Genetics Chapters 13,14,16,17, application C, DSM 13

What advice would you give individual III-9?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

Groups of genes that are evolutionarily related are called ________.

gene families

What is the name of the enhanceosome that forms when Gal4 binds to the UASG?

mediator

When a cell divides, chloroplasts are randomly distributed. What is this called?

replicative segregation

Open promoters are ________.

transcriptionally active, with nucleosomes displaced

Drag the colors on the left to the appropriate blanks on the right. Colors can be used once, more than once, or not at all.

1. A spot containing a gene that is overexpressed in cancer cells: red 2. A spot containing a housekeeping gene that is expressed equally in both cell types: yellow 3. A spot containing the p24 gene, which is present and expressed in normal cells, but absent in cancer cells: green 4. A spot containing the p90 gene, which is normally repressed by the p24 gene: red

Use the results of the crosses to classify each of the petite mutants. Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

1. Petite #1 is a segregational petite mutant. 2. Petite #2 is a suppressive petite mutant. 3. Petite #3 is a neutral petite mutant.

Based on genomic analysis, the human genome is thought to include approximately how many protein-coding genes?

20,000

A sequence of DNA was analyzed with a bioinformatics program that translated the sequence in all 6 possible reading frames. Below is the outcome of this analysis. If this sequence contains one gene, which frame is most likely the correct reading frame for this gene? (Remember that Met represents a potential start codon and Stop represents a stop codon.)

5'- 3' direction, Frame 3A E Met R D G G A F S G P L L L E T P G P E P G Q Q E P L V F G S G D T V E L T C P S P I D S P T G P S I W V K D G V G L V P S D R I L V G P R R L Q V L N A S H E D A G T Y S C R Q R L T Q R I L C H F S V Stop

Repetitive DNA sequences account for approximately what proportion of the human genome?

50%

Where is the silencer sequence located?

9

Based on your analysis, what is the most likely molecular abnormality causing the disease allele?

A pre-mRNA spicing mutation causes a deletion of exon 3.

In which section of the search results can you find nucleotide-by-nucleotide comparisons between your query sequence and similar database sequences?

Alignments

Define the "two-hit hypothesis" for retinoblastoma. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.

BOTH COPIES of one gene must be mutated in order for retinoblastoma to develop. This hypothesis was based on the finding that HEREDITARY RETINOBLASTOMA always affected both eyes, whereas SPORADIC RETINOBLASTOMA only affected one eye.

Which of the following characteristics is NOT one of the four general ways in which cancer cells differ from normal cells?

Cancer cells are highly organized.

If a cell is unable to process pri-miRNA to produce miRNA, what gene is likely mutated?

Drosha

The activity of which of the following proteins is directly regulated by the pRB protein product of the RB1 gene?

E2F

Choose the correct definition of epigenetics.

Epigenetic refers to heritable states of chromatin structure.

In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence? Enter the complete DNA sequence, which should contain 24 bases.

GATGACATGGCGTCAGTCGATGCG

In yeast, which protein is bound to the UASG in the galactose utilization pathway?

Gal4

Which of the following regulatory components would be classified as trans-acting?

General transcription factors (GTFs)

One group of Su(var) mutations are caused by a loss of HP-1, a protein found in constitutive heterochromatin. Another group of Su(var) mutations affect genes encoding which enzymes?

Histone methyltransferases (HMTs)

Part complete In the pedigree below, individual I-1 has Leber hereditary optic neuropathy (LHON), an inherited form of vision loss caused by a mutation in mitochondrial DNA. Which members of her family will also inherit LHON?

II-2 II-3 II-4 III-1

Use this pedigree to determine which pairs of family members listed below share mitochondrial DNA.

II-2 and III-6 II-1 and IV-1

In the pedigree below, three mtDNA variants are present in generation I, each variant represented by a different color. The dashed lines indicate a mating to an individual in the same generation on the opposite side of the pedigree. For the individuals in generations II through V, indicate which mtDNA variant they inherited by dragging one of the pink, blue, or orange labels to each target in the pedigree. Then complete the statements below the pedigree by dragging one white label (with the number 1, 2, or 3) to each statement. Labels may be used once, more than once, or not at all.

II. pink, blue, blue, blue, orange, orange, orange III. Blue, blue, blue, orange, orange, orange IV. orange orange orange orange orange orange V. orange, orange, orange 1. 3 2. 2 3. 1 4. 1

The pedigree from Part A is shown below. Three Y chromosomal DNA variants are present in generation I, each variant represented by a different color. The dashed lines indicate a mating to an individual in the same generation on the opposite side of the pedigree. For the males in generations II through V, indicate which Y chromosomal DNA variant they inherited by dragging one of the yellow, purple, or green labels to each target in the pedigree. Then complete the statements below the pedigree by dragging one white label (with the number 1, 2, or 3) to each statement. Labels may be used once, more than once, or not at all.

II. yellow, purple, green, green III. Yellow, yellow, purple IV. yellow, yellow, yellow V. yellow, yellow 1. 3 2. 2 3. 1 4. 1

What advice would you give individual III-6?

It is likely that all children will have the trait and be affected with this disorder, depending on the penetrance of the trait.

Predict the gel shift assay results for each mutated fragment by dragging the labels to the correct locations. Labels may be used once, more than once, or not at all.

Lane 1: 3 Lane 2: 2 Lane 3: 4 Lane 4: 1 Lane 5: 3 Lane 6: 2 Lane 7: 1 Lane 8: 2 1- lowest bar, 4- highest bar

Drag the correct description under each cell structure to identify the role it plays in the plant cell.

Plant cell wall: - strong, protective structure made from cellulose fibrils central vacuole: - regulates cytoplasm composition, creates internal pressure, and storers cell compounds chloroplast: - makes sugar by converting light energy into chemical energy mitochondrion: - produces chemical energy (ATP) that can power the cell Golgi apparatus: - modifies and packages proteins

What is the genotype of a normal cell in the retina in a person who has sporadic retinoblastoma?

RB1+RB1+

What name is given to the alteration of an RNA sequence after transcription?

RNA editing

In studies of human families with polydactyly, which type of mutation has been identified?

Single base substitutions in the SHH enhancer

What might be the cause of such a wide variation in their genome sizes?

Symbiodinium minutum is a free-living organism, whereas Plasmodium falciparum is an obligate parasite. The difference in their genome complexity is likely due to their different lifestyles, since an obligate parasite undergoes genome contraction relative to related, a free-living organism.

Celiac disease (CD) is a common, usually inherited human disorder of intestinal inflammation that is triggered by eating gluten, a major protein in wheat and other cereal grains. It is the most frequent food intolerance. One of the three genes involved encodes SH2B3, a protein involved in innate, nonspecific immune response to bacterial pathogens. Celiac sufferers frequently have a particular allele of this gene, an allele so common in the human population that which of the following might be hypothesized?

The allele must have been positively selected for during a period of especially frequent bacterial infections.

How does the rate of mutation in mammalian mitochondrial genomes compare to the rate of mutation in the nuclear genome?

The mitochondrial mutation rate is about 10 times greater than that of the nuclear genome.

What must happen for a benign tumor to become malignant? Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

The progression from benign to malignant tumors typically requires multiple genetic changes (mutations) that activate PROTO-ENCOGENES and/or inactivate TUMOR SUPPRESSOR GENES. In the case of colon cancer, DCC, APC and TP53 are examples of tumor suppressor genes KRAS is an example of a proto-oncogene.

Would your answer change if it were the mother who exhibited disease symptoms rather than the father?

There is a strong chance that the children will be affected irrespective of their sex.

What advice would you give individual III-1?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

What advice would you give individual III-4?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

In their normal state, what is the primary function of the protein products of the BRCA1 and BRCA2 genes?

They detect and repair DNA damage.

If you create a mutant that expressed Gal3 constitutively, what phenotype would you expect to see?

Transcription in the presence or absence of galactose.

Which complex is recruited to the cis-acting regulatory sequences of Hox genes to acetylate histones?

TrxG

Which of the following components is a cis-acting regulatory element in yeast?

UASG

How does the Xist RNA facilitate the formation of a Barr body?

Xist RNA coats the inactive X chromosome, attracting HMTs to deacetylate and methylate histones H3 and H4.

To understand how cells function as the fundamental unit of life, you must first become familiar with the individual roles of the cellular structures and organelles. Drag the labels on the left onto the diagram of the animal cell to correctly identify the function performed by each cellular structure.

a. synthesizes lipids b. assembles ribosomes c. defines cell shape d. produces secretory proteins e. modifies and sorts proteins f. digests proteins g. generates ATP

Chloroplast mRNAs are not 5'-capped or polyadenylated, making them more like RNAs of ________.

bacteria

Often, in the absence of experimental data, computerized algorithms are used to predict gene structures from large sequences. What is this approach known as?

bioinformatics

How are all codons in mitochondrial transcripts accommodated by only 22 tRNAs?

by allowing more flexibility for base pairing in the third position of codons

The Plasmodium mitochondrial genome does not encode any tRNAs; how are genes of the Plasmodium mitochondrial genome translated?

by using nuclear-encoded tRNAs, which are imported from the cytosol

Yeast are actively growing in the presence of both glucose and galactose. What would you expect to observe at the transcriptional level?

A repressor complex bound to the silencer between the UASG and GAL1.

Which of the genes circled in red is most likely to be an essential gene?

BIM1

A researcher measures the quantity of cDNA that corresponds to the exons of a particular gene in mice using RNA-seq. They find that RNA for this gene isolated from the brain contains 4 exons, while RNA from the liver heart and skin contains 5 exons. What phenomenon likely explains this result?

cells of the brain splice this mRNA differently than other cells in the mouse

Plastids can differentiate into ________ that carry out photosynthesis.

chloroplasts

Which of the following defines the essential gene set of an organism such as a species of yeast?

genes whose deletion alleles are lethal

In Leber's disease (LHON), degeneration of the optic nerve results in blindness due to a defect in NADH dehydrogenase affecting electron transport. If this is due to a mutation in a mitochondrial gene, which combination of the following effects would you expect to see when doing a pedigree analysis of a family with LHON? i. variable expressivity ii. incomplete penetrance iii. progressive blindness over time iv. maternal inheritance v. diminished muscle mass

i, ii, iii, and iv only

Transcomplementation is a name sometimes given for a test to see whether a gene from one organism can "rescue" a loss-of-function mutant of a different organism with a homologous gene. To which of the following processes might this term apply?

introduction of a human WEE1 gene into a yeast culture with wee1- mutant yeast

Human genes often occupy a larger part of the chromosome compared to the homologous gene in yeast, yet the number of amino acids in more homologous human and yeast proteins are not very different. What structure explains this difference?

introns

In a microarray analysis used to compare sporulating and nonsporulating yeast, a spot that appears yellow at a given time point is associated with a gene that is _______.

is expressed roughly equally in both sporulating and nonsporulating yeast

The movement of genes from one species into the genome of another is referred to as _____.

lateral gene transfer

What is the name of the area of the organelle in which organelle DNA is packaged?

nucleoid

The BLAST program from NIH enables a researcher to look for homologous genes. It does so in general by searching for identity in what?

nucleotide sequence

Interspecific (between species) genome studies show us conserved sequences, but intraspecific (within species) comparisons identify what?

polymorphisms

In eukaryotes, where do transcriptional repressor proteins bind?

silencers

The conserved order of consecutive genes along a chromosome segment in different species is called __________.

synteny

Why does deletion D effectively eliminate transcription of lacZ?

the deletion removes the promoter

The set of transcripts present in a cell or organism is called the ________.

transcriptome

Which of the following organisms would have the LOWEST predicted gene density (number of genes per megabase of DNA) in genomic DNA?

Homo sapiens (human)

Mammalian genomes all have a number of genes for globin polypeptides. Several of these genes are functional, but several are never expressed. What are the nonfunctional ones known as?

pseudogenes

Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTRCFTR gene?

- Consider genes that code membrane proteins. - Consider genes that code secretory pathway proteins. - Consider genes that are expressed only in epithelial tissues.

Choose the correct possible biological causes for the difference in expression patterns of the two transgenes. Select the three correct answers.

- Expression of the gene is controlled post-translationally. - Expression of the gene is controlled translationally. - Expression of the gene is controlled post-transcriptionally.

The pedigree below combines the results of Parts A, B, and C. Note that the mtDNA variants are shown only for the females in this pedigree. Based on the inheritance patterns shown in this pedigree, select all of the true statements in the following list.

- Individual I-4 did not contribute her mtDNA to the most recent generation. - Individual I-3 did not contribute his Y chromosomal DNA to the most recent generation.

What differences and similarities might you expect to see in the annotation of the sequences - for example, in number of genes, gene structure, regulatory sequences, repetitive DNA? Check all that apply.

- The Bacillus anthracis sequence will contain more annotated genes than the Gorilla gorilla sequence. - Genes in the Gorilla gorilla sequence will be separated by large intergenic DNA sequences. - Genes in the Bacillus anthracis sequence will not have introns. - The Gorilla gorilla sequence will lack operons.

Sometimes, a mother who is affected with a mitochondrial disease will have an unaffected child. Which of the following could explain this observation?

- The affected mother could be heteroplasmic. - The phenotype could be affected by nuclear genes, which could differ among children. - The mitochondrial disease may have a variable age of onset, and asymptomatic children may develop the condition later in life.

Recent advances in paleogenomics (the recovery and sequencing of DNA from remains up to about 80,000-100,000 years old) have allowed geneticists to test a hypothesis long proposed by paleoanthropologists: that humans (Homo sapiens) interbred with other hominin species, such as Neanderthals (Homo neanderthalensis), that some human groups encountered as they migrated out of Africa. Early work in paleogenomics focused on mtDNA, and more recent work has assembled a complete autosomal genome sequence for Neanderthals. Surprisingly, paleogenomics has also recently identified a previously unknown hominin species in Asia, named Denisovans. DNA recovered from a single finger bone and some teeth enabled researchers to sequence the complete Denisovan genome. A comparison of the variation in mtDNA and autosomal DNA from Neanderthals and Denisovans with the variation in present-day humans from Sub-Saharan Africa, Europe, and Melanesia (a region including islands in the western Pacific Ocean) revealed the following. What does the information in the table above indicate about interbreeding between humans, Neanderthals, and Denisovans? Select all of the true statements in the following list.

- The autosomal DNA evidence supports the hypothesis that the ancestors of present-day Europeans interbred with Neanderthals. - The autosomal DNA evidence supports the hypothesis that the ancestors of present-day Melanesians interbred with Neanderthals. - The autosomal DNA evidence supports the hypothesis that the ancestors of present-day Melanesians interbred with Denisovans.

Some of the following statements are true for chloroplasts; others are true for mitochondria. Which statements are true for chloroplasts? Select the three that apply.

- They are the sites of reactions that convert solar energy into chemical energy. - They contain the green pigment chlorophyll. - They have membranous sacs called thylakoids that are surrounded by a fluid called stroma

A genetic network can be determined by identifying genes that show synthetic lethality.Yeast strains were identified with the mutations listed below. Select the strain(s) that alone would not show a lethal phenotype. Select all that apply.

- a null mutation in a nonessential gene - a conditional mutation in an essential gene

Select the organelles involved in organelle heredity.

- chloroplast - mitochondria

Which of the following crosses would be able to produce haploid spores that could grow on the minimal media plus glycerol plates? Select all that apply.

- segregational petite x wild type - segregational petite x neutral petite - neutral petite x wild type

A synthetic lethal interaction is one in which two yeast stains with non-lethal phenotypes are crossed and the resulting double mutant is lethal.Of these yeast strains, what are all the possible combinations that could be crossed to look for synthetic lethal interactions?Strain A: a null mutation in a nonessential geneStrain B: a null mutation in an essential geneStrain C: a conditional mutation in an essential gene Select all that apply.

- strain A x strain A - strain C x strain C - strain A x strain C

The cytoskeleton of a eukaryotic cell plays a major role in organizing the structures and activities of the cell. The cytoskeleton consists of three main types of fibers: microfilaments, intermediate filaments, and microtubules. The three types of fiber differ in size, composition, and the functions they perform in the cell. Drag the terms on the left to the appropriate blanks in the sentences on the right. Terms can be used once, more than once, or not at all.

1. In eukaryotic flagella, the fibers that slide past one another due to the activity of dynein proteins are microtubules. 2. Many cell organelles, most notably the nucleus, are anchored by intermediate filaments which are assembled from a diverse class of proteins. 3. Centrosomes are sites where protein dimers assemble into microtubules. 4. The extension of pseudopodia in amoeba is due to the regulated assembly and destruction of microfilaments. 5. The only cytoskeletal fibers not associated with intracellular movement or whole cell locomotion are the intermediate filaments. 6. During muscle contractions, myosin motor proteins move across tracks of microfilaments.

Identify the steps involved in the microarray procedure. Drag the terms on the left to the blanks on the right to complete these sentences about the microarray procedure. Not all terms will be used.

1. Isolate mRNA from both the normal cells and the cancer cells. 2. Use the enzyme reverse transcriptase and fluorescently labeled nucleotides to make cDNA from the starting material isolated in Step 1. 3. Denature the fluorescently labeled molecule created in Step 2, and incubate it with the microarray. The fluorescently labeled molecules from the two different cell types will hybridize to single-stranded DNA on the microarray. 4. Wash and then scan the microarray to measure the fluorescence at each spot on the array.

Gene duplication events are very common in eukaryotes. Depending on the molecular basis of the duplication and the mutations that accumulate, the genes may experience a number of fates. Below are several examples of gene duplication events. Choose the term that best describes each example.

1. The beta-globin gene has sequence similarity to the other genes in the beta globin family, but it lacks a start codon. pseudogene 2. Hemoglobin consists of an alpha chain and a beta chain, each produced by a different but similar gene. Neither gene alone can make a functional hemoglobin molecule. subfunctionalization 3. A duplicated gene in mosquitos accumulated mutations that allow it to break down a chemical found in a common pesticide. neofunctionalization 4. In most vertebrates, the pax transcription factor acts during development in the eye and brain. In zebra fish, each tissue has a different but similar transcription factor (paxA and paxB) and both transcription factors are necessary for normal development. subfunctionalization 5. The olfactory receptor gene family in humans contains 16 genes. Six of these genes contain mutations such that the genes do not encode functioning proteins. pseudogene

Next, the scientists wanted to test the effect of a new cancer drug on gene expression in the cancer cells. Previous studies had shown that the drug has no effect on gene expression in normal cells.The scientists added the drug to both the cancer cells and normal cells, and collected cDNAs at specified time points. They performed a microarray experiment using samples from each time point. This microarray shows the results for those genes that showed a change after the addition of the drug.Analyze the results of this experiment by answering these questions. Drag the correct answer to the blank after each question. Labels can be used once, more than once, or not at all.

1. Which group of genes showed increased expression in the cancer cells after the addition of the drug? Group C 2. Which group of genes showed repressed expression in the cancer cells after the addition of the drug? Group D 3. Which group of genes returned to baseline levels of expression in the cancer cells by the end of the experiment? Group A 4. Which group of genes remained highly expressed in the cancer cells throughout the experiment? Group C

Three terms describe the relationships of evolutionarily related genes: homolog, paralog, and ortholog. Indicate which terms correctly describe each example by dragging a check mark to the appropriate columns. More than one term may apply to a single example. If a term does not apply to a particular example, drag an X to that column.

1. the mouse and human alpha globin genes evolved from a common ancestor. (homologs and orthologs) 2. the human alpha and beta globin subunits resulted from a gene duplication event. (homologs and paralogs) 3. a plant transmembrane protein has two transmembrane domains in a single-celled algae and five transmembrane domains in a multicellular plant. These two transmembrane proteins evolved from a common ancestor. (homologs and orthologs)

What percentage of cancer cases are thought to be associated with inherited mutations that predispose individuals to cancer?

5-10%

Which of the following statements is true of a heteroplasmic gene?

A heteroplasmic gene is found in multiple allelic forms in DNA molecules that make up the genomes of organelles in the cells of an organism.

In a simple bioinformatics exercise, students are asked to locate the beginning of an ORF among the six possible reading frames for a hypothetical DNA molecule. The first step in their process should involve looking for what sequence?

ATG

Sigma virus infection in Drosophila melanogaster causes flies to become paralyzed and then die in high concentrations of CO2. The virus is passed on extrachromosomally. Two isogenic strains of Drosophila cultures are maintained: R (resistant to CO2 or wild type) and S (susceptible to CO2, infected with sigma). After crosses between male R and female S flies, subsets of offspring of each sex are tested for CO2 sensitivity. Which of the following results do you expect?

All the offspring are sensitive.

What type of genomic imprinting would you predict to observe on maternal chromosome 11?

An enhancer drives expression of H19, while an insulator bound to the ICR blocks expression of IGF2.

In certain Latin American countries during periods of political volatility, children were removed from their families and their parents were executed (then referred to as being "disappeared"). The methods with the best chance of reuniting those children with members of their extended family have used mtDNA matching. Why and how?

Children's mitochondria will have genomes that are identical to those of their maternal grandmothers

Many eukaryotic genes exhibit transcriptional regulation in either an inducible, developmental, or cell-specific manner. Which of the following gene features would you expect to see in a gene whose transcription is being tightly regulated?

Covered promoter

A new gene was identified that has a synthetic lethal relationship with RAD27 (circled in blue on the genetic network map in Part C). Scientists would like to determine the molecular function of this gene. In which process would you predict this new gene plays a role?

DNA synthesis and repair

Which of the following regulatory components is a large protein complex that directs DNA bending into a loop to encourage transcription?

Enhanceosome

Suppose you have identified a yeast mutant in which transcription of the galactose utilization pathway genes is constitutive (transcription occurs even in the absence of galactose). What gene is likely mutated?

GAL80

Which of the following experimental questions is least suited to testing through microarray analysis?

How does the number of genes in the human genome compare to the number of genes in the chimpanzee genome?

Identify the genotype of each family member using the sizes of mRNAs to indicate each allele. (For example, a person who is homozygous wild type is indicated as "1250/12501250/1250.")

I. 1250/1020, 1250/1020 II. 1020/1020, 1250/1020, 1020/1020, 1250/1250

The pedigree from Parts A and B is shown below. Now it shows the inheritance of a rare recessive autosomal condition that affects individuals II-3, IV-2, IV-5, and V-3 (denoted by the filled symbols and the genotype aa). Individuals I-1, I-2, I-5, and I-6 have no history of this condition in their families. Indicate the most likely genotype of the selected individuals in the pedigree by dragging the correct label to each target. Labels may be used once, more than once, or not at all.

I. Aa, Aa II. Aa, Aa, AA III. Aa, Aa IV. Aa, Aa

In both cases, how would you clone the genes you identified by mutation?

In both cases, how would you clone the genes you identified by mutation?

What advice would you give individual III-2?

It is likely that all children will have the trait and be affected with this disorder, depending on the penetrance of the trait.

The human egg has about 2000 mitochondrial genomes, but somatic cells have a range of hundreds to thousands. Which of the following is most likely to account for the difference?

Large mitochondria in oocytes can divide into many smaller mitochondria, and smaller mitochondria can replicate their DNA.

What are the specialized enhancer elements that regulate transcription of multiple genes packaged in complexes of related genes in eukaryotes?

Locus control regions (LCRs)

Which of the following products are always encoded by the mitochondrial genome?

Mitochondrial rRNAs

Which of the following statements best describes what you would expect to see in a Su(var) mutation?

Most cells show active w+ transcription, so the eyes are red.

What is the acetylase protein found upstream of the promoter at the UASp1 element in the PHO5 gene of yeast?

NuA4

Complete a graph depicting the relative amounts of nuclear and mitochondrial DNA present in the different stages of the cell cycle (G1, S, G2, M). Labels can be used once, more than once, or not at all.

Pink: top: nuclear DNA Bottom: Mitochondrial DNA Blue: G1, S, G2, M, G1

What is the function of a "pioneer factor"?

Pioneer factors are the first to bind regulatory regions of the DNA.

What protein binds to heterochromatic DNA to initiate the transition to euchromatin?

Pioneer transcription factors

Plant cells and animal cells share many of the same structures, but each type of cell also has unique structures. In this activity, you will indicate which cell structures are found only in plant cells, only in animal cells, or in both plant and animal cells. Drag each cell structure to the appropriate bin. If a structure is found in both plant cells and animal cells, drag it to the "both" bin.

Plant Cell Only: - central vacuole - Chloroplast - cellulose cell wall Animal Cell Only: - centriole Both: - mitochondrion - plasma membrane - endoplasmic reticulum - golgi apparatus - nucelus - cytoskeleton

Two fundamental types of cells are known to exist in nature: prokaryotic cells and eukaryotic cells (like the one shown in the Tour of an Animal Cell animation). Both prokaryotic and eukaryotic cells carry out all of the processes necessary for life, but they differ in some important ways. In this activity, you will identify which cell structures are found only in prokaryotic cells, only in eukaryotic cells, or in both types of cells. Drag each cell structure to the appropriate bin.

Prokaryotic: - nucleoid Eukaryotic: - nucleolus - lysosome - mitochondria both: - flagella - plasma membrane - ribosomes

What is the normal cell genotype if the person has hereditary retinoblastoma?

RB1+RB1−

Using RB1+RB1+ for the normal wild-type allele and RB1−RB1− for the mutant allele, identify the genotype of a cell in a retinoblastoma tumor.

RB1−RB1−

Which chromatin remodeler complex both slides and relocates nucleosomes to expose promoters or regulatory sequences?

SWI/SNF complex

Did you find any sequences in the human genome that were statistically similar to your query sequence?

Similar sequences were found only with the blastn (lower similarity) search.

Which of the following best describes the mechanism by which steroid hormones control gene expression?

Steroid hormones that enter the cell activate receptors. These hormone-receptor complexes then bind HREs and influence gene expression.

Which of the following functions is NOT associated with the TP53 protein?

Stimulating angiogenesis

How do the E values change as you go from the top of the list of hits to the bottom?

The E values get larger.

Deletion of the Dicer gene would have what effect on a cell?

The cell would be unable to synthesize siRNA or miRNA.

A 50-year-old man has been diagnosed with MELAS syndrome. His wife is phenotypically normal, and there is no history of MELAS syndrome in either of their families. The couple is concerned about whether their children will develop the disease. As a genetic counselor, what will you tell them?

The children won't develop the disorder.

What advice would you give individual III-8?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

What is metagenomics?

The study of DNA sequences from entire natural communities that include a range of organisms

Which of the following is the most accurate comparison of the two yeast samples studied in the microarray analysis at the time of sporulation?

The two yeast samples share a common genome, but display differences in their transcriptomes.

How will you show that the fusion protein retains its normal biological function? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.

This gene fusion could be introduced into a strain that is HOMOZYGOUS for a loss-of-function mutation of this gene to create a transgenic organism in which the only copy of the gene in question is the gene fusion. If the transgenic strain has the WILD-TYPE phenotype, then the gene fusion is functional. If the transgenic strain has the MUTANT phenotype, then the gene fusion is nonfunctional. If the transgenic strain has an INTERMEDIATE phenotype, then the gene fusion has partial function.

Do you think it is possible that significant increases in the incidence of other types of cancer will occur in the future among people who were exposed to the Fukushima radiation? Why?

Yes, it is possible, because radiation causes DNA damages in most/all cell types.

Bioinformatics programs can search DNA for specific sequences to help identify potential protein-coding regions. Label the sequences in the eukaryotic gene below that could be used by a computer program to identify a gene.

a. transcription regulatory sequences b. promoter c. start codon d. splice sites e. stop codon f. transcription termination sequences

An inherited human disorder, familial dysautonomia, results from a nucleotide mutation in the gene IKAP that is expressed in the nervous system. The decreased IKAP protein leads to abnormal development, and the resulting disease is usually fatal by age 30. The nucleotide change alters splicing. If this change affects only the nervous system and not the immune system, in which the gene is also expressed, what feature must be found in this gene?

alternative splicing

The process of finding the location of genes and functional (e.g., regulatory) sequences and their functions within a genome sequence is called ________.

annotation

Suppose a bacterium is infected by a phage it has not encountered before. Drag the labels to targets in Group 1 that indicate the steps of the CRISPR-Cas immune response. Then drag the labels to targets in Group 2 that demonstrate your understanding of the three main phases of the immune response.

blue: 1. Phage infects the bacterial cell with its DNA 2. Phage DNA incorporated as a new spacer into CRISPR array 3. transcription of CRISPR locus, yielding pre-crRNA 4. Pre-crRNA processed into mature crRNA 5. Mature crRNA forms complex with Cas nuclease 6. crRNA-Cas machinery cuts complementary target DNA of invading phage Pink 1. Spacer Acquisition 2. crRNA Biogenesis 3. interference

Which type of sequencing involves first creating a physical map?

clone-by-clone sequencing

In general, which part of a coding gene shows the most evolutionary conservation?

coding sequences

What is the name given to regions of chromatin that is always densely compacted and transcriptionally inert?

constitutive heterochromatin

A cell or organism in which all copies of the cytoplasmic organelle gene are the same is said to be ________.

homoplasmic

Predict the progeny that would result from each of the crosses listed in the table below. Drag the phenotypes to their correct locations in the table. Labels can be used once, more than once, or not at all.

petite #1 x petite #2 - 100% petite petite #1 x petite #3 - 50% petite; 50% wild type petite #2 x petite #3 - 100% petite

Conserved noncoding sequences (CNGs) are usually sequences involved in what kinds of functions?

regulation

If an entire genome is fragmented and then a large number of pieces are sequenced, the approach is known as the ________ approach.

shotgun

In mammals, the number of mitochondria per cell is highly variable. Which of the following would have the largest number?

skeletal muscle cells

The reason some cells respond to the presence of a steroid hormone while others do not is that ______

the receptors necessary for regulation differ among cells of various types

In 1718, the tsar of Russia, his wife the tsarina, and their five children were presumably assassinated and buried in an unmarked grave. Later, several women came forward and claimed that they were in fact Anastasia, one of the daughters whose bones had not been found. More recently, forensic scientists have extracted DNA, including mtDNA, from the skeletal remains. Which of the following samples of mtDNA had to be analyzed to discern which, if any, of the claimants was Anastasia?

the tsarina and the claimants

As an approach to understanding the function of a certain funfun gene, you wish to create a loss-of-function allele. How will you accomplish this?

transformation and homologous recombination

You wish to know the physical location of the encoded protein product. How will you ascertain such information?

translational fusion with GFPGFP gene

How to differentiate between proto-oncogene and tumor suppressor gene? Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

tumor suppressor genes normally function TO INHIBIT OR LIMIT CELL PROLIFERATION, whereas proto-oncogenes normally function TO PROMOTE CELL PROLIFERATION

Select the approaches you might take to examine the temporal and spatial expression pattern at the cellular level. Select the three correct answers.

- fusion with GFP gene - fusion with lacZ gene - in situ hybridization

Where is the enhancer sequence located?

6

Which kingdom does Fusarium redolens belong to?

Fungi

Does this information indicate the presence of enhancer and/or silencer sequences in the ME1 upstream sequence?

yes

List examples illustrating the phenomenon.

- Angelman syndrome - Prader-Willi syndrome

In whole-genome shotgun sequencing, the chromosome is cut into pieces, the pieces are sequenced, and the sequences are aligned based on overlapping sequences into a contig. Place the fragments of DNA in the proper places to form the contig for this sequence of DNA, using the central CAT sequence as a guide.

1. CCAGGCC 2. CCATCGA 3. GGCCATC 4. CAT 5. AGGCCAT 6. CATCGAG

What gene discussed in this chapter might be responsible for pausing the cell cycle of dividing cells long enough for radiation-induced damage to be repaired in cells?

TP53 gene

Which of the following components of the strategy ensures that sequence reads are obtained from the ends of cloned fragments?

The use of primers that anneal to vector sequences near vector/cloned fragment boundaries

What are the different chromatin classifications, and what is their relationship to gene expression?

There are two classes of chromatin with respect to gene transcription: EUCHROMATIN and HETEROCHROMATIN. The difference between them is that EUCHROMATIN is less densely packed and is accessible to transcription proteins, whereas HETEROCHROMATIN is more tightly packed and less accessible. Moreover, HETEROCHROMATIN can be further divided into two types: CONSTITUTIVE HETEROCHROMATIN and FACULTATIVE HETEROCHROMATIN. While CONSTITUTIVE heterochromatin refers to chromosome regions that are always packaged as HETEROCHROMATIN, FACULTATIVE heterochromatin refers to chromosome regions that can be packaged as EUCHROMATIN or HETEROCHROMATIN, depending on the environmental conditions, physiological conditions, or cell type.

Using this knowledge, how would you screen for Drosophila mutants that have an impaired circadian rhythm? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms can be used once, more than once, or not at all.

Using eclosion at TIMES OTHER THAN DAWN as the mutant phenotype, it is possible to conduct an F3 screen for recessive mutations that affect the time pupae eclose. Male flies HOMOZYGOUS for dark body (db) are fed EMS to induce mutations and then mated to females HETEROZYGOUS for a balancer chromosome 3 containing the db allele and the dominant marker, CyO, which causes curly wings. Individual F1 males that have CURLY wings and DARK bodies are selected and mated back to a female from the chromosome 3 balancer strain to create many independent F2 lines. F2 progeny with CURLY wings and DARK bodies will be heterozygous for the new mutations. Interbreeding the F2 will create many independent F3 populations. If the F2 were heterozygous for a circadian rhythm mutation, about one-third of the progeny would eclose at TIMES OTHER THAN DAWN.

Previously unidentifiable microorganisms have now been identified through ________.

metagenomics

Sequencing of DNA from a community of organisms rather than from a single individual is known as ________.

metagenomics

The term ________ refers to cells that are not confined in their growth and invade normal tissues

metastasis

A researcher has produced groups of contigs that are linked via paired-end sequences, although these include some sequence gaps. What are these groups called?

scaffolds

You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans. Using genome databases, you identify and align the three sequences, shown here.What can you conclude from these results?

- How many regions in the DNA sequences have been conserved among all three species? three - In general, DNA regions that are conserved between distantly-related species provide evidence of conserved FUNCTION. - Regulatory DNA that is conserved between distantly-related species may function as regions that bind REGULATORY PROTEINS.

How can you prove that your chosen candidate is the CFTRCFTR gene?

- Search for polymorphism of the gene between normal people and people with cystic fibrosis. - Show that people with cystic fibrosis are homozygous for mutant variants of the gene. - Show that parents of people with cystic fibrosis are both heterozygous for mutant variants of the gene.

Which of the following lists has the steps involved in the whole genome shotgun approach to Sequencing in the correct order?

1. Isolation and shearing of genomic DNA 2. Insertion of genomic fragments into cloning vector 3. Transformation of E. coli with cloning vector 4. Sequencing of cloned fragment ends 5. Sequence assembly

What are the steps in the shotgun approach to whole-genome sequencing? Drag the labels to their appropriate locations on the flowchart. Only some labels will be used.

1. multiple copies of the same chromosome are prepared. 2. chromosome copies are broken into 1-kb fragment 3. 1-kb fragments are cloned into plasmids 4. the plasmids are sequenced 5. a computer combines the fragment sequences.

The first step in annotating a gene is identifying the open reading frame. In bacteria, all genes that code for a protein have a start and stop codon with an open reading frame between them. A bioinformatics program can translate all the possible reading frames (series of 3 codons) in an attempt to find the longest open reading frame. How many possible open reading frames can a bioinformatics program translate from one DNA sequence? Enter your answer numerically (for example: 2).

6.00

Now that you understand what E values mean, you can determine which hit or hits represent the best match(es) to your query sequence. Which statement best describes the results shown in the Descriptions section?

A hit derived from Fusarium redolens is the best match to the query sequence

Which of the following best describes the role of chaperone proteins in the regulation of gene expression by steroid hormones?

Chaperone proteins maintain functionality of the receptor.

Given the information available from deletion analysis, can you give a molecular explanation for the observation that ME1ME1 expression appears to turn on and turn off at various times during normal mouse development?

Expression of ME1 is regulated by an enhancer and a silencer, which can be regulated such that ME1 expression is activated at some developmental stages and then repressed at others.

What are the approximate rates of cancer that develop in people carrying a mutation of one of these genes?

For mutations in MSH2, the lifetime risk of developing some type of cancer was 91% for males and 69% females.

What is the consensus sequence from Part B that has coverage included on at least 3 of the 5 DNA fragments (3x coverage)?

GGCCATC

What general role does acetylation of histone protein amino acids play in the transcription of eukaryotic genes?

Histone acetylation events are most often associated with transcription activation.

How does the alignment of the FN397219.1 sequence to your query sequence compare to the alignment of the AY259214.1 sequence you examined in Part F?

In the FN397219.1 alignment, there are the same number of nucleotide differences but more gaps.

Explain why cancer is almost certain to develop with the inheritance of one mutated copy of RB1RB1. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.

Individuals who inherit one mutant copy of RB1RB1 have ONLY ONE FUNCTIONAL COPY of RB1 in every somatic cell in their body. Such mutation results in a cell with no functional RB1 gene, and therefore, dysregulation of the G1 to S PHASE cell cycle transition.

Can you say with certainty that a woman inheriting a mutation of BRCA1 will definitely develop breast cancer in her lifetime? Why or why not?

One cannot conclude with certainty that a woman with a BRCA1 mutation will get breast cancer. Only 60% of women with certain BRCA1 mutations are expected to develop breast cancer by age 70.

How does the chromosome mutation producing Burkitt's lymphoma generate the disease?

- 1. The chromosome mutation that causes Burkitt′′s lymphoma is a reciprocal translocation involving chromosome 8 and chromosomes 2, 14, or 22. - 2. The translocation places this gene on chromosome 8 near genes that are highly actively transcribed - 3. This causes unregulated, high levels of c-MYC transcription. - 4. Because this gene codes for a transcription factor that activates transcription of genes that promote cell division its unregulated high-level expression leads unregulated cell division of B-lymphocytes.

There are two types of Lynch syndrome, what are they?

- Lynch syndrome II (noncolonic cancer of stomach endomentrium, biliary and pancreatic systems) - Lynch syndrome I (hereditary nonpolyposis colorectal cancer)

What genes are most commonly mutated in Lynch syndrome?

- MSH2 gene - MLH1 gene

In most plants, such as Arabidopsis, genes whose encoded products have roles related to photosynthesis have expression patterns that vary in a circadian manner. Using this knowledge, how would you screen for Arabidopsis mutants that have an impaired circadian rhythm?

Seed from wild-type plants would be treated with a mutagen, allowed to develop and self-fertilize, and the progeny collected and screened for gene expression profile defects.

Can a tumor arise from a single mutated cell? Are all the cells in a tumor identical?

Yes, a tumor can arise from a single, mutated cell, and it typically contains cells that are genetically heterogeneous.

Shotgun sequencing requires all of the following except?

a genetic map

A genome sequence is considered to be complete when all its ________ are included, as well as reasonable amounts of repetitive sequences.

euchromatic sequences

The feature of DNA fragment preparation that ensures fragment end overlap is _______.

random breakage of genomic DNA by physical shearing

What type of chromosomal rearrangement generates the c-ABL-BCR "fusion gene"?

reciprocal translocation

In 2000, when then-President Clinton along with Francis Collins of the Human Genome Project and Craig Venter of Celera announced the completion of a "draft" of the human genome, the event did not, in fact, represent true completion because most of what types of sequences were not included?

repetitive sequences

________ is a strategy that compiles genome sequence from many overlapping DNA sequences each corresponding to a random location in the target genome.

shotgun sequencing

Consider the predominant types of alternative splicing events that occur in mammals. Which of the following choices represent mRNA molecules that could be produced from the primary RNA transcript by alternative RNA splicing? (In each choice, the yellow part on the left represents the 5' cap, and the yellow part on the right represents the poly-A tail.) Select all that apply.

- ACEI - ACEGI - ACGI

In how many positions are there nucleotide differences between your query sequence and the sequence of accession AY259214.1?

10

Sort each scenario according to whether the phage will be able to infect the bacterial cell or whether the bacterial cell will be able to resist phage infection.

Phage could potentially infect bacterium: - phage has undergone a mutation near a PAM sequence since the bacterium encountered it last. - the phage's DNA has been engineered to remove all its PAM sequences. Bacterium could potentially destroy phage DNA. - the phage attacks a bacterial cell whose parent cell encountered the phage before it divided - the phage has undergone a mutation far away from a PAM sequence since the bacterium encountered it last.

Explain the reason for the difference between the genotypes. Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

The difference is that all cells of the person with sporadic retinoblastoma start out with two functional RB1 genes: only those cells that suffer mutations in both RB1 genes leads to tumor formation, and those mutations are rare events. this differs in the individual with hereditary retinoblastoma because all of their cells start out with one mutant RB1 and one wild-type RB1: any cell that undergoes a mutation to the single wild-type gene leads to tumor formation.

Based on the differences between proto-oncogenes and tumor suppressor genes, which of these genes would you classify as a proto-oncogene and which as a tumor suppressor gene? Drag the appropriate items to their respective bins.

Tumor suppressor genes: - APC - TP53 - RB1 Proto-oncogenes - c-MYC

Use the expression data for constructs 8 - 13 from Part B (repeated below) to determine the locations of EW and EL, as well as the promoter for Gene 2 (P2). Using the data, identify the function of each DNA segment by dragging the labels to their correct locations.

a. Ew b. El c. P2

Using the data, identify the function of each DNA segment by dragging the labels to their correct locations. Labels can be used once, more than once, or not at all.

a. P1 b. Ea c. I d. Ewl

Species whose ancestors might once have been free living may now be present as parasites. Would their genomes now tend to be larger, smaller, or approximately the same size and complexity?

smaller

Give an example of a benign tumor that becomes a malignant tumor.

the progression from polyp to malignant colon cancer

Once the genome of a novel organism has been sequenced, how do you know the sequence is correct? Which of the following methods could be used to ensure that sequencing data is correct? Select all that apply.

- Sequence the complementary DNA strands at the same time and use base pairing to check the sequence. - Sequence the genome multiple times and compare the reads from each sequence.

Describe the difference between a benign tumor and a malignant tumor. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.

- Benign tumors are composed of PRE-CANCEROUS CELLS that are growing excessively and ARE CONTAINED WITHIN THEIR TISSUE. - Malignant tumors are composed of CANCER CELLS whose growth is extensive and HIGHLY DISORGANIZED Cells of this type of tumors have the potential to METASTASIZE, escaping their tissue and spreading to other locations within the body.

Which statements about the regulation of transcription initiation in these genes are true?

- Control elements C, D, and E are distal control elements for the imaginin gene. - The fantasin gene will be transcribed at a high level when activators specific for control elements A, B, and C are present in the cell. - Both the fantasin gene and the imaginin gene will be transcribed at high levels when activators specific for control elements A, B, C, D, and E are present in the cell.

What can you conclude from these data? Answer each question below by dragging the terms on the left to the appropriate blanks on the right. Not all terms will be used.

- For which gene or genes does the insulator region act as an insulator? both Gene 1 and Gene 2 - How many enhancers control the expression of Gene 2 in wing and leg discs? two enhancers, one for each disc type

Test your understanding of the function of each structure in the CRISPR-Cas9 machinery by filling in the sentences. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms may be used more than once.

- From the CRISPR array in the bacterial genome, crRNA is transcribed and processed to help direct the Cas protein to the target DNA. - Cas9 is an endonuclease, encoded by cas genes in the bacterial genome, that cleaves invasive viral DNA. - Cas9 associates with crRNA and tracrRNA, forming a complex that is capable of targeting and cleaving viral DNA with a specific sequence. - Cas9 proteins consist of two signature nuclease domains that cleave the phage DNA: HNH cleaves the strand that is complementary to the crRNA, and RuvC cleaves the strand that is not. - Cas9 employs a strategy to distinguish the bacterium's own DNA from invasive viral DNA, and will not cleave DNA lacking a PAM sequence.

Test your understanding of the CRISPR locus in bacterial DNA by filling in the sentences. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms may be used more than once.

- In the CRISPR array, repeats are multiple short sequences that all have the same sequence. - The spacers are variable sequences derived from invading phage DNA. - The cas genes encode proteins involved in several functional roles such as spacer acquisition, crRNA biogenesis, and interference. - New spacers derived from invading phage DNA are inserted in the CRISPR array by Cas proteins. - The spacers are the molecular memory of previous phage attacks, enabling this immune system to be adaptive.

How does the chromosome mutation producing the Philadelphia chromosome lead to CML?

- The chromosome mutation producing the Philadelphia chromosome is a RECIPROCAL translocation that creates a gene fusion of the BCR GENE on chromosome 22 and the C-ABL GENE on chromosome 9. - The normal c-ABLc-ABL gene codes for a membrane-bound TYROSINE KINASE that SIGNALS CELL CYCLE REGULATORY PROTEINS and promotes the proliferation of WHITE BLOOD CELLS in response to proper extracellular signals. The BCR-c-ABLBCR-c-ABL gene fusion codes for a FUSION PROTEIN that has a constitutively active kinase, which sends a constant, unregulated signal stimulating continuous proliferation of target cells, thus leading to chronic myelogenous leukemia.

Other than the genus and species information, what characteristics do most of the top hit sequences share? Select the two best answers.

- They contain a sequence of an internal transcribed spacer (ITS). - They contain a ribosomal RNA (rRNA) sequence.

Correlate the following structures or complexes with their effects on eukaryotic gene expression. Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

- a promoter is a DNA sequence where RNA polymerase binds and begins the process of transcription. - an enhancer is a DNA sequence that binds regulatory proteins that interact with promoter-bound proteins to activate transcription. - a silencer is a DNA sequence that binds regulatory proteins that inhibit transcription. - RISC is the protein complex that is part of the RNA interference (RNAi) mechanism. It denatures short double-stranded RNAs to single strands that carry out RNAi. - Dicer is the enzyme complex that is active in RNAi where it cuts double-stranded regulatory RNAs into 21-bp to 26-bp segments that are subsequently denatured by RISC.

enhancer sequence is likely to be:

- located upstream of the gene it controls - orientation independent - located downstream of the gene it controls - located either nearby or at great distance from the gene it controls

Compare and contrast promoters and enhancers with respect to their location (upstream versus downstream), orientation, and distance (in base pairs) relative to a gene they regulate. promoter sequence is likely to be: Check all that apply.

- located within a few dozens nucleotides of the gene it controls - orientation dependent - located upstream of the gene it controls

In addition to inheriting a BRCA1BRCA1 mutation, what else must happen for a woman to develop breast or ovarian cancer?

- mutations in proto-oncogenes - environmental factors - mutations in tumor suppressor genes

Identify the normal functions of the following genes whose mutations are associated with the development of cancer. Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

- the c-MYC gene codes for a transcription factor whose expression promotes cell proliferation. - the APC gene codes for the protein bearing the same name (limits the growth of epithelial cells that are in contact with other cells, which prevents hyperplasia and dysplasia in epithelial tissue). - the TP53 gene codes for p53 protein (a cell cycle checkpoint regulator that prevents cell cycle progression in the presence of DNA damage). - the RB1 gene encodes pRB (binds to and inhibits e2F, which is a transcription factor that promotes the G1 to S cell cycle transition.)

Choose the normal functions of the protein products of these genes.

- MSH2 codes for a protein that identifies regions of DNA that contain mistakes in DNA replication by binding to DNA that contains mismatched base pairs. - MSH1 codes for a protein that is part of a complex of proteins that repairs the DNA in the region identified by MSH2.

Which statements about the modification of chromatin structure in eukaryotes are true?

- Methylation of histone tails in chromatin can promote condensation of the chromatin. - Some forms of chromatin modification can be passed on to future generations of cells. - Acetylation of histone tails in chromatin allows access to DNA for transcription. - DNA is not transcribed when chromatin is packaged tightly in a condensed form. - Acetylation of histone tails is a reversible process.

To test the hypothesis that the three conserved regions function as regulatory DNA, you make several transgenic constructs using a GFP reporter gene and you evaluate their expression in developing heart and lung tissue. What can you conclude from these results?

- Region 1 is necessary but not sufficient for gene expression in the heart because expression is absent when this region is mutated.Which other region, if any, is also required for gene expression in the heart? REGION 3 - . Region 2 is necessary and sufficient for gene expression in the lung because expression is absent when this region is mutated.Which other region, if any, is also required for gene expression in the lungs? no region - Region 3 is necessary but not sufficient for gene expression in the heart because expression is absent when this region is mutated.Which other region, if any, is also required for gene expression in the heart? Region 1

To investigate regulatory protein binding to Regions 1, 2, and 3, you will use labeled DNA fragments with some of the same point mutations as in Part B, incubate them with proteins extracted from heart or lung tissue, and conduct a gel shift assay. How would gel shift assay results be affected by these mutations?

- Regions 1 and 3 bind protein from heart tissue. If both Regions 1 and 3 are mutated, then the DNA will not shift on the gel when incubated with protein from heart tissue. - Region 2 binds protein from lung tissue. If Region 2 is mutated, then the DNA will not shift on the gel when incubated with protein from lung tissue.

Genomics is the study of biological processes from the perspective of the whole genome. Genomics includes several specific areas of study. Identify the type of genomics employed in each of the examples below. Terms may be used more than once.

1. DNA that represented approximately 1800 different genomes was isolated from the Sargasso Sea. metagenomics 2. This method was used to identify members of the human hemoglobin gene family. The members of this gene family descended from a single ancestral gene. evolutionary genomics. 3. Genes were identified in a novel bacteriophage genome using bioinformatics programs that use algorithms to look for common features of open reading frames. structural genomics 4. Genomes of several species of bacteria were compared to identify common organization of genes. evolutionary genomics 5. A sample of contaminated ground water was sequenced to identify the species diversity and relative abundance of bacteria in the sample. metagenomics 6. A protein domain in a protein with unknown function was identified as an ion channel. functional genomics