Exam 3 Questions

Translate the sequence in the five other reading frames

A student analyzes a genomic DNA sequence of 100 nucleotides in order to determine if it is part of a gene. When she translates the sequence beginning at the first nucleotide at the 5' end of one strand, she finds that the tenth codon is TAA (a stop codon). What should she (a sensible genetics student) do next? Tell her professor that the sequence does not represent an exon Tell her professor that the sequence encodes a peptide with nine amino acids Ignore the stop codon and keep translating in the same reading frame Translate the sequence from the opposite end (3' to 5') of the same DNA strand Translate the sequence in the five other reading frames

A gene that blocks DNA replication in response to DNA damage is fused to a regulatory element that activates transcription always, even when DNA is not damaged.

Different types of cancers can be caused by reciprocal translocations. Which of these scenarios would NOT cause a cancer phenotype? A receptor tyrosine kinase gene fused to another gene makes a chimeric tyrosine kinase that does not respond to a growth signal and becomes constitutively active. A gene required for apoptosis of abnormal cells is disrupted in its coding sequence due to the translocation breakpoint within the gene, and cells lose the ability to undergo programmed cell death. A gene encoding a transcription factor that promotes cell division is fused to an enhancer of another gene, and the new enhancer increases the expression of the transcription factor. A gene that blocks DNA replication in response to DNA damage is fused to a regulatory element that activates transcription always, even when DNA is not damaged.

33

Diploid oranges have 18 chromosomes. Diploid bananas have 22 chromosomes. How many chromosomes do triploid bananas have?

triploid bananas

Diploid oranges have 18 chromosomes. Diploid bananas have 22 chromosomes. Which fruit has greatest chance of producing genetically unbalanced gametes? Triploid bananas Triploid oranges Diploid bananas Diploid oranges

63

Donkeys have 62 chromosomes and horses have 64 chromosomes. How many chromosomes do mules have?

paralogous

Genes A and B are

4

How many different SNP alleles exist?

No

In 2008, Margaret Binkele was murdered in her Georgia home. The number of repeats at three CODIS simple sequence repeat (SSR) loci were determined using the crime scene sample and blood from three suspects. The results of genotyping three SSR loci are summarized in the table. Allele frequencies for each locus are given: Locus 1, allele 10: 0.1 Locus 2, allele 11: 0.2 Locus 3, allele 6: 0.2; Locus 3, allele 9: 0.3 According to the data, is there any suspect whose genotype matches that of the crime scene sample?

0.000048

In 2008, Margaret Binkele was murdered in her Georgia home. The number of repeats at three CODIS simple sequence repeat (SSR) loci were determined using the crime scene sample and blood from three suspects. The results of genotyping three SSR loci are summarized in the table. Allele frequencies for each locus are given: Locus 1, allele 10: 0.1 Locus 2, allele 11: 0.2 Locus 3, allele 6: 0.2; Locus 3, allele 9: 0.3 What is the probability of matching the genotype identified from the crime scene sample?

The inversion homozygote would have twice as many FISH signals as the normal plant.

In plants, genes E, F, and G are on the same chromosome arm. Alternate dominant and recessive alleles of these three genes determine visible traits: E = normal leaf number, e = extra leaves; F = normal stems, f = furry stems; G = normal flower size, g = gigantic flowers. (Dominant alleles are in capital letters, and recessive alleles in small letters.) If you design a probe for the E gene and it can hybridize to either end of the breakpoint, how would the number of fluorescent FISH signals compare between a normal plant with two copies of intact E gene and an inversion homozygote whose E gene is split into two parts as shown here? The inversion homozygote would have twice as many FISH signals as the normal plant. They would have equal numbers of FISH signal. The normal plant would have twice as many FISH signals as the inversion homozygote.

extra leaves, normal stems, gigantic flowers

In plants, genes E, F, and G are on the same chromosome arm. Alternate dominant and recessive alleles of these three genes determine visible traits: E = normal leaf number, e = extra leaves; F = normal stems, f = furry stems; G = normal flower size, g = gigantic flowers. (Dominant alleles are in capital letters, and recessive alleles in small letters.) What is the phenotype of a plant that is homozygous for an inversion between two breakpoints shown here if one breakpoint disrupts the E gene by splitting it into two parts causing recessive loss of function? (The plant is homozygous for F and g as well.) normal leaf number, normal stems, gigantic flowers extra leaves, furry stems, gigantic flowers normal leaf number, furry stems, gigantic flowers extra leaves, normal stems, gigantic flowers

Exome sequencing and comparison with known mutations in databases

In the United States, most newborns undergo a screening test for up to 60 genetic disorders. A few drops of blood is taken from each baby and the levels of various blood components are determined. The screening identifies babies who might have a genetic disorder but is not diagnostic. Further testing is required if the screen shows a blood component is out of the normal range. Which of the following technologies could potentially be a low-cost replacement for the current newborn screening and would directly test most babies for the presence of many genetic disorders? DNA fingerprinting using CODIS SSRs PCR amplification and sequencing of the PKU (phenylketonuria) gene Preimplantation embryo diagnosis, which involves genotyping single embryonic cells for particular disease gene loci prior to implantation Exome sequencing and comparison with known mutations in databases SNP microarray to genotype each baby for millions of SNPs RNA seq to compare the sequence reads for genes on chromosome 21 to screen for Down syndrome

Away from the centromere

In which direction is the CFTR gene transcribed - toward the centromere or away from the centromere?

Translocation

Mouse chromosome 1 shown here contains large blocks of sequences found on human chromosomes 1, 2, 5, 6, 8, 13, and 18 (different colors). Arrows indicate the relative orientations of sequence blocks from the same human chromosome, and this demonstrates that the identity and order of the genes in each block are almost exactly the same in the two genomes. What chromosomal rearrangement is most likely responsible for the divergence of mouse and human genomes from the genome of a common ancestor? (Mouse and human genomes are similar in size and the number of genes is comparable.) Duplication Inversion Translocation Deletion

Meiosis II of father

Nondisjunction occurring in which of these could NOT produce an XXY male?

159

Now, zoom out 100x more until the entirety of chromosome 7 is visible. What is the approximate size of chromosome 7 in Mbp (106 bp)? Round to the nearest whole number.

There are 6 ORFs in this sequence, and there are 3 ORFs found on each strand.

Part I: Go to ORF Finder: https://www.ncbi.nlm.nih.gov/orffinder/ (Links to an external site.). In the space below "Enter Query Sequence," copy and paste the following sequence (887 nt) and Submit. TGAAATGAATAAGGCCTTTATTAGCCAGAGAAAAGAAAACAATATTGAAACTAAACATAAGAAAGTGAGGGCTGTAAGTTATCGTAAAAAGGAGCATCTAGGTAGGTCTTTGTAGCCAATGTTACCCGATTGTCCTACAGCTTTGTCCAGTGGCTGTAGCGGTCCCGTTGCTGCGGTGAGCTGGCTGCGTTGATGGGCGGTAAGTGGCCTAGCTGGTGCTCCATTCTTGAGTGTGTGGCTTTCGTACAGTCATCCCTGTACAACCTGTTGTCCAGTTGCACTTCGCTGCAGAGTACCGAAGCGGGATCTGCGGGAAGCAAACTGCAATTCTTCGGCAGCATCTTCGCCTTCCGACGAGGTCGATACTTATAATTCGGGTATTTCTCTCTGTGCATGGCCTGTAATTTCTGTGCCTCCTGGAAGAATGGCCATTTTTCGGCTTCAGTAAGCATTTTCCACTGGTATCCCAGCTGCTTGCTGATCTCTGAGTTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCATGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTTACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAGAGCGGGAATATTCTCTTGCACAGCTGGACTGTAATCATCGCTGTTGAATACGCTTAACATAGCAGAAGCATATGATTGCATTGTCAAAAACAAGGAGAGTGCGACAAAATTGAAAGGTGCCAGAGTTCGAAACTTATTTTACTATCCAAAACTCACTTCTACCAGATTCTTTGTTACGTTAACTTTTGTAATGAAACTTGCATTTCTCCGCCCTCAACA

short arm toward

Part I: Go to UCSC Genome Browser: https://genome.ucsc.edu/cgi-bin/hgGateway?hgsid=931854001_729N9BlGSSF2WcwttDJsr5eG6WGV (Links to an external site.). Under Position/Search term, type HTT (pick Homo sapiens huntingtin on top) and Go. The HTT gene is located on the _____ of chromosome 4, and the direction of transcription is________the centromere (marked by two triangles).

10 map units

Part I: The figure below shows the pedigree of a family in which a completely penetrant, autosomal dominant disease is transmitted through three generations. The disease allele, which is rare, has a single origin. The alleles for a SNP locus are shown (A or C). What is the genetic distance between the two loci? 40 m.u. 50 m.u. 0 m.u. 20 m.u. 10 m.u. 30 m.u.

203

Part II: After you submit the aforementioned sequence (887 nt) in ORF Finder, select the longest ORF in the list and do SmartBLAST. For the protein with the highest Total Score, how many amino acids are identical between the query (your sequence) and the subject (from the database)? (Hint: You need to look at "Additional BLAST Hits" and click the appropriate protein to go to the alignment.)

The likelihood ratio for linkage is (0.9^9 ) x (0.1^1) x (2^10) , which means we don't have sufficient data to support linkage with statistical confidence.

Part II: The figure below shows the pedigree of a family in which a completely penetrant, autosomal dominant disease is transmitted through three generations. The disease allele, which is rare, has a single origin. The alleles for a SNP locus are shown (A or C). Linkage likelihood? Does it support?

133 or 51

Part II: When you go to UCSC Genome Browser and search for the aforementioned gene, what is the "sum" of the number of exons and introns? (Note: If there are multiple transcripts, work with the longest one.)

rehsus lamprey

Part III: When you go to UCSC Genome Browser and search for the aforementioned gene, the vertebrate that has the homologous gene most similar to your human gene is ________ , and the vertebrate that has the homologous gene least similar to your human gene is ________ (Hint: Analyze "Multiz Alignments of 100 Vertebrates.")

Find the direction of transcription Find nearby genes on the same chromosome

Pick two applications of the UCSC Genome Browser. Display all the open reading frames (ORF) in the query sequence Find a best match sequence in database Find the direction of transcription Determine the pattern of inheritance: recessive vs. dominant mutation Compare a nucleotide or amino acid sequence to database Find nearby genes on the same chromosome

human delta paralogous

The following tree shows the evolutionary history of human hemoglobin and myoglobin genes, which are homologous. The gene that would have the greatest degree of nucleotide similarity to the human beta (β) gene is the human delta (δ) gene, and the two genes are paralogous

When many copies of the globin gene formed after several rounds of duplication events, independent mutations allowed some globin genes to assume new specialized but related functions.

The following tree shows the evolutionary history of human hemoglobin and myoglobin genes, which are homologous. The different forms of hemoglobin are adapted to most efficiently carry oxygen in different stages of development: embryonic, fetal, and adult stages. How is this functional diversification made possible? About 500 million years ago, an ancestral globin gene duplicated and over time, the two diverged, through differential gene expression pattern, to give rise to an alpha-lineage and a beta-lineage. Different hemoglobin forms are identical in sequence, and their diverse functions can be solely attributed to post-translational modifications. When many copies of the globin gene formed after several rounds of duplication events, independent mutations allowed some globin genes to assume new specialized but related functions. Different hemoglobin forms are a result of alternative splicing of a common primary transcript.

gain-of-function

The fusion protein produced as a result of this translocation has _______ mutation.

7;14;21 7

The numbers of chromosomes in the somatic cells of several wheat varieties are 14 for einkorn wheat; 28 for durum wheat; and 42 for common wheat. If einkorn wheat is diploid, the gamete chromosome number (n) is _______ and the basic chromosome number (x) is _______ in wheat

The onset of disease would be earliest in the individual B , and there are 4 individual(s) most likely to be affected by Huntington disease, which is an autosomal dominant disease.

The trinucleotide repeat region of the Huntington disease (HD) locus in six individuals is amplified by PCR and analyzed by gel electrophoresis as shown; the numbers to the right indicate the sizes of the PCR products in base pairs. The 5' end of one primer is located 70 nucleotides upstream of the first CAG repeat, and the 5' end of the other primer is located 60 nucleotides downstream of the last CAG repeat. Normal alleles for HD gene contain up to 35 CAG repeats, while disease-causing alleles carry 36 or more. The more the repeats, the earlier the age of disease onset.

2

There could be many alleles of a polymorphic locus in human populations. How many different alleles per locus can any one person have?

Two of the above (does not have introns or promoter)

What information is lacking from cDNA?

9/17

What is the RF between the SNP and the NF gene in this case?

Autosomal dominant

What is the apparent mode of inheritance of this rare disease allele?

10 or 20

What is the number of chromosomes of balanced gametes produced by a triploid oyster (x=10)?

It contains sequences conserved at predicted exon-intron boundaries The DNA sequence is at least 50% similar to its closest match in human, mouse, and zebrafish, and the putative protein sequence is 80% similar The sequence is complementary to a cDNA clone There are many homologous sequences found in the same genome, and they have a similar function

What pieces of evidence support that a DNA sequence is part of a protein-coding gene? (Select all that apply.) It has at least one ORF in each reading frame It contains an ORF, which is 30 bp in length It contains sequences conserved at predicted exon-intron boundaries The DNA sequence is at least 50% similar to its closest match in human, mouse, and zebrafish, and the putative protein sequence is 80% similar The sequence is complementary to a cDNA clone There are many homologous sequences found in the same genome, and they have a similar function The putative protein sequence has no ortholog

Transposase gene is mutated

What type of mutation could this non-autonomous TE (Ds) have if it is able to move in the presence of an autonomous TE (Ac)?

Nonsense mutation in the transposase gene makes non-functional transposase enzyme. Mutation in the promoter of the transposase gene inhibits transcription.

What type of mutation in a defective DNA transposon that cannot move on its own could allow its mobilization in the presence of a wild-type copy of the DNA transposon that can move on its own? In other words, which function, disrupted by mutation, can be provided by a non-defective copy of the transposon elsewhere in the genome? (Select two that apply.) Nonsense mutation in the transposase gene makes non-functional transposase enzyme. Mutation in the promoter of the transposase gene inhibits transcription. Point mutation in the inverted repeats prevents transposase from recognizing them. One of the inverted repeats is deleted.

SSR (unit≤10 bp)

What type of polymorphism is seen with HD alleles?

Long arm of chromosome 7

Which chromosome carries the CFTR gene?

cDNA library of brain neurons

Which library is smallest in size?

5' GGCTAAGATC 3' and 3' CATCGCGGAA 5'

Which of the following sets of primers could you use to amplify the entire target DNA sequence below, which is part of the last protein-coding exon of the CFTR gene? 5' GGCTAAGATCTGAATTTTCCGAG...TTGGGCAATAATGTAGCGCCTT 3'3' CCGATTCTAGACTTAAAAGGCTC...AACCCGTTATTACATCGCGGAA 5' 5' GTAGCGCCTT 3' and 3' CATCGCGGAA 5' 5' GTAGCGCCTT 3' and 3' CCGATTCTAG 5' 5' GGCTAAGATC 3' and 3' CCGATTCTAG 5' 5' GGCTAAGATC 3' and 3' CATCGCGGAA 5'

All answer choices can produce Turner syndrome individuals or mosaics.

Which of these events cannot produce Turner syndrome individuals or mosaics? Nondisjunction of chromosome X during first meiotic division Mitotic nondisjunction of chromosome X All answer choices can produce Turner syndrome individuals or mosaics. Nondisjunction of chromosome X during second meiotic division Mitotic loss of chromosome X

1 and 5

Which of these haploid gametes are genetically balanced? Note that red and blue chromosomes are NOT homologous. Select all that apply.

Individuals with fragile X syndrome have 200 or more CGG repeats in the untranslated region of the FMR-1 gene.

Which of these is an example of simple sequence repeat (SSR)? Individuals with fragile X syndrome have 200 or more CGG repeats in the untranslated region of the FMR-1 gene. A single nucleotide insertion in an exon of a gene results in a truncated protein, which is nonfunctional. The most common cystic fibrosis allele has a deletion of three base pairs in the coding region of the CFTR gene. A single base substitution in the GLI3 gene makes a nonsense mutation that can cause polydactyly.

SNP

Which polymorphism cannot be detected by gel electrophoresis (i.e. size difference)?

SNP in the start codon of a protein-coding gene A rare SNP, linked to the disease locus and consistently present in the affected individuals of a family InDel within the consensus sequence of a promoter

Which polymorphism is most likely to cause a disease that is rare in population? (Select all that apply.) SSR in an intron of a protein-coding gene (It does not affect splicing) SNP in the start codon of a protein-coding gene InDel in a DNA region between genes A rare SNP, linked to the disease locus and consistently present in the affected individuals of a family A common SNP, linked to the disease locus and found in the SNP database InDel within the consensus sequence of a promoter SNP in a telomeric repeat sequence

Intergenic regions (between genes)

Which region is least conserved across four species shown?

Protein-coding exons (CDS)

Which region is most conserved across four species shown?

Segregation 2

Which segregation pattern will produce genetically balanced gametes?

pancreas

Which tissue type has highest mRNA expression of CFTR?

Genes A & B

Which two genes would have highest sequence similarity?

Rhesus monkey

Which vertebrate has the CFTR gene most similar to the human CFTR gene?

It will increase

Will the probability of producing unbalanced gametes from triploid organisms increase or decrease with increasing x?

250

You want to PCR amplify the trinucleotide repeat region of the Huntington disease (HD) locus and analyze the PCR product by gel electrophoresis. The 5' end of one primer is located 70 nucleotides upstream of the first CAG repeat, and the 5' end of the other primer is located 60 nucleotides downstream of the last CAG repeat. Normal alleles for HD gene contain up to 35 CAG repeats, while disease-causing alleles carry 36 or more. What would be the size of the PCR product in base pairs for an allele with 40 CAG repeats?