottest growth -psychrotrophs -hyperthermophile -facultative thermophile -obligate psychrophiles -mesophiles -obligate thermophile
1. Obligate psychrophiles 2. psychrotrophs 3. mesophiles 4. facultative thermophile 5. obligate thermophile 6. hyperthermophile
Rank the microorganisms from largest to smallest Prochlorococcus, escherichia coli, Varicella-zoster virus, spirogyra, Pelomyxa
1. Pelomyxa - Ameba 2. spirogyra - aquatic algae 3. escherichia coli - bacteria found in the human colon 4. prochloroccocus - photosynthetic marine bacteria 5. Varicella-zoster virus - the virus that causes chickenpox
Order the following components in E. coli during balanced exponential growth from greatest to least in terms of % of total cellular weight -Lipids, water, inorganic ions, protein, nucleic acid (DNA + RNA)
1. Water 2. Protein 3. Nucleic acid (DNA + RNA) 4. Lipids 5. Inorganic ions
What are the steps of the Gram stain?
1. add methanol 2. add crystal violet 3. add iodine 4. wash with ethanol 5. add safranin
what is the historical timeline of DNA investigation?
1. chromosomes known to contain genetic material 2. "transformation" factor proposed by Griffith 3. DNA proved to be transforming factor 4. viral DNA shown to carry viral genes 5. first genome fully sequenced
Label
1. labeled antibody to helicase 2. origin sequence tagged with fluorophore 3. DAPI (4', 6-diamidino-2-phenylindole)
Based on your answer to Part 1, do you think the bacteria are dividing rapidly during the daytime? Find out by calculating the generation (doubling) time and enter it here:
167 minutes
A disinfectant was added to a culture of bacteria containing 20,000,000 CFUs per milliliter to start. Since the D value of the disinfectant is 1 minute and 20 seconds, there will be __________ CFUs per ml after 4 minutes.
20,000
The Hawaiian bobtail squid Euprymna scolopes harbors a dense population of symbiotic, bioluminescent Vibrio fischeri in specialized light organs. An adult squid contains about 5 × 108 symbionts, and the light they produce provides counterillumination to help the squid avoid predation at night when it is foraging above the sand flats. The squid returns to the sand by daybreak, and at this time 95% of the symbiont population is expelled back into the environment. Assuming the remaining bacteria divide at a constant rate of growth, how many generations must take place to repopulate the organ by nightfall (12 hours later)?
4.32 generations
A food worker was preparing some macaroni salad on the same counter on which he had cut up some raw chicken. Suppose this resulted in the accidental introduction of 380 cells of E. coli into the 1 gallon container of macaroni. This careless worker then left it unrefrigerated until 6 hours later. Now consider that E. coli has a doubling (generation) time of 20 minutes when grown in a rich medium. Assuming the cells were dividing at their maximum rate in the macaroni salad, what would the level of bacterial contamination be by the time it was finally refrigerated?
9.96 x 10^7 cells
Bacterial DNA is a relatively huge molecule in the cell. DNA comprises approximately how much of a bacterial cell's dry mass? A. 3.0% B. 60% C. 30% D. 0.3%
A. 3.0%
Which of the following best explains the difference between the staining of Gram-positive bacteria versus Gram-negative bacteria? A. Gram-negative bacteria have a thinner, more porous cell wall that is easier to decolorize. B. Gram-positive bacteria have special spore-forming structures that hold the crystal violet stain more tightly. C. Gram-positive bacteria have a capsule that holds the crystal violet stain better. D. Gram-positive cells are stained with positively charged dyes, while Gram-negative cells are stained with negatively charged dyes. E. Gram-negative bacteria have an outer membrane that prevents crystal violet from attaching to the cell wall.
A. Gram-negative bacteria have a thinner, more porous cell wall that is easier to decolorize
Which of the following statements regarding the bacterial sacculus are true? Choose one or more: A. It provides protection from osmotic rupture. B. The crucial cross-linking reactions occur inside the cell (i.e., in the cytoplasm). C. It is composed of peptidoglycan. D. It is impervious to polar or charged molecules. E. It is also known as the cell wall.
A. It provides protection from osmotic rupture C. It is composed of peptidoglycan E. It is also known as the cell wall
Which of the following statements best describes the antiparallel arrangement of double-stranded DNA? A. One DNA strand runs from the 5'-to-3' direction and the other DNA strand runs from the 3'-to-5' direction. B. Phosphodiester bonds link the 3′ carbon of one ribose to the 5′ carbon of the next ribose. C. An original parent DNA strand and one newly synthesized DNA strand compose a new DNA molecule. D. A purine always pairs, via hydrogen bonds, with a pyrimidine.
A. One DNA strand runs from the 5'-to-3' direction and the other DNA strand runs from the 3'-to-5' direction
Which of the following scenarios would cause a peritrichously flagellated bacterium (like E. coli) to swim in a forward motion? A. all flagella turning counterclockwise B. 50% or more of the flagella rotating counterclockwise C. all flagella turning clockwise D. rotation of the flagella (direction doesn't matter) on only the "back" half of the bacterium E. 50% or more of the flagella rotating clockwise
A. all flagella turning counterclockwise
Which of the following would not be an advantage to heat-fixing a bacterial specimen to a slide? A. allows visualization of flagellar function B. allows focus to a specific area C. prevents exposure to harmful organisms D. allows differential stains to be performed on the sample
A. allows visualization of flagellar function
A Gram-negative cell envelope contains A. an inner cell membrane, thin peptidoglycan layer, and outer membrane. B. a cell membrane covered by a thick layer of peptidoglycan. C. a double membrane, but no peptidoglycan cell wall. D. a thin layer of peptidoglycan surrounded by a cell membrane. E. a thick layer of peptidoglycan only.
A. an inner cell membrane, thin peptidoglycan layer, and outer membrane
Cells of a normally rod-shaped bacterium (e.g., Bacillus subtilis) that have completely lost the ability to produce the MreB protein would mostly likely be A. coccoid-shaped. B. stalked (like Caulobacter). C. filamentous in form. D. unable to divide symmetrically. E. nonflagellated.
A. coccoid-shaped
Which of the following technologies describes how super-resolution imaging can track a single molecule inside of a cell, even though the resolution limit of light is much larger than the molecule being tracked? A. computation of central peak position based on intensity profile B. calculated wavefront emissions from light scattering observations C. nanoscale secondary ion mass spectrometry of fluorophore location D. fluorescent emission wavelength intensity spectra
A. computation of central peak position based on intensity profile
Which of the following is the best description of the difference between simple and differential stains? A. Differential stains always stain one kind of cell but not another kind. B. Differential stains always use a mordant. C. Differential stains always use two different dyes. D. Differential stains always use a decolorizing step. E. Differential stains always indicate organisms down to the species level.
A. differential stains always stain one kind of cell but not another kind
Which of the following would have the greatest effect on cell function due to changes in pH? A. disrupting protein secondary structure, thus decreasing enzyme activity B. changing the fatty acid interactions in membranes, thus harming the integrity of the hydrophobic barrier C. changing nucleic acids to nucleic bases and interfering with the DNA code D. causing carbohydrate changes so that they would no longer serve as proper nutrient sources
A. disrupting protein secondary structure, thus decreasing enzyme activity
What techniques could have been used to examine the locations of the mouse and human membrane proteins? Choose one or more: A. fluorescence microscopy with fluorophore-labeled antibodies B. fluorescence microscopy with gene fusion reporters C. scanning electron microscopy D. fluorescence microscopy with fluorophore-labeled nucleic acids E. transmission electron microscopy
A. fluorescence microscopy w/ fluorophore-labeled antibodies B. fluorescence microscopy with gene fusion reporters
Which of the following are extragenomic DNA molecules that commonly interact with bacterial genomes? Choose one or more: A. horizontally transferred bacterial plasmids B. eukaryote-specific plasmids, such as 2µ in Saccharomyces cerevisiae C. mitochondrial genomes D. bacteriophage genomes
A. horizontally transferred bacterial plasmids D. bacteriophage genomes
Many potentially pathogenic bacteria are prevented from growing in our bodies because this essential element is tightly bound by specific proteins. A. iron B. calcium C. sodium D. magnesium E. potassium
A. iron
When preparing to examine a specimen using a microscope, one should begin with a low-power objective because of which of the following reasons? A. It generates a range of planes so that the object is in or near focus. B. It requires more light in order to provide the best possible contrast. C. It creates a smaller field of view so that the object can be more easily magnified. D. It decreases the depth of field to provide better resolution. E. It allows immersion oil in order to provide the proper density to prevent refraction.
A. it generates a range of planes so that the object is in or near focus
What eventually happens to the electron that gains energy during the process of fluorescence? A. It returns to its original energy level in the atom. B. It is released from the atom as a longer wavelength of electromagnetic radiation. C. It gains energy and leaves the atom as a longer wavelength. D. It gains heat and burns, thus causing a different colored emission spectrum.
A. it returns to its original energy level in then atom
Which of the following are possible structural forms of bacterial and archaeal chromosomes? Choose one or more: A. linear DNA chromosomes B. circular RNA chromosomes C. circular DNA chromosomes D. linear RNA chromosomes
A. linear DNA chromosomes C. circular DNA chromosomes
Spontaneous generation is the notion that A. living organisms arise from nonliving matter. B. microbes are ubiquitous. C. antibiotics are produced by microorganisms to defend against other microorganisms. D. microbes cause disease.
A. living organisms arise from nonliving matter
Which of the following is not a mechanism by which plasmids ensure their inheritance and maintenance during cell division? A. low-copy-number plasmids B. carrying partitioning system genes, parC, parM, and parR C. carrying self-preservation genes, known as addiction modules D. high-copy-number plasmids E. carrying antibiotic resistance genes
A. low-copy-number plasmids
Good resolution of microscopic objects using electromagnetic radiation (e.g. visible light) requires which of the following? Choose one or more: A.magnification B.scattering C.contrast D.absorption E.reflection F.wavelength smaller than the object
A. magnification C. contrast F. wavelength smaller than the object
Which of the following are characteristics of archaeal cell membranes that probably help them survive at very high temperatures? Choose one or more: A. membrane monolayers B. branched fatty acids C. cyclopentane rings D. high percentage of LPS E. ether-linked lipids
A. membrane monolayers C. cyclopentane rings E. ether-linked lipids
Choose the pair of words that correctly completes the following sentence: Biofilms preferentially form in __________ environments with __________ levels of nutrients. A. moist / high B. dry / high C. dry / low D. moist / low
A. moist / high
Which of the following materials are commonly stored by bacteria for future metabolic needs? Choose one or more: A. polyhydroxybutyrate (PHB) B. gas vesicles C. glycogen D. elemental sulfur (S0) E. nanotubes
A. polyhydroxybutyrate (PHB) C. glycogen D. elemental sulfur (S^0)
Biofilms are defined as microbial communities growing within a self-produced extracellular matrix composed primarily of A. polysaccharides. B. fimbriae. C. peptidoglycan. D. ejected flagella. E. waxy lipids.
A. polysaccharides
Which of the following adaptations helps microbes growing at the bottom of the ocean? A. polyunsaturated fats in phospholipids to help increase membrane fluidity B. ether linkages of isoprenes to prevent cold temperatures from destroying membranes C. production of chaperone proteins to prevent denaturation of enzymes D. monolayer membranes to accomodate the increased pressure
A. polyunsaturated fats in phospholipids to help increase membrane fluidity
Which of the following best describes a function of DNA polymerase III in bacterial replication? A. proofreads newly synthesized DNA B. synthesizes RNA primers C. adds nucleotides to fill in the gaps between Okazaki fragments D. joins Okazaki fragments E. unzips the DNA helix
A. proofreads newly synthesized DNA
Which of the following techniques would be best to use to study extremophiles that cannot be cultured in normal laboratory conditions? A. the polymerase chain reaction to amplify the DNA to have enough for further analysis B. peptide analysis to study protein fragments C. gas chromatography to study the lipid composition D. spectrophotometry to measure the cell concentration
A. the polymerase chain reaction to amplify the DNA to have enough for further analysis
Mature biofilms of Pseudomonas aeruginosa produce flagellated cells for what purpose? A. to go in search of new places to colonize B. to increase water and nutrient flow through biofilm channels via flagellar rotation (like a mini motor) C. to escape grazers that may be foraging on the biofilm D. to provide additional elevation to the biofilm towers (the flagella act as stalks) E. There is no real "purpose." Because of random mutations, some revert to a flagellated form.
A. to go in search of new places to colonize
MacConkey agar is an example of a medium that is which of the following? Choose one or more: A. differential based on ability to ferment lactose B. differential based on ability to ferment mannitol C. enriched with blood to support selected human pathogens D. selective for Gram-positive bacteria E. selective for Gram-negative bacteria F. general purpose (suitable for Gram-negatives and Gram-positives)
A.differential based on ability to ferment lactose E. selective for Gram-negative bacteria
Analysis of the genome of a newly discovered bacterial strain reveals that it is composed of a double-stranded DNA molecule containing 16% thymine. Based on this information, what would you predict the percentage of cytosine to be? A. 16% B. 34% C. 68% D. 32%
B. 34%
Which of the following DNA molecules would most likely have the highest denaturing temperature (melting temperature, Tm)? Only a single strand of the double-stranded DNA is shown. A. ACATTCGTAGTATCGCTTTTT B. ACGGTGACGGCGCGAGCGC C. AGTTACAGTAACTAACAAAT D. AACACTTAGTTATAATTGATT
B. ACGGTGACGGCGCGAGCGC
How does temperature affect microbial physiology? A. Slightly increased temperatures would cause DNA denaturation, thus killing the cell and eliminating microbial physiology. B. Slightly increased temperature speeds up the action of enzymes, thus increasing microbial metabolism. C. Decreased temperatures increase the chances of causing beneficial mutations, thus increasing microbial physiology. D. Decreased temperatures increase membrane fluidity to allow organisms to take up more nutrients.
B. Slightly increased temperature speeds up the action of enzymes, thus increasing microbial metabolism
Why are human eyes not able to use all of the information in visible light? A. Airy disks do not resolve when passing through the lens of the eye. B. The distance between photoreceptors is greater than the wavelength of visible light. C. The scattering of light occurs due to imperfections in the lens of the eye. D. Light acts like both a beam of particles and a wave.
B. The distance b/w photoreceptors is greater than the wavelength of visible light
For much of the history of microbiology, scientists have studied cells suspended in liquid culture. Recently, however, much more attention has been given to bacteria growing as attached communities on surfaces (that is, as biofilms). What are some reasons why biofilms are considered to be such a high research priority? Choose one or more: A.They are easy targets for phagocytes and protists. B.They can cause tooth decay. C.They can damage and degrade industrial equipment. D.Bacteria cannot communicate by quorum sensing unless attached to a surface. E.They can cause chronic and recurrent infections. F.They represent the preferred mode of existence for most bacteria.
B. They can cause tooth decay C. they can damage and degrade industrial equipment E. they can cause chronic and recurrent infections F. they represent the preferred mode of existence for most bacteria
Using nitrate as the final electron acceptor for the electron transport chain is associated with which of the following? A. Fenton reaction B. anaerobic respiration C. aerobic respiration D. fermentation E. glycolysis
B. anaerobic respiration
Tetracycline is an antibiotic that works by binding to the 30S subunit of bacterial ribosomes, thus inhibiting protein synthesis. This drug is able to cross the cell membrane because A. it acts as a mild detergent to weaken and partially dissolve the lipid bilayer. B. as a weak base, it can cross the membrane in its uncharged form. C. as a weak acid, it forms small holes in the membrane through which it passes. D. it closely resembles aromatic amino acids and enters using their transport proteins. E. it also binds to sugars, thereby "hitching a ride" on normal nutrients into the cell.
B. as a weak base, it can cross the membrane in its uncharged form
Suppose you have isolated a compound that alters the quorum signal of Pseudomonas aeruginosa, such that it cannot interact with its normal receptor. Bacterial cells targeted by such a disrupter would most likely A. retain their flagella after surface contact. B. be similar to free-living cells in their sensitivity to antibiotics. C. be nonmotile. D. be unable to respond to settling cues. E. be unable to turn off twitching motility.
B. be similar to free-living cells in their sensitivity to antibiotics
Which of the following structures does not play a role in adherence of bacteria to surfaces and/or host cells? A. pili (fimbriae) B. carboxysomes C. flagella D. stalk and holdfast E. extracellular polysaccharides
B. carboxysomes
All of the following would represent good research applications for cell fractionation EXCEPT A. isolating ribosomes for in vitro translation studies. B. determining whether a bacterium can metabolize certain sugars. C. obtaining outer membrane proteins for vaccine development. D. characterizing cell membrane lipids. E. analyzing periplasmic binding proteins.
B. determining whether a bacterium can metabolize certain sugars
MacConkey agar is most suitable for the cultivation of which of the following? A. lactic acid bacteria (such as Lactobacillus and Streptococcus) B. enteric pathogens (such as Salmonella and Shigella) C. endospore formers (such as Bacillus) D. nutritionally fastidious organisms (such as Neisseria) E. respiratory pathogens (such as Mycobacterium)
B. enteric pathogens (such as Salmonella and Shigella)
Which of the following would be associated with archaea growing in extremely high temperatures? A. approximately equal A-T and C-G base pairs and lipid bilayer membranes with saturated fatty acids B. high G-C content of DNA and lipid monolayer membranes with isoprene units C. high A-T content and lipid tetralayer membranes with fatty acid ether linkages D. high A-G base pairing and high levels of cholesterol in the membranes
B. high G-C content of DNA and lipid monolayer membranes with isoprene units
Which of the following statements is NOT true of sporulation? A. The resultant endospores may remain viable for thousands of years. B. It represents an important form of reproduction for some bacterial species. C. The process is long and complex, requiring 8-10 hours. D. This capability is shared by many species of Gram-positive pathogens. E. Under favorable conditions, endospores can germinate and resume vegetative growth.
B. it represents an important form of reproduction for some bacterial species
All of the following can be used to visualize ribosomes except which one(s)? Choose one or more: A. atomic force microscopy B. light microscopy C. transmission electron microscopy D. scanning electron microscopy E. unaided eye F.X-ray crystallography
B. light microscopy E. unaided eye
Antibiotics that weaken the peptidoglycan cell wall make a bacterium more prone to A. phagocytosis by macrophages. B. osmotic lysis. C. shrinkage in hypertonic solutions. D. starvation. E. detaching from surfaces.
B. osmotic lysis
The process by which DNA is amplified in vitro in the laboratory is called A. DNA sequencing. B. polymerase chain reaction (PCR). C. recombinant DNA technology. D. transformation.
B. polymerase chain reaction (PCR)
Which of the following may be present as part of the prokaryotic genome? Choose one or more: A. RNA B. prophage C. plasmid D. chromosome
B. prophage C. plasmid D. chromosome
Which of the following is used as the standard for pasteurization, and why is it used as the standard? A. Using the D value to reduce pathogenic microbes to acceptable levels since that has been shown to prevent illness. B. The ability to kill Coxiella burnetii since it is the most heat-resistant pathogen that doesn't form spores. C. The ability to kill all endospores since the fluid needs to be sterile in order for people to safely consume it. D. The ability to eliminate viruses from liquids since they are most likely to evade lethal conditions and cause disease.
B. the ability to kill Coxiella burnetii since it is the most heat-resistant pathogen that doesn't form spores
All of the following describe the unique characteristics of eukaryotic chromosomes, EXCEPT which statement? A. They contain large amounts of noncoding DNA. B. They contain regulatory DNA sequences. C. They associate with histones. D. They are localized in the nucleus. E. They are never circular.
B. they contain regulatory DNA sequences
If halophiles require high environmental concentrations of salt (NaCl), then why do they have such high intracellular concentrations of potassium? A. High potassium is needed to counterbalance the high sodium levels in the cell to provide the right ionic balance. B. They keep sodium levels low by replacing it with potassium since sodium can be used for symport with other solutes. C. There isn't a high potassium level in halophiles; they have a high level of sodium due to the high concentration of salt. D. High potassium levels prevent the membranes from becoming too fluid in the high-salt conditions.
B. they keep sodium levels low by replacing it with potassium since sodium can be used for symport with other solutes
which group do the following features related to chromosomes and gene expression belong? -DNA is genetic material -Ribosomes translate mRNA into protein
Both Eukaryotes and prokaryotes
Which of the following best describes semiconservative replication? A. Phosphodiester bonds link the 3′ carbon of one ribose to the 5′ carbon of the next ribose. B. One DNA strand runs from the 5'-to-3' direction and the other DNA strand runs from the 3'-to-5' direction. C. An original parent DNA strand and one newly synthesized DNA strand compose a new DNA molecule. D. A purine always pairs, via hydrogen bonds, with a pyrimidine.
C. An original parent DNA strand and one newly synthesized DNA strand compose a new DNA molecule
Which enzyme helps pack DNA into the cell by negatively supercoiling DNA? A. DNA helicase B. DNA ligase C. DNA gyrase D. Topoisomerase I E. DNA polymerase III (Pol III)
C. DNA gyrase
What is the effect on species diversity of dumping untreated sewage into a waterway? A. Overall negative since the sewage will cause oligotrophication, leading to extreme competition due to the different food source. B. Overall negative since the raw sewage will kill most living organisms due to diseases present. C. Overall negative due to eutrophication, resulting in unrestricted growth of one species able to grow to extreme numbers and outcompete other species. D. Overall positive since the extra nutrients will lead to oligotrophication, which allows extra species to be present due to this change. E. Overall positive since the new nutrients will provide additional resources for an increased variety of organisms to utilize.
C. Overall negative due to eutrophication, resulting in unrestricted growth of one species able to grow to extreme numbers and outcompete other species
You have isolated a microorganism from seawater that contains thylakoid membranes, gas vacuoles, and carboxysomes. It is most likely A. an ameba. B. algae. C. a cyanobacterium. D. Caulobacter. E. E. coli.
C. a cyanobacterium
which of the following is true about all microbes? A. all microbes are single cells B. all microbes contain a nucleus C. all microbes contain a genome D. all microbes cause disease
C. all microbes contain a genome
Hydrogen peroxide used as a 6% solution is used to clean wounds on skin as a(n) __________, and it is also used as a stronger solution (>30%) as a(n) __________. A. bacteriostatic agent; bactericidal agent B. virucide; sporicide C. antiseptic; disinfectant D. fungicide; sterilizer E. sanitizer; sterilizer
C. antiseptic; disinfectant
Louis Pasteur used a swan-necked flask to demonstrate that A. microorganisms cause disease B. microorganisms can arise from nonliving matter C. dust in the air is a source of living microbes D. microbial fermentation can be used to make beer and wine E. microorganisms can arise from cellular fission
C. dust in the air is a source of living microbes
Which of the following best explains why electron microscopes provide a much more detailed image of specimens than light microscopes? A. More electrons can be used to bombard the specimen than photons of light. B. Electron microscopes use dozens of lenses while light microscopes use only two. C. Electrons have much shorter wavelengths than visible light waves. D. Electron grids are used to capture the image rather than the photoreceptors of a human eye. E. Charged particles will not lose their energy as opposed to light waves.
C. electrons have much shorter wavelengths than visible light waves
Which of the following are two important reasons why microscope lenses are glass parabolas? A. glass for strength while still being clear and parabola for reversing the image B. glass for clarity and parabola for increased surface area C. glass for refractive index and parabola for bending light rays to intersect at a focal point D. glass for ease of shaping lens and parabola for fitting properly into the lens holder E. glass for silica content and parabola for ability to reverse the curvature of light
C. glass for refractive index and parabola for bending light rays to intersect at a focal point
How does the cell membrane affect osmolarity? A. It prevents changes in osmolarity by increasing the saturated fatty acids in the phospholipids to allow water to move more freely across the membrane. B. It doesn't have any effect since water and solutes flow through the membrane. C. It is semipermeable, allowing water molecules to move across while tending to keep solutes in (or out). D. It is semipermeable to solutes, while keeping water from moving across to maintain a specific water activity in the cell.
C. it is semipermeable, allowing water molecules to move across while tending to keep solutes in (or out)
Compared to a random walk, a biased random walk has ______________ runs and a _____________ frequency of tumbling. A. longer / increased B. shorter / decreased C. longer / decreased D. shorter / increased
C. longer / decreased
Movement of molecular oxygen (O2) and carbon dioxide (CO2) across the cell membrane A. only occurs when the O and C atoms are part of some other molecule (e.g., a sugar or amino acid). B. requires energy in the form of ATP or the proton motive force. C. occurs by passive diffusion. D. occurs only unidirectionally, such that oxygen is allowed to enter and carbon dioxide (waste) is able to leave. E. occurs passively, but membrane transporters are required to facilitate their movement.
C. occurs by passive diffusion
The resolving power of the earliest electron microscopes was at least ten times higher than that of the light microscopes, mainly because A. the lenses of the electron microscope have greater magnification power than do those of the light microscope. B. electron microscopes use fluorescent dyes to stain specimens. C. the wavelength of electrons is much smaller than the wavelength of light. D. the wavelength of electrons is much greater than the wavelength of light.
C. the wavelength of electrons is much smaller than the wavelength of light
Recent metagenomic analysis of the bacterial genomes involved in arctic and subarctic microbialite formation has led to the conclusion that there is a common microbiome associated with all microbialites, regardless of location. Microbialites are sedimentary structures formed from the interactions and relationships between microbial communities and their environment. The data supporting this conclusion most likely involved which of the following methods? A. growing microbialites in the laboratory B. using gel electrophoresis to separate DNA from each microbe C. using next-generation sequencing to analyze gene expression in the microbial community D. isolating and growing each identified microbe in pure culture
C. using next-generation sequencing to analyze gene expression in the microbial community
A researcher was trying out different chemical compounds as additives to her new formulation for a liquid bandage, something to put on cuts in order to seal them off and help the healing process. She noticed that some of the additives seemed to prevent growth of bacteria on plates, and when she looked at cells subjected to one of the compounds, DK64, after an hour of treatment she saw something like what is seen in the figure below. Based upon these observations, which of the following ideas best describes what is happening with the cells?
D. DK64 is acting by weakening the cell walls, which likely leads to cells bursting open when subjected to hypotonic conditions
Which of the following is a unique characteristic of viruses that distinguishes them from the other major groups of microorganisms? A. Lack of a nucleus B. Too small to be seen without a microscope C. Ability to cause disease D. Lack of cell structure E. Presence of a genome
D. Lack of cell structure
Which of the following components was absent from Leeuwenhoek's microscopes? A. Focus knob B. Lens C. Sample holder D. Light source
D. Light source
Which of the following describes media and conditions that will be selective for nitrogen-fixing organisms? A. Media lack any nitrogen-containing compounds, and there is no N2 present in the atmosphere. B. Media contain ammonium ion, NH4+, as well as a dye that turns cells red when they reduce nitrogen gas (N2) into ammonium ion. C. Media lack amino acids but contain ammonium ion, NH4+. D. Media lack any nitrogen-containing compounds, but N2 is present in the atmosphere.
D. Media lack any nitrogen-containing compounds, but N2 is present in the atmosphere
Which of the following types of molecules would not require specific transporters to cross lipid bilayers? A. Anions (e.g., Cl- and HCO3-) B. Cations (e.g., H+, Na+, and K+) C. Monosaccharides (e.g., glucose) D. Small, uncharged molecules E. Small, charged organic molecules (e.g., amino acids)
D. Small, uncharged molecules
A pure culture refers to: A. a culture of diverse microorganisms obtained from a single diseased patient B. a culture that causes a single disease C. a culture of diverse microorganisms obtained from a single environmental sample D. a culture that contains a single type or strain of microorganism
D. a culture that contains a single type or strain of microorganism
Peptidoglycan is sometimes referred to as "murein" (which means "wall molecule"). A life-size model of a single peptidoglycan layer would most closely resemble A. Swiss cheese. B. a spider web. C. violin strings. D. a fish net. E. a brick wall.
D. a fish net
Koch's postulates are criteria used to establish that A. microorganisms can arise from nonliving matter. B. microbes can be classified based on genomic similarities. C. inoculations can be used to prevent disease. D. a particular microbe causes a particular disease.
D. a particular microbe causes a particular disease
Which best describes a genome? A. the number of chromosomes present in a cell B. the nucleotide sequence of a given gene C. any double-stranded DNA (dsDNA) molecule D. all the genetic information possessed by a cell or virus E. the dry weight of an organism's total nucleic acid
D. all the genetic information possessed by a cell or virus
John Tyndall discovered that intermittent boiling (cycles of heating and cooling) can kill bacterial endospores. This is a result of A. eventual depletion of nutrients in the treated medium. B. accelerated degradation of the endospore cortex. C. cellular autolysins that are activated and degrade the endospore cell wall. D. endospores germinating into vegetative cells during the cooling phase. E. generation of toxic oxygen species that penetrate and kill the endospore.
D. endospores germinating into vegetative cells during the cooling phase
The complementary nucleobase pairs in DNA are held together by which type of bonds? A. phosphodiester B. peptide C. polar covalent D. hydrogen
D. hydrogen
A complex medium is one that A. contains specified amounts of five to ten known chemical components. B. is designed to specifically inhibit the growth of either Gram-negative or Gram-positive cells. C. is difficult and time consuming to make. D. is nutrient-rich, but the amounts and identity of specific nutrients are unknown. E. distinguishes among microorganisms based on some enzymatic or metabolic ability.
D. is nutrient-rich, but the amounts and identity of specific nutrients are unknown
Consider a typical growth curve of a bacterial batch culture grown in the laboratory. Which of the following phases would be shortened, or absent entirely, if the culture was started using an inoculum from a log-phase culture (in the same medium)? A. death phase B. stationary phase C. log phase D. lag phase
D. lag phase
The major factor limiting bacterial growth in nature is A. space. B. antibacterial agents. C. oxygen. D. nutrients. E. temperature extremes.
D. nutrients
Which of the following is a common compatible solute used by microbes to prevent water loss in a hypertonic medium? A. hydroxide ion B. sodium ion C. fluoride ion D. potassium ion E. chloride ion
D. potassium ion
Resolution refers to which of the following? A. wavelength of electromagnetic radiation used in focusing objects B. increase in the apparent size of the object C. ability to determine the presence of an object D. smallest distance by which two objects can be separated and still be distinguished as separate
D. smallest distance by which two objects can be separated and still be distinguished as separate
Which of the following best explains why the death of microbes follows a negative exponential curve? A. It is negative because the loss of cells is an undesirable event. B. Only approximately 10% of the cells are fit for an environment that has been changed by the added lethal conditions. C. The cells essentially die at the same rate as they are born, which is also an exponential function. D. The cells accumulate random lethal hits to essential proteins or genes at a specific rate.
D. the cells accumulate random lethal hits to essential proteins or genes at a specific rate
Sterilization indicates A. a form of radiation used to prevent microbial growth. B. preventing microbes from reproducing, thus causing them to be sterile. C. the elimination of pathogenic microbes. D. the elimination of all microbes. E. using chemicals to disinfect tissues.
D. the elimination of all microbes
Which of the following is the best explanation of what is happening when looking at a magnified object? A. The refraction of light alters the wavelength to allow the eye to detect the image with better resolution. B. The parabolic lens prevents the scattering of light so that the object appears larger than it normally would. C. The inversion of the image makes the smaller object appear larger. D. The expansion of light waves through a lens increases the distance between points of the image.
D. the expansion of light waves through a lens increases the distance between points of the image
Which of the following is the best example of an extremophile? A. the facultative anaerobe Bacillus cereus B. the Gram-negative plague-causing bacteria Yersinia pestis C. the barotolerant bacterial strain DSK1 D. the hyperthermophile bacteria Methanopyrus kandleri
D. the hyperthermophile bacteria Methanopyrus kandleri
What would be the effect of water evaporating from a puddle without anything else acting on it? A. The water activity would increase due to a decrease in the concentration of dissolved substances. B. The water activity would increase due to an increase in the concentration of dissolved substances. C. The water activity would decrease due to a decrease in the concentration of dissolved substances. D. The water activity would decrease due to an increase in the concentration of dissolved substances.
D. the water activity would decrease due to an increase in the concentration of dissolved substances
Which mechanism of gene transfer among microbes was elucidated by the team of Avery, MacLeod, and McCarty? A. binary fission B. conjugation C. transduction D. transformation
D. transformation
Active transport is required for bacterial cells to A. move large polar solutes along their concentration gradient. B. exchange oxygen and carbon dioxide with the environment. C. bring any charged molecule into the cell. D. transport solutes against their concentration gradient. E. move to environments with a higher nutrient concentration.
D. transport solutes against their concentration gradient
Which of the following early events in biofilm formation by Pseudomonas aeruginosa involves the extension and retraction of a specific pilus? A. quorum sensing B. extracellular matrix production C. genetic exchange between cells D. twitching motility E. tethering adjacent cells together
D. twitching motility
An actively dividing bacterial cell (such as E. coli) typically contains two molecules of __________ and only one molecule of ______________, each of which constitutes approximately 1% of total cell weight.
DNA, peptidoglycan
Compared to eukaryotic microorganisms, bacteria are able to evolve very quickly, which allows these microorganisms to adapt to new environments, use a variety or resources, and develop antibiotic resistance. Which of the following sets of characteristics allow bacteria to evolve so rapidly? A. Small population, rapid growth rate, anaerobic B. Large population, rapid growth rate, sexual reproduction C. Rapid growth rate, anaerobic, sexual reproduction D. Large population, slow growth rate, anaerobic E. Large population, rapid growth rate, transformation
E. Large population, rapid growth rate, transformation
Which of the following organisms are not considered microbes? A. Bacteria B. Protozoa C. Fungi D. Viruses E. Mosquitoes
E. Mosquitoes
You have isolated a mutant strain of Bacillus subtilis (which you designate wimP) whose endospores can be killed by boiling water. When you analyze the endospores produced by this strain, you find that compared to endospores produced by the parent (a wild-type strain), the wimP spores have significantly A. reduced amounts of germination factors. B. lower amounts of spore coat proteins. C. elevated amounts of germination factors. D. reduced amounts of small acid-soluble proteins. E. higher water content.
E. higher water content
Molecular oxygen can form superoxide radicals and other harmful oxygen-containing molecules that damage nucleic acids, proteins, and lipids. Therefore, which of the following choices would best explain the benefit to microbes that grow in the presence of oxygen? A. It can be used to oxidize fatty acids in order to provide more unsaturated fats in phospholipids to help with extra membrane transport. B. There is no benefit. Microbes exposed to oxygen just need to find ways to make it less harmful, although it does allow them to grow where other (anaerobic) microbes cannot survive. C. It can be incorporated into carbohydrates like glucose to provide more energy by burning it, like with a piece of wood. D. It can be used to make hydrogen peroxide, which is used by some microbes to kill other microbes. E. It serves as the final electron acceptor in aerobic respiration, providing more energy in the cell.
E. it serves as the final electron acceptor in aerobic respiration, providing more energy in the cell
Bacterial plasma (cell) membranes contain which two molecules in the greatest abundance? Choose one or more: A. polysaccharides B. nucleic acids C. ribosomes D. lipopolysaccharides E. phospholipids F. proteins
E. phospholipids F. proteins
Upon reorienting after a tumble, an E. coli cell A. becomes nonmotile for several seconds while it decides which in direction to go. B. points itself in the direction of an attractant. C. points itself in a direction away from a repellent. D. needs to wait for the flagellar motors to "cool down" before it resumes a run. E. points itself in a random direction.
E. points itself in a random direction
Which of the following would not be included in the formulation of a defined medium? A. potassium phosphate B. glucose C. sodium chloride D. magnesium sulfate E. tryptone
E. tryptone
what are the following characteristics associated with? -dipicolinic acid -small acid soluble proteins (SASPs) -double membrane -resistant to heat, UV light, dessiccation, etc
Endospore
Identify the three domains of life according to the classification developed by Carl Woese
Eukarya, Bacteria, and Archaea
What are plants, animals, protists, algae, and fungi classified as?
Eukaryotes
which group do the following features related to chromosomes and gene expression belong? -Nucleus with nuclear membrane -Diploid -DNA replication and gene expression are separated
Eukaryotes
Prokaryotic, eukaryotic, or both? -telomeres
Eukaryotic only
What are archaea and bacteria classified as?
Prokaryotes
which group do the following features related to chromosomes and gene expression belong? -Haploid -Nucleoid -DNA replication and gene expression can occur simultaneously
Prokaryotes
Prokaryotic, eukaryotic, or both? -topoisomerase IV
Prokaryotic only
After the first ultracentrifuge for cell fractionation the pellet contains ____________ and the supernatant contains __________.
Spheroplasts and outer membrane, Periplasm
what are the following characteristics associated with? -uses central septation site -transcriptionally active -binary division -metabolically active
Vegetative Cell
Water molecules are sufficiently small that they do not require specific transporters to cross biological membranes. But because they are polar, diffusion of these molecules across the phospholipid bilayer is slow. Peter Agre won the 2003 Nobel Prize in Chemistry for his discovery that the rapid movement of water into and out of cells occurs via _______________.
aquaporins
The use of microbial metabolism to remove or neutralize human waste and industrial pollutants is known as __________
bioremediation
Prokaryotic, eukaryotic, or both? -DNA primase -DNA polymerase -ligase -helicase
both
what are the following characteristics associated with? -chromosome -proteins -ribosomes -peptidoglycan
both vegetative cells and endospores
A strategy used by all microbes to help prevent denaturation of proteins during heat shock is __________________.
chaperone proteins
The phenol ___________ is used to compare the maximum effective dilution of a test substance to the maximum effective dilution of phenol to determine the test substance's relative effectiveness in killing microbes.
coefficient
During the process of cell fractionation, isolation of inner and outer membrane components may be accomplished via ultracentrifugation in a sucrose gradient. This technique partitions particles on the basis of _____________.
density
Koch
devised techniques of pure culture to study a single species of microbe in isolation
what kind of counts does the following items represent? -viability stains -Petroff-Hausser chamber -Fluorescence-activated cell sorter (FACS)
direct counts
Fleming
discovered that the Penicillium mold generates a substance that kills bacteria
Pasteur
discovered the microbial basis of fermentation and showed that providing oxygen does not enable spontaneous generation
Ivanovsk
discovered viruses as filterable infective particles
Jenner
established the practice of vaccination (inoculation with cowpox to prevent smallpox)
The following characteristics belong to which type of chromosome? -histones -telomeres -nucleus -all linear chromosomes
eukaryotic
Dark-field microscopy is especially useful for visualizing ___________, structures found in some bacteria that are typically not easily detected using light microscopy.
flagella
The majority of bacterial cell membrane lipids have the following basic structure: a ____________ molecule linked to two _________acids via ______________ bond, and _____________ head group.
glycerol, fatty, an ester, a phosphoryl
Unlike prokaryotes, eukaryotic cells pack their DNA in the nucleus with the help of a series of distinct proteins called ___________ which compact the DNA.
histones
what kind of counts does the following items represent? -protein levels -dry weight -optical density -pour plates -spread plating
indirect counts
Pseudomonas aeruginosa represents a well-studied model organism for single-species biofilm formation. This research is also of direct medical significance because of the propensity of these bacteria to form biofilms in the ____________ of patients with cystic fibrosis.
lungs
Microorganisms in nature are generally found in complex consortia containing numerous species, known as a microbiome. ____________ is the use of modern genomic techniques to study microbial communities directly in their natural environment, bypassing the need for isolating and cultivating individual species in the laboratory.
metagenomics
a __________ is one-millionth of a millimeter
nanometer
A(n) _____________ stain is often used to detect bacterial capsules.
negative
Many biofilm-specific phenotypes are controlled by "quorum sensing." This system allows bacteria to regulate gene expression according to the concentration of _________________ in its immediate environment.
other bacteria
The arrangement of mycolic acids in the cell envelopes of mycobacteria allows them to function as a type of ______________.
outer membrane
Certain aquatic bacteria use magnetosomes to direct them to environments with optimal levels of ____________.
oxygen
The following characteristics belong to which type of chromosome? -Termination zones (ter sites) -operons -nucleoids -circular or linear chromosomes
prokaryotic
Before the scientific advances of the mid-20th century, most scientists believed that a cell's genetic information was encoded by ____________ .
protein
-adenine -guanine
purine
-thymine -cytosine -uracil
pyrimidine
Archaea are prokaryotic cells, yet based on the comparative analysis of ______________sequences, archaea are more closely related to eukaryotes than to bacteria.
ribosomal RNA (rRNA)
The "Great Plate Count Anomaly" refers to the discrepancy between the number of microbes that are present in a particular sample and the number that can be grown in the laboratory. In fact, it is estimated that upwards of 99% of prokaryotic species lack a cultured representative. Still, we can both detect these microbes and gain insight into their phylogenetic relatedness, based on the sequences of their ________________ genes that are acquired from samples using ____________.
ribosomal RNA, PCR
Semmel
showed that antiseptic could prevent transmission of pathogens from doctor to patient
Spallanz
showed that microbes arise from preexisting microbes and that heat sterilization can prevent microbial growth
Tyndall
showed that repeated cycles of heat were necessary to eliminate spores formed by certain kinds of bacteria
Nighting
statistically quantified the impact of infectious disease on human populations
Oxygen exposure will kill __________.
strict anaerobes
Confocal microscopy is a form of _____________ imaging.
super-resolution
Bacteria and archaea fix nitrogen (N2) by reducing it to ammonia (NH3), the form of nitrogen assimilated by plants. The main reservoir of nitrogen is ___________.
the atmosphere
Hooke
the first to record observations of microbes through simple microscopes
Which type of topoisomerase is: -ATP-independent -cleaves one strand of the DNA double helix -unwinds supercoils
type 1
Which type of topoisomerase is: -ATP-dependent -introduces supercoils -cleaves two strands of the DNA double helix
type 2
which bacteria has a spiral shape?
-Brachyspira pilosicoli -Spirilum minus -Leptospira interrogans
which bacteria has a rod shape?
-Lactobacillus acidophilus -Escherichia coli -Bacillus megaterium
which bacteria has a spherical shape?
-Staphylococcus aureus -streptococcus pyogenes
What are the 9 steps of the dilution streaking technique?
1. sterilize the loop (and allow it to cool) before using it to obtain the bacterial inoculum 2. remove a sample of bacteria from the culture flask (or plate) using the sterile loop 3. inoculate a section of your agar petri dish by sweeping the loop back and forth across the surface 4. flame the loop a second time and allow it to cool 5. using the loop, streak cells from the first area onto a fresh section of the agar 6. flame the loop a third time and allow it to cool 7. using the loop, draw cells from the second area onto another fresh section of agar 8. sterilize the loop a final time 9. place the petri plate in the appropriate incubator
What are Koch's postulates in order?
1. the microbe is found in all cases of the disease but is absent from health individuals 2. the microbe is isolated form the disease and grown in pure culture 3. when the microbe is introduced into a healthy, susceptible host, the same disease occurs 4. the same strain of microbe is isolated from the newly diseased host
Where would extremophiles most likely make up the greatest percentage of microorganisms? A. As part of the human microbiota B. In hydrothermal vents C. In soil D. In the air
B. in hydrothermal vents
The cell envelopes of mycobacteria contain large amounts of these molecules, which make them "acid-fast." A. peptidoglycans B. teichoic acids C. mycolic acids D. fibronectin-binding proteins E. arabinogalactans
C. mycolic acids
Which of the following describes a shared function of DNA polymerase I (Pol I) and RNase H during bacterial DNA replication? A. proofread new DNA B. join Okazaki fragments C. synthesize RNA primers D. unzip the DNA helix E. remove RNA primers
E. remove RNA primers
A short primer composed of ______ is needed at the origin of replication in order to initiate DNA replication.
RNA
