exam 3 genetics

Based on what we learned about the most important splicing consensus sequences, what will the sequence of this simplified intron-containing mRNA (written from 5' to 3', left to right) be after splicing occurs? (Don't write anything besides nucleotide letters.) CAAGGUCCCUCCCACCUAGCAA

CAAGCAA, caagcaa, Caagcaa, CaagCaa

The following is part of an mRNA sequence, written from 5' to 3' (left to right): CGAAUACUA Write out the corresponding sequence of the non-template DNA (write it from 5' to 3', left to right). (Don't include anything besides the nucleotide letters, for example don't write 5', 3', etc.)

CGAATACTA, cgaatacta, Cgaatacta

A boundary element is also known as a(n): A) insulator. B) repressor. C) enhancer. D) coactivator. E) mediator.

a

A polypeptide has the following amino acid sequence: Met-Ala-Gln-Arg-Glu-Leu. This polypeptide was mutated to produce the following mutant sequence: Met-Ala-Gln-Gly-Glu-Leu. Which describes the MOST likely type of mutation that occurred? A) nonsense mutation B) missense mutation C) frameshift mutation D) neutral mutation

b

Huntington's disease can strike at an earlier age and bring about a more rapid degeneration and death in successive generations within a family. This phenomenon can be explained by which mechanism? a) presence of a transposable element in the gene b) expansion of a trinucleotide repeat in the coding sequence of the gene c) chronic exposure to mutagens in the environment d) presence of an extra chromosome in the germ line e) absence of a gene product that is involved in DNA repair

b

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation? A) The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly. B) The 5ʹ cap could recruit proteins that would help to assemble the ribosomes. C) The 5ʹ cap could assist in the identification of stop codons within the mRNA. D) The 5ʹ cap could serve as a marker for the ribosome to locate promoters. E) The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to the DNA.

b

Which of the following RNA molecules serves as an adaptor molecule during protein synthesis A) rRNA B) tRNA C) mRNA D) circRNA E) All of the above

b

Which of the following statements about gene regulation concerning operons is INCORRECT? A) A negative repressible gene is controlled by a regulatory protein that inhibits transcription. B) For a gene under negative repressible control, a small molecule is required to prevent the gene's repressor from binding to DNA. C) For a gene under positive repressible control, the normal state is transcription of a gene, stimulated by a transcriptional activator. D) A regulator gene has its own promoter and is transcribed into an independent mRNA. E) Presence of operons where genes of related functions are clustered is common in bacteria but not in eukaryotes.

b

RNA molecules that are complementary to particular sequences on mRNA are called: A) complementary RNA. B) sense RNA. C) antisense RNA. D) riboswitches. E) ribozymes.

c

How many introns are present in an intron-containing gene that consists of five exons? a) Six b) Two c) Five d) Three e) Four f) Zero

e

If the bottom strand of the DNA is the template, the tRNA anticodon sequence for the first of the three displayed RNA codons, 5' to 3', is: A) GGA. B) AUG. C) CAC. D) UCC. E) CCU.

e

A fly (Drosophila) with an XY genotype has a mutation in its sex-lethal (Sxl) gene that renders its protein product nonfunctional. Which of the following describes the sex of this fly? A) male B) female C) intersex D) male, but it will be sterile E) female, but it will be sterile

a

A linear DNA fragment is cut with a restriction enzyme to yield two fragments. How many restriction sites are there for the enzyme in this fragment? A) one B) two C) three D) four E) It cannot be determined with this information.

a

Consider the regulation of galactose metabolism through GAL4. Which of the following would result from a mutation that allowed GAL3 to bind to GAL80 in the absence of galactose? A) Transcription of the genes involved in galactose metabolism would occur both in the presence and in the absence of galactose. B) GAL80 would be able to bind to GAL4, and transcription of the genes involved in galactose metabolism would be repressed. C) GAL4 would no longer be able to bind to the DNA; thus, transcription of the genes involved in galactose metabolism would occur. D) GAL80 would no longer be able to stimulate transcription of the genes involved in galactose metabolism. E) There would be no change in the regulation of galactose metabolism because GAL3 normally binds to GAL80 to cause a conformation change in GAL80.

a

E. colilac operon control bylacI is: A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) attenuation.

a

How does histone acetylation affect chromatin? A) It loosens the chromatin and allows increased transcription. B) It allows DNA to become resistant to damage. C) It helps the histones have a greater affinity for DNA. D) It inhibits DNA replication by making it more difficult to separate the DNA strands. E) It causes the chromatin to become more condensed in preparation for metaphase.

a

The following is a short sequence near the beginning of exon 1 of an mRNA. 5' AUG GCU AAC 3' What will be the sequence of the anticodon (from 5' to 3', left to right) that will pair with the second codon in the mRNA? a) AGC b) CAU c) GCT d) GCU

a

Through genetic engineering, a geneticist mutates the TATA box for the insulin gene in cultured human cells. This mutation prevents TBP from binding to the TATA box. What is the most likely effect of this mutation on the cells that possess it? a) The insulin gene will not be transcribed b) All genes containing a TATA box will be transcribed but not translated c) The insulin gene will be transcribed but not translated d) All genes containing a TATA box will not be transcribed e) There will likely be no effect.

a

When regions around genes become sensitive to the enzyme DNase I, this is an indication that those regions are: A) becoming transcriptionally active. B) becoming more condensed. C) binding to the single-strand binding proteins. D) destabilizing and transcriptionally inactive. E) becoming highly methylated by a methylase.

a

Which of the following DNA sequences are contained within a cDNA library? A) exons B) introns C) promoters D) enhancers

a

Which of the following RNA molecules serves as an adapter molecule during protein synthesis? a) tRNA b) All of the above c) mRNA d) rRNA

a

Which of the following is INCORRECT about SARS-CoV-2 RNA? a) The - strand serves as the template for translation Viral RNA is transcribed from an RNA template b) The + strand is the strand that gets packaged into the virus c) Both the + strand and the - strand are synthesized by the same enzyme d) The - strand serves as a template for the + strand, and the + strand serves as a template for the - strand

a

Which of the following statements CORRECTLY describes the facts about introns and exons? A) The number of introns is always less than the number of exons in a gene. B) Introns are degraded in the cytoplasm. C) All eukaryotic genes contain an intron. D) Mitochondrial and chloroplast genes do not contain introns. E) Introns do not contain sequence-specific information.

a

Which of the following statements about histones and gene expression is CORRECT? A) In a general sense, highly condensed DNA bound with histone proteins represses gene expression. B) Acetylation involves the addition of acetyl groups to histone proteins, and it usually results in repression of transcription. C) Addition of methyl groups to the tails of histone proteins always results in activation of transcription. D) Histone code refers to the modification that takes place on the globular domain of the octamer histone core. E) Phosphorylation of cytosines generally leads to increase in transcription.

a

Which of the following statements about response elements is INCORRECT? A) A single eukaryotic gene is regulated by only one unique response element. B) Response elements are composed of specific consensus sequences that are unique from one another. C) Different genes can possess a common regulatory element upstream of their start site. D) Multiple response elements allow the same gene to be activated by different stimuli. E) Response elements allow complex biochemical responses in eukaryotic cells.

a

Which of the following statements is TRUE regarding transcription in most organisms? a) The DNA template strand is used as a template for mRNA synthesis. b) All genes are transcribed from the same strand of DNA. c) The strand encoding an mRNA is chosen randomly by RNA Polymerase II. d) Different genes may be translated from different strands of DNA. e) The DNA nontemplate strand is used to encode double-stranded RNA.

a

How do germ-line mutations differ from somatic mutations? a) Germ-line mutations involve small changes to DNA such as base-pair substitutions, while somatic mutations usually involve large deletions. b) Germ-line mutations can be passed on to offspring, while somatic mutations cannot. c) Germ-line mutations occur during DNA replication, while somatic mutations do not. d) Germ-line mutations result in cancers, while somatic mutations do not. e) Germ-line mutations are reversible, while somatic mutations are not.

b

Researchers in a lab have created a system in a test tube that efficiently transcribes a bacterial gene but terminates inefficiently. What is one possible problem? A) There is a mutation in the -10 consensus sequence, which is required for efficient termination. B) Rho factor has not been added. C) Sigma factor has not been added. D) A hairpin secondary structure has formed at the 3 end of the mRNA, interfering with termination. E) Histones were added prematurely and interfered with termination.

b

The 5' UTR (UnTranslated Region) of a eukaryotic mRNA, which precedes the start codon, is encoded by sequences in the gene's _________ A) Shine-Dalgarno consensus sequence B) Exon C) Intron D) Promoter

b

The agouti locus helps determine coat color in mice, and this phenotype can vary from light to dark between genetically identical individuals. You have discovered a drug that reduces the variation in the agouti phenotype. What is a likely explanation for this drug's mechanism of action? A) It inhibits DNA polymerases. B) It inhibits DNA methyl transferases. C) It activates shelterin proteins. D) It activates mitochondrial transcription. E) It causes DNA damage.

b

What would be the consequences of a two nucleotide-deletion mutation in the middle of the first exon of a protein-coding gene? A) The result would be no change in the protein, since deletions are very rare. B) A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal. C) Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made. D) Since exons are not coding regions, no changes in the protein would occur. E) No change in the reading frame would occur due to the degeneracy of the genetic code.

b

Which of the following is an example of an epigenetic change in eukaryotes? A) a loss of an AT base pair from a gene B) the addition of methyl groups to cytosines in the promoter region of a gene C) the substitution of an AT base pair by a GC base pair in a gene as a result of a mistake during DNA replication D) a deletion that simultaneously removes two genes from the genome E) None of these examples represents epigenetic changes.

b

Which of the following statements about regulation of eukaryotic gene expression is INCORRECT? A) The presence of a nuclear membrane separating transcription and translation in eukaryotes led to the evolution of additional mechanisms of gene regulation. B) In eukaryotes, most structural genes are found within operons. C) Eukaryotic mRNAs are generally more stable than prokaryotic mRNAs. D) The rate of degradation of mRNAs is important in regulation in eukaryotes. E) Posttranslational regulation of histones is unique to eukaryotes.

b

Which of the following elements would NOT be found in an mRNA molecule? (You may choose more than one.) a) protein-coding region b) origin of replication c) TATA box d) 3' untranslated region e) exons

b, c

Which of the following statements about how transposons violate basic laws of genetics is CORRECT. (You may choose more than one.) a) Transposons are post-transcriptionally stimulated by piRNAs b) Some transposons can create additional copies of themselves at new locations in the genome c) Some transposons can synthesize DNA from an RNA template d) All transposons require RNA intermediates

b, c

Many types of RNA are naturally present in both eukaryotes and prokaryotes. Which of the following RNAs are NOT present in both eukaryotes and prokaryotes? (You can choose more than 1.) a) Ribosomal RNA b) CRISPR RNA c) Transfer RNA d) Micro RNA e) Messenger RNA

b, d

A geneticist is studying the insulin gene, which has a TATA box in its promoter. Through genetic engineering, the scientist mutates the TATA Binding Protein (TBP) from human cells in culture. This mutation prevents TBP from binding to DNA. What is the most likely effect of this mutation on the cells that possess it? a) There will likely be no effect. b) The insulin gene will be transcribed and translated c) All genes containing a TATA box will not be transcribed d) The insulin gene will be transcribed but not translated e) All genes containing a TATA box will be transcribed but not translated

c

How do germ-line mutations differ from somatic mutations? A) Germ-line mutations involve small changes to DNA such as base-pair substitutions, while somatic mutations usually involve large deletions. B) Germ-line mutations occur during DNA replication, while somatic mutations do not. C) Germ-line mutations can be passed on to offspring, while somatic mutations cannot. D) Germ-line mutations are reversible, while somatic mutations are not. E) Germ-line mutations result in cancers, while somatic mutations do not.

c

Huntington's disease can strike at an earlier age and bring about a more rapid degeneration and death in successive generations within a family. This phenomenon can be explained by which mechanism? A) presence of a transposable element in the gene B) chronic exposure to mutagens in the environment C) expansion of a trinucleotide repeat in the coding sequence of the gene D) presence of an extra chromosome in the germ line E) absence of a gene product that is involved in DNA repair

c

If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is: A) AUAGGCAGU. B) UCCCAGGUG. C) CACCUGGGA. D) AGGGUCCAC. E) GACAUUAGA.

d

Indicate the order of events in transcription of a eukaryotic gene by RNA polymerase II. 5' cap added to the mRNA Transcription terminates Rat1 binds to 5' end of cleaved RNA RNA polymerase II binds to the promoter

5' cap added to the mRNA ---- 2nd Transcription terminates ---- 4th Rat1 binds to 5' end of cleaved RNA ---- 3rd RNA polymerase II binds to the promoter ---- 1st

Imagine you're an astrobiologist trying to crack the genetic code of a microbe in another galaxy. You isolate a mutant with a one base-pair insertion in Gene X which causes the gene to be frameshifted and therefore nonfunctional. You then isolate a second base-pair insertion in Gene X a few nucleotides downstream of the first mutation. When combined, these two mutations result in a functional version of Gene X. What does this experiment reveal about the genetic code of this alien microbe? a) The genetic code is quadruplet (words of 4 nucleotides) b) The genetic code is triplet (words of 3 nucleotides) c) The genetic code is doublet (words of 2 nucleotides) d) The genetic code degenerated e) The genetic code is universal

c

What is the purpose of Taq polymerase in a PCR reaction? A) DNA denaturation B) primer annealing C) DNA synthesis D) heating of the reaction E) heating of the reaction and DNA denaturation

c

When codons that code for the same amino acid differ in their _____, a single tRNA might bind both of them through wobble base pairing. A) 5' base B) middle base C) 3' base

c

Which of the following Before/After statements best describes the change in scientific knowledge brought about by the Neurospora experiments performed by Beatle & Tatum + Srb & Horowitz? a) Before: we thought genes and proteins were colinear. After: we know that RNA splicing violates the principle of colinearity in eukaryotes! b) Before: we thought protein was the genetic material. After: we know DNA is the genetic material! c) Before: we thought proteins did all the important work in a cell, while genes played minor roles. After: we know that proteins are the products of genes! d) Before: we thought Neurospora were auxotrophic. After: we know that Neurospora are autotrophic!

c

Which of the following consensus sequences are NOT found in nuclear introns? A) GU at the 5 splice site at the beginning of the intron B) AG at the 3 splice site at the end of the intron C) CCA at the 3 site downstream of the branch point D) A at the lariat branch point site

c

Which of the following is observed in prokaryotes but not in eukaryotes? A) UGG is an example of a stop codon only found in prokaryotes. B) An mRNA can be translated by only one ribosome at a time in prokaryotes. C) The 5 ́ end of a prokaryotic mRNA can be translated while the 3 ́ end is still being transcribed. D) Translation does not require any protein factors in prokaryotes. E) In prokaryotes, ribosomes move along an mRNA in the 3 ́ to 5 ́ direction.

c

Which of the following statements is TRUE regarding transcription in most organisms? A) All genes are transcribed from the same strand of DNA. B) The strand encoding an mRNA is chosen randomly by RNA Polymerase II. C) Different genes may be transcribed from different strands of DNA. D) The DNA template strand is used to encode double-stranded RNA. E) The DNA nontemplate strand is used to encode single-stranded RNA.

c

You are interested in studying large-scale chromosome rearrangements, such as transversions and duplications. Which of the following sources will be most likely to provide you with a high level of such rearrangements. a) Siamese cats b) Prokaryotic cells grown in a petri dish c) Cancer cell lines grown in a petri dish d) Zebrafish treated with 5-Bromouracil e) Tissue from humans afflicted with Huntington's Disease

c

You just isolated a mutant in the eukaryotic single-cell organism Saccharomyces cerevisiae ("Brewer's Yeast") that fails to transcribe your favorite gene. Which of the following regions is most likely to contain your mutation? a) Rat1 exonuclease b) 5' splice site c) TATA box d) Sigma subunit binding site

c

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT? A) Colinearity means that the linear nucleotide sequence of a given gene corresponds directly to the linear amino acid sequence in the corresponding polypeptide. B) The number of nucleotides in a gene should be precisely proportional to the number of amino acids present in the corresponding polypeptide. C) Colinearity generally holds true for the coding regions of prokaryotic viral genes. D) The vast majority of eukaryotic genes follow the concept of colinearity. E) An exception to colinearity between genes and polypeptides is the presence of untranslated sequences (UTRs).

d

It is estimated that transposable elements compose approximately what percent of the human genome? A) <1% B) 1% C) 10% D) 50% E) 99%

d

The beginning of a protein has the following amino acid sequence: Met-Ala-Gln-Arg-Ser-His. The gene encoding this protein was mutated to produce the following mutant sequence: Met-Ala-Gln-Leu-Glu-Tyr. Which describes the MOST likely type of mutation that occurred? a) transition b) missense mutation c) temperature sensitive mutation d) frameshift mutation e) transversion

d

Which of the following statements about RNA polymerase is NOT true? A) RNA polymerase adds a ribonucleotide to the 3ʹ end of a growing RNA molecule. B) RNA polymerase binds to a promoter to initiate transcription. C) During transcription of a gene, RNA polymerase reads only one strand of DNA. D) RNA polymerase reads a template strand of DNA 5ʹ to 3ʹ. E) RNA polymerase has many subunits.

d

Which of the following statements about ribosomes and ribosomal RNA is NOT true? a) The human genome has many copies of ribosomal RNA genes b) Multiple different ribosomal RNAs are processed from a single ribosomal RNA transcript. c) Ribosomal RNA is typically the most abundant RNA in a cell d) Ribosomal RNA is typically the most abundant RNA in a cell

d

Which part of a eukaryotic mRNA encodes the 3' UTR? a) Enhancer b) Intron c) Exon d) Promoter

d

siRNAs and miRNAs are produced by the: A) cleavage of RISCs by endonucleases. B) cleavage of functional mRNA within the cytoplasm. C) cleavage of pre-mRNA in the nucleus. D) cutting and processing of double-stranded RNA by Dicer enzymes. E) cutting and processing of double-stranded RNA by Slicer enzymes.

d

You just isolated a mutant in the eukaryotic single-cell organism Saccharomyces cerevisiae ("Brewer's Yeast") that fails to transcribe your favorite gene. Which of the following is highly unlikely to contain your mutation? (You can choose more than one.) a) Promoter b) TATA box c) Transcription start site d) Shine-Dalgarno sequence e) Rut site

d, e

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the: A) rho factor. B) TFIID. C) TBP. D) omega subunit. E) sigma factor.

e

Transcriptional control that acts by regulating the continuation of transcription is called: A) riboswitching. B) antitermination. C) negative control. D) operator mutation. E) attenuation.

e

Which of the following information CANNOT be learned from RNA sequencing? A) the types and number of RNA molecules produced by transcription B) the presence of alternatively processed RNA molecules C) information about differential expression of the two alleles in a diploid individual D) different RNA molecules generated by bidirectional or overlapping transcription of DNA sequences E) the active sites of the enzyme the RNA encodes

e

Which of the following statements about regulation of gene expression is CORRECT? A) An inducible gene is transcribed when a specific substance is absent. B) A gene is any DNA sequence that is transcribed into an mRNA molecule only. C) All genes are transcribed at all times as long as they have a functional promoter. D) The regulation of gene expression is the same in both eukaryotes and prokaryotes. E) The regulation of gene expression is critical for the control of life processes in all organisms.

e

If a SARS-CoV-2 virus had a loss-of-function mutation in its NSP12 gene (a.k.a. RNA-dependent RNA polymerase), what would be the most likely outcome for the virus? a) If a SARS-CoV-2 virus had a loss-of-function mutation in its NSP12 gene (a.k.a. RNA-dependent RNA polymerase), what would be the most likely outcome for the virus? b) The virus will be able to transcribe its RNA but unable to replicate its genome c) The virus will be able to replicate its genome but unable to translate its structural proteins d) The virus will have to rely on the RNA polymerase of its eukaryotic host e) The virus will be able to transcribe its RNA but unable to translate its structural proteins f) The virus will be unable to replicate its genome or transcribe its RNA

f