Intro to Cell Biology Review of Tests for Final

2.1 The induced-fit model

involves a conformational change in the shape of the enzyme.

5.17 There is a mutation in the repressor that results in a molecule known as a super-repressor because it represses the lac operon permanently. Which of these would characterize such a mutant?

it cannot bind to the INDUCER

2.14 Part D - New Mutant A new mutant has been discovered such that electrons from NADH are not passed to FMN but rather to Cyt b directly. What effect would this change have on the relative magnitude of the electrochemical proton gradient across the inner mitochondrial membrane.

it would reduce the gradient

1.26 Galactosemia is a potentially fatal disease that occurs in humans who lack the enzyme that converts galactose to glucose. To treat this disease, physicians exclude the monosaccharide galactose from the diet. Which of the following would you also predict to be excluded from the diet?

lactose

4.6 Part C - Relationship with Mendel's findings Suppose that the botanist carried out the test cross described in Parts A and B and determined that the original green-pod plant was heterozygous (Gg). Which of Mendel's findings does her test cross illustrate?

law of segregation

2.15 Which of the following contains hydrolytic enzymes?

lysosome

4.6 Part D - Relationship of allele behavior to meiosis During which part of meiosis (meiosis I or meiosis II) do the two alleles of a gene separate? During which phase does the separation occur? State your answer as meiosis I or meiosis II followed by a comma and the name of the phase (for example, if your answer is meiosis II and metaphase, enter meiosis II, metaphase).

meiosis I, anaphase

2.24 Part D - Acetyl CoA location During cellular respiration, acetyl CoA accumulates in which location?

mitochondrial matrix

4.14 Sister chromatids separate from each other during _____.

mitosis and meiosis II

1.9 Decreasing the saturation of the fatty acid chains on a particular type of phospholipid would result in the formation of _____.

more fluid bilayers ( Unsaturated fatty acids have kinks that prevent tight packing of the hydrophobic tails. This increases the fluidity and permeability of the membrane.)

1.15 Integral membrane proteins are anchored in lipid bilayers. Of the following four groups of amino acids - nonpolar, polar, charged/acidic, charged/basic - which would likely be found in the portion that crosses the lipid bilayer?

nonpolar amino acids (Only amino acids with nonpolar side groups containing only C and hydrogen would be stable in the hydrophobic interior of the membrane.)

2.36 Suppose a drug were added to mitochondria that allowed protons to freely pass through the inner membrane. (mitochondria = powerhouse/ ATP producer of the cell) Which of the following mitochondrial activities would most likely be inhibited?

oxidative phosphorylation

2.18 Part D - Pulse-chase experiments and protein location Scientists can track the movement of proteins through the endomembrane system using an approach known as a pulse-chase experiment. This experiment involves the "pulse" phase: Cells are exposed to a high concentration of a radioactively labeled amino acid for a short period to tag proteins that are being synthesized. the "chase" phase: Any unincorporated radioactively labeled amino acids are washed away and large amounts of the same, but unlabeled, amino acid are added. Only those proteins synthesized during the brief pulse phase are radioactively tagged. These tagged proteins can be tracked through the chase period to determine their location in the cell. The data below were obtained from a pulse-chase experiment in which cells were examined at different times during the chase period. The numbers represent the radioactivity (measured in counts per minute) recorded at each of the indicated sites. The higher the number, the greater the radioactivity. Data table with data from a pulse-chase experiment Based on these data, what is the most likely function of the cells in this experiment?

phagocytosis (the highest number and final destination is the lysosomes; The cells in this experiment were macrophages. These immune system cells have many lysosomes for the destruction of bacteria and other invaders brought into the cell via phagocytosis. The enzymes (hydrolases) that carry out this catabolic activity are synthesized in the endoplasmic reticulum, modified in the Golgi, and transported to the lysosomes.)

1.25 Part A - Components of nucleotides Sort these nucleotide building blocks by their name or classification. (The nucleic acids DNA and RNA are made from chains of nucleotides. Nucleotides consist of three components: a five-carbon sugar (either ribose or deoxyribose), a nitrogenous base attached to the sugar's 1'-carbon, and a phosphate group attached to the sugar's 5'-carbon.)

phosphate, ribose, deoxyribose, pyrimidines, and purines (All of the genetic material in all living organisms is made from these basic building blocks of nucleotides.) (see ppt)

3.17 In which mitotic phase do the chromosomes condense and does the mitotic spindle begin to form?

prophase

4.20 For the male Drosophila shown in Figure 13.1, what are the (1) haploid number, (2) ploidy, and (3) total number of chromosomes?

(1) 4, (2) 2n, and (3) 8

2.31 Part A Draw a redox reaction that occurs between compounds AH2 and B+ to form A, BH, and H+. On the drawing, connect the reactant and product forms of each compound and state if it is the reduction or oxidation step and how many electrons are transferred. Label the diagram by dragging the labels to the appropriate targets. Note: not all labels will be used.

(AH2) + (B^+) -----> (A) + (BH) + (H^+) 1. AH2 ---> A is an oxidation (lose 2e-) 2. B^+ ---> BH +H^+ is a reduction (gain 2e-)

2.18 Part C - The pathway of secretory proteins Proteins that are secreted from a eukaryotic cell must first travel through the endomembrane system. Drag the labels onto the diagram to identify the path a secretory protein follows from synthesis to secretion. Not all labels will be used. (Drag and Drop)

(protein synthesis): a) endoplasmic reticulum --> b) cis Golgi cisternae --> c) medial Golgi cisternae --> d) trans Golgi cisternae --> e) plasma membrane (extracellular space)

2.40 Part E - Cellular locations of the four stages of cellular respiration Each of the four stages of cellular respiration occurs in a specific location inside or outside the mitochondria. These locations permit precise regulation and partitioning of cellular resources to optimize the utilization of cellular energy.

*Glycolysis - cytosol *acetyl CoA formation - mitochondrial matrix *citric acid cycle - mitochondrial matrix *oxidative phosphorylation - inner mitochondrial membrane (Cellular respiration begins with glycolysis in the cytosol. Pyruvate, the product of glycolysis, then enters the mitochondrial matrix, crossing both the outer and inner membranes. Both acetyl CoA formation and the citric acid cycle take place in the matrix. The NADH and FADH2 produced during the first three stages release their electrons to the electron transport chain of oxidative phosphorylation at the inner mitochondrial membrane. The inner membrane provides the barrier that creates an H+ gradient during electron transport, which is used for ATP synthesis.)

2.19 For the oxidation of pyruvate shown in Figure 9.9, which answer correctly identifies molecules involved in the positive (+) and negative (−) control of this reaction?

+: NAD+, CoA, and AMP; −: Acetyl CoA, NADH, and ATP

5.7 In the process of transcription, the genetic information encoded in the sequence of bases that makes up a gene is "transcribed," or copied in the same language, into a strand of RNA bases. The enzyme that catalyzes this reaction is called an RNA polymerase. In eukaryotes, before the resulting strand (called pre-mRNA) leaves the nucleus, it is processed in several ways. The product of this processing is the mRNA that functions as the template for protein synthesis outside the nucleus. RNA processing After transcription begins, several steps must be completed before the fully processed mRNA is ready to be used as a template for protein synthesis on the ribosomes. Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus?

- A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA. -Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes. -A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA.

2.22 Exocytosis and endocytosis Sort the phrases into the appropriate bins depending on whether they describe exocytosis, endocytosis, or both. (Drag and Drop)

- Exocytosis: secretes large molecules out of the cell; requires fusion of vesicles with the plasma membrane; increases the surface area of the plasma membrane - Endocytosis: decreased the surface area of the plasma membrane; forms vesicles from inward folding of plasma membrane - Both: requires cellular energy; transported substances never really cross the plasma membrane

1.6 Part A What is the difference between linking glucose molecules with α-1,4-glycosidic linkages versus β-1,4-glycosidic linkages? Check all that apply.

- In β-1,4-glycosidic linkages every other glucose flipped in orientation. - The linkages are located on opposite sides of the plane of the glucose rings. - The linkages have different orientation of the glucose monomers. - In α-1,4-glycosidic linkages the glucose monomers are linked in the same orientation.

2.21 Part B - Compare and contrast the regulation of isocitrate dehydrogenase in step 3 of the citric acid cycle with what you have learned about phosphofructokinase in glycolysis. What are their differences?

- Isocitrate dehydrogenase: is regulated by competitive inhibition; is regulated by NADH - Phosphofructokinase: is regulated by allosteric inhibition; is regulated by ATP

1.20 Unicellular organisms live in a wide range of habitats, from the hot springs in Yellowstone National Park to the freezing temperatures of the Antarctic. Biological researchers have studied species of bacteria that are native to the artic tundra where temperture in the winter is well below zero and summer temperture is well above freezing. It has been shown that these bacteria adapt to survive during the winter by dramatically modifying their membranes. Predict what adaptive structural features you would expect in the membranes of these bacteia as they transition from summer to winter. Check all answers that apply

- The fatty acid tails would shorten. -There would be an increase in unsaturation (number of double bonds) in the fatty acid tails.

1.30 If the lipid bilayer were to contain the CFTR molecule, what would pass through the membrane in a hypothetical situation where you added a 1-molar solution of sodium chloride on the left side and a 1-molar solution of potassium ions on the right? Assume that there is an equal amount of water on each side at the start of the experiment. Check all that apply.

- chloride ions -water will initially move from the right side to the left, then backward

2.16 From the equation ΔG = ΔH − TΔS, it can be concluded that __________.

- increasing the change in entropy of a system will increase the probability of spontaneous change - the capacity of a system to perform useful work is related to the total free energy of the system - increasing the temperature of a system will increase the probability of spontaneous change *all the answer choices are correct

2.18 Part B - Sites of protein synthesis All proteins are synthesized by ribosomes in the cell. Some ribosomes float freely in the cytosol, while others are bound to the surface of the endoplasmic reticulum. Most proteins made by free ribosomes function in the cytosol. Proteins made by bound ribosomes either function within the endomembrane system or pass through it and are secreted from the cell. Which of the following proteins are synthesized by bound ribosomes? Select all that apply.

- lysosomal enzyme - ER protein - insulin

1.7 What conditions must be present for the effects of osmosis to occur? Check all that apply.

- membrane that allows only water to pass, but not the solute - different solute concentrations on the two sides of a membrane

2.38 Exposing inner mitochondrial membranes to ultrasonic vibrations will disrupt the membranes. However, the fragments will reseal "inside-out'. These little vesicles that result can still transfer electrons from NADH to oxygen and synthesize ATP. The functions of these 'inside-out' vesicles produced have been characterized with various treatments that support the chemiosmotic hypothesis. Of the treatments below which one(s) accurately describes the functioning of these vesicles? Select each treatment description that accurately describes the funtioning of 'inside-out' vesicles. Choose all that apply.

- will make ATP from ADP and Pi if transferred to a pH7 buffered solution after incubation in a pH4 buffered solution. - will become acidic inside then NADH is added.

1.6 Part B What are the consequences (of ifference between linking glucose molecules with α-1,4-glycosidic linkages versus β-1,4-glycosidic linkages)? Check all that apply.

- β-1,4-glycosidic linkages are much more likely to form linear fibers and sheets. - β-1,4-glycosidic linkages more resist to degradation.

1.2 Part B - Compare and contrast the structures and functions of starch and glycogen. How are these molecules different? Check all that apply.

-All glycogen polysaccharides are more highly branched with alpha 1,6-glycosidic linkages compared to starch -Starch consists of amylose and amylopectin. -Starch is a mixture of unbranched and branched polysaccharides.

2.34 The Golgi apparatus has a polarity, or sidedness, to its structure and function. Which of the following statements correctly describes this polarity?

-Proteins in the membrane of the Golgi may be sorted and modified as they move from one side of the Golgi to the other. -Lipids in the membrane of the Golgi may be sorted and modified as they move from one side of the Golgi to the other. -Transport vesicles fuse with one side of the Golgi and leave from the opposite side. -Soluble proteins in the cisternae (interior) of the Golgi may be sorted and modified as they move from one side of the Golgi to the other. *All of the listed responses correctly describe polarity characteristics of the Golgi function.

1.13 Part B - Electrochemical gradients Because ions carry a charge (positive or negative), their transport across a membrane is governed not only by concentration gradients across the membrane but also by differences in charge across the membrane (also referred to as membrane potential). Together, the concentration (chemical) gradient and the charge difference (electrical gradient) across the plasma membrane make up the electrochemical gradient. Consider the plasma membrane of an animal cell that contains a sodium-potassium pump as well as two non-gated (always open) ion channels: a Na+ channel and a K+ channel. The effect of the sodium-potassium pump on the concentrations of Na+ and K+ as well as the distribution of charge across the plasma membrane is indicated in the figure below.

-The diffusion of Na+ ions into the cell is facilitated by the electrical gradient across the plasma membrane. -The diffusion of K+ ions out of the cell is facilitated by the K+ concentration gradient across the plasma membrane. -The diffusion of K+ ions out of the cell is impeded by the electrical gradient across the plasma membrane. (The concentration gradient of Na+ ions across the membrane (higher Na+ concentration outside) facilitates the diffusion of Na+ into the cell. At the same time, the electrical gradient across the membrane (excess positive charge outside) drives Na+ into the cell. The concentration gradient of K+ ions across the membrane (higher K+ concentration inside) facilitates the diffusion of K+ out of the cell. However, the electrical gradient across the membrane (excess positive charge outside) impedes the diffusion of K+ out of the cell. The electrochemical gradient for an ion is the sum of the concentration (chemical) gradient and the electrical gradient (charge difference) across the membrane. For Na+ ions, diffusion through the Na+ channel is driven by both the concentration gradient and the electrical gradient. But for K+ ions, the electrical gradient opposes the concentration gradient. Therefore, the electrochemical gradient for Na+ is greater than the electrochemical gradient for K+.)

3.14 Part C Select the false statement about the G protein hormone receptor system

-The hormone is a ligand for G protein (a receptor protein not a G protein) True Statements: -This system is an example of membrane-based signal transduction -The system results in an amplification of the original signal. -GTP, a close relative of ATP, is required to complete activation of the G protein -The G protein must be able to move about along the membrane

2.13 Part B - Energy State Reduction Wben an atom or molecule gains one or more electrons, it is said to be ______________ and is at a ____________ energy state.

reduced; higher

2.13 Part F - In ther fermentation reaction shown below, pyruvate (pyruvic acid) is being _________ and NADH is being _______________

reduced; oxidized

3.6 Identify the events in the cell cycle that must be completed successfully for daughter cells to share an identical complement of chromosomes. Check all that apply.

-the spindle apparatus must connect with the kinetochores of each sister chromatid in pro metaphase -the sister chromatids of each replicated chromosome must be partitioned in anaphase and fully separated into daughter cells by cytokinesis -all the chromosomes must be replicated during the S phase

1.5 Part F Which two molecules (shown as a straight chain structure and not as a cyclical structure) are aldose sugars that are structural isomers (have the same number of C, H, and Os but positioned differently)? Enter the numbers of the 2 molecules separated with a comma. For example if the correct answer was number 13 and 14 you should enter 13, 14 into the answer box.

1 and 4 (see ppt)

1.28 Imagine a beaker with solutions separated by a planar membrane (like what is shown in Figure 6.12, step 3). Predict what will happen after addition of a new solute to the solution on the left side, if the new solute (1) crosses the membrane readily or (2) is incapable of crossing the membrane.

1) The new solute will diffuse from left to right to establish equilibrium. (2) The water level on the right will fall.

5.6 Operon vocabulary Can you match terms related to operons to their definitions? Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

1. A(n) operon is a stretch of DNA consisting of an operator, a promoter, and genes for a related set of proteins, usually making up an entire metabolic pathway. 2. Thegenes of an operon is/are arranged sequentially after the promoter. 3. A(n) promoter is a specific nucleotide sequence in DNA that binds RNA polymerase, positioning it to start transcribing RNA at the appropriate place. 4. A(n) regulatory gene codes for a protein, such as a repressor, that controls the transcription of another gene or group of genes. 5. Regulatory proteins often bind to the operator to control expression of the operon. 6. A(n) repressor is a protein that inhibits gene transcription. In bacteria, this protein binds to the DNA in or near the promoter. 7. A(n) inducer is a specific small molecule that binds to a bacterial repressor protein and changes its shape so that it cannot bind to an operator, thus switching an operon on.

1.3 Rank the molecules for storage of potential energy from highest to lowest. Rank the molecules from left (highest potential energy storage) to lowest. (Drag and Drop)

1. CH4 2. COH4 3. COH2 4.CO2H2 5. CO2 (highest potential energy when there are fewer bonds and single bonds opposed to double bonds)

3.1 Part C - The roles of proteins in bacterial cell division and eukaryotic cytokinesis The division of a bacterial cell into two daughter cells (called binary fission) is accomplished by a protein called FtsZ. FtsZ is very similar to the tubulin subunits that form microtubules in eukaryotes. After the replicated bacterial chromosomes have moved to opposite ends of the cell, a ring of FtsZ proteins forms inside the plasma membrane in the region where the cell will divide. As the FtsZ ring constricts, the plasma membrane and bacterial cell wall fold in and eventually separate into two cells. Plant and animal cells also require cytoskeletal proteins for cytokinesis, although the roles these proteins play differ among bacteria, plants, and animals. For each space in the table, drag the appropriate label to indicate if the statement is true or false for each group of organisms.

1. Cell divides by constriction of a ring of protein. Bacteria: true Animal: true Plant: false 2. The presence of a cell wall prevents the cell from dividing by contraction. Bacteria: false Animal: false Plant: true 3. Tublin or tublin-like molecules function in binary fission (in bacteria) or cytokinesis (in animals and plants). Bacteria: true Animal: false Plant: true

3.7 1. After a carbohydrate meal glucose concentration increases in the blood and glucose enters the beta cells through ______ transporters.

1. GLUT

3.10 Part C - Predicting movement through an artificial non-gated K+ channel Suppose that an artificial non-gated K+ channel could be inserted into the plasma membrane of an axon at resting potential (membrane potential = -70 mV). Assume that the axon has not recently produced an action potential. What would happen when an artificial K+ channel is inserted into an axon membrane at resting potential? Answer questions 1-4 by selecting only from the three answer choices to the left of each question. Drag the correct answer to the right of each question.

1. In what direction will K+ ions move through the artificial channel? out of the cell 2. Does K+ concentration gradient promote or impede the movement of K+ ions through the artificial channel? promote 3. Does membrane potential promote or impede the movement of K+ ions through the artificial channel? impede 4. Does the movement of K+ ions through the artificial channel affect the membrane potential? causes hyperpolarization

1.27 Part A - Distinguish between the levels of structural description of proteins: primary, secondary, tertiary, and quaternary. Complete the following vocabulary exercise relating to the level of structure in proteins. Match the words in the left-hand column with the appropriate blank in the sentences in the right-hand column.

1. Primary structure is the sequence of amino acids in a protein. 2. Quaternary structure is the result of two or more protein subunits assembling to form a larger, biologically active protein complex. 3. Tertiary structure is achieved when a protein folds into a compact, three-dimensional shape stabilized by interactions between side-chain R groups of amino acids 4. Secondary structure describes the alpha-helices and beta-sheets that are formed by hydrogen bonding between backbone atoms located near each other in the polypeptide chain.

3.25 Explain the difference between a ligand-gated K+ channel and a voltage-gated K+ channel. Match the words in the left column to the appropriate blanks in the sentences on the right. Make certain each sentence is complete before submitting your answer.

1. The ligand-gated channel opens or closes in response to binding by a small molecule . 2. The voltage-gated channel opens or closes in response to changes in membrane potential .

4.19 Analyze Mendelian Cross Edited for exam In pigeons, checkered feathered pattern (B) is dominant over barred (b), and grizzled (spotted) color pattern (G) is dominant over plain color (g). Data has shown that the genes controlling these two traits are on completely separate chromosomes. What phenotypic ratio would you expect among the progeny from the following cross: BbGg X bbgg?

1. The proportion that are checkered, grizzled is 1/4th 2. The proportion that are checkered, plain is 1/4th 3. The proportion that are barred, grizzled is 1/4th 4. The proportion that are barred, plain is 1/4th

4.4 Dominance Relations

1. William Bateson and R.C. Punnett while crossing Pea plants produced F1 dihybrid plants (PpLl) that had purple flowers and long pollen grains. When they selfed the F1 they were expecting a standard 9/16, 3/16, 3/16, 1/16 F2 ratio but observed something quite different when more offspring resembled the original parents. To test for linkage they performed a testcross of the dihybrid. The test parent was ppll and the result produced was 47 Purple, Long: 444 Purple, oval: 456 red, Long and 53 red, oval. From this testcross they concluded that the genes were linked . From these results you would also be able to conclude that the two pure breeding parents that produced the dihybrid (PpLl) were PPll crossed with ppLL . 2. Evidence of codominance is observed when the phenotype of the heterozygote provides evidence that both alleles produce a functionalenzyme . In incomplete dominance the evidence from the evaluation of the heterozygote compared to the homozygote individuals suggests that incomplete dominance isenzyme limited.

3.2 Fill in the blank Soon after a checkpoint has been passed the cyclin protein for that checkpoint is absent from the cell. As the cell cycle progresses more cyclin protein is gradually produced which immediately binds to its respective kinase enzyme but this Cyclin-Cdk complex is initially ___1____. Once the Cyclin-Cdk complex is produced it is ___2___ at a regulatory site by another separate kinase enzyme that is not cyclin dependent. This step adds two functional groups to the Cyclin-Cdk complex and this enhances the ____3____. At a critical stage of the cell cycle a new kinase enzyme is produced which further phosphorylates the Cyclin-Cdk complex at an ____4____ site and at this time the cyclin-Cdk complex is still ___5___. When a ___6____ factor molecule binds to the extracellular site on a ___7____ protein, signal transduction activates the ____8____ protein on the inside of the cell membrane, which subsequently phosphorylates the activating Cdk phosphatase enzyme. The activated Cdk phosphatase enzyme removes the two phosphates from the regulatory (inhibitory) site and this switches the cyclin-Kinase complex to the ___9___ state. One of the first function of an activated Cyclin-Cdk complex is to activate an enzyme process that destroys the ___10___ protein and this serves as a very important function in the cell as it woks as an ___11____ switch.

1. inactive 2. phosphorylated 3. inactivity 4. activating 5. inactive 6. growth 7. receptor 8. ras 9. 'on' 10. cyclin 11. 'off'

2.10 Complete the following sentences about enzyme function: Enzymes speed reaction rates by ___1.___ and lowering activation energy. Activation energies drop because enzymes stabilize ___2.____. Enzyme specificity is a function of the active site's shape and the chemical properties of ___3.____ at the active site

1. orienting substrates; 2. the transition state; 3. R-groups

2.14 Part B - State of FMN when it passes electrons As two electrons are passed from FMN to Fe-S proteins, FMN becomes ______1.________, whereas Fe-S protein becomes _____2._____.

1. re-oxidized.....2. reduced

2.14 Part C - Poison cyt a If a metaboic poison irreversibly binds to cyt a, cyt a will become permanently _____1______, whereas cyt a3 will be permanently ____2_____.

1. reduced .... 2. oxidized

2.14 Part A - When electrons from NADH are released onto FMN, FMN becomes _______1.______, and since Fe-S protein is a stronger ____2._____ agent with a ____3._______ negative Standard Reduction Potential, it immediately accepts the electrons from FMN. (process of reduction-oxidation reactions)

1. reduced......2. oxidizing agent...... 3. less

3.26 Part A Labeling an action potential diagram

1. resting potential 2. depolarization 3. repolarization 4. hyperpolarization 5. resting potential restored

3.26 Part B Explain which ion flow or flows are responsible for each part.

1. resting potential - Na+, K+, and Cl- at equilibrium in respects to electrochemical gradients 2. depolarization - Na+ channels open allowing influx of Na+ 3. repolarization - K+ channels open allowing efflux of K+ ions; Na+ channels are inactivated 4. hyperpolarization - K+ channels have remained open and are slowly closing, temporarily hyper polarizing cell

3.3 1. DNA replication produces two identical DNA molecules, called _________, which separate during mitosis.

1. sister chromatids

4.28 Allele segregation and gamete formation One character in peas that Mendel studied was yellow versus green seeds. A cross between a homozygous yellow line (YY) and a homozygous green line (yy) will result in F1 plants that are heterozygous (Yy) for this trait and produce yellow seeds. When an F1 plant undergoes meiosis, what gamete types will it produce, and in what proportions? Use your understanding of Mendel's law (or principle) of segregation to label each gamete possibility as "correct" or "incorrect."

1/2 Y and 1/2 y are the correct statement from Yy

4.8 Assume that five pairs of genes assort independently. Calculate the probability of the following events: An AaBbCCDdee offspring from the cross AaBbCCddEe X AaBbCcDdee, Enter the answer as a fraction expressed with the numerator followed by a forward slash and then the denominator. For example if the probablity was 0.5 you would enter 1/2

1/32 (2^5)

4.13 Albinism is an autosomal (not sex-linked) recessive trait. A man and woman are both of normal pigmentation, but both have one parent who is albino (without melanin pigmentation). What is the probability that their first child will be an albino?

1/4 (1/2*1/2)

4.15 Meiosis results in a reassortment of maternal and paternal chromosomes. If n = 3 for a given organism, there are eight different combinations of paternal and maternal chromosomes. If no crossing over occurs, what is the probability that a gamete will receive only paternal chromosomes?

1/8 (2^3)

4.26 A species has ten distinct types of chromosomes. A haploid cell of this species contains how many chromosomes?

10

2.33 Part C If ΔH = -50.0 kJ and ΔS = -0.500 kJ/K , the reaction is spontaneous below a certain temperature. Calculate that temperature. Express your answer numerically in kelvins.

100 K ΔG=ΔH−TΔS 0= -50.0kJ - (T)(-0.500 kJ/K)

1.5 Part E Which three molecules could be found in a RNA nucleotide? Enter the three numbers of molecules that make up a RNA nucleotide with each separated with a comma. For example if the correct choice was numbers 8, 14 and 15 you should enter 8, 14, 15 into the box provided.

11,12, and 13 (see ppt)

1.5 Part H Which molecule is a disaccharide? Enter the number of the molecule in the box provided.

15 (see ppt)

1.5 Part G Which molecule is an amino acid that would be involved in forming disulfide bridges (disulfide bonds), which are covalent bonds that hold extracelluar proteins in a defined tertiary structure. Enter the correct number in the box provided.

2 (see ppt)

3.7 2. Increased glucose concentration leads to an increase in the intracellular concentration of ______ from the process of oxidative metabolism.

2. ATP

3.3 2. After chromosomes condense, the ______ is the region where the identical DNA molecules are most tightly attached to each other.

2. centromere (s)

1.8 If a DNA double helix contains 28% T nucleotides, then what is the percentage of A nucleotides?

28% ( A and T are complementary base pairs, so the amounts of A and T should be equal.)

4.7 The karyotype of a trisomic individual is symbolized as ____.

2n + 1

5.3 Part A A DNA template strand has the following base sequence. 5' TTACACGTGGACTGAGGACCTCTCCAT 3' Answer the following: What is the complementary strand of this template? (label the ends)

3' AATGTGCACCTGACTCCTGGAGAGGTA 5'

5.22 Part C 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' What is the anticodon that would match the third codon in the mRNA, shown above.

3'CAA5'

5.22 Part D 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' What would be the template strand DNA for this third codon?

3'CAA5'

3.3 3. During mitosis, microtubules attach to chromosomes at the __________.

3. kinetochore (s)

4.23 Different ratios occur in crosses with single gene pairs or two gene pairs. What types of ratios are likely to occur in crosses dealing with a single gene pair?

3:1, 1:1, 1:2:1

3.7 3. During the resting state of the beta cells there are many open KATP channels that allows the continuous ____a_____ of K+ ions from the cell and this ion movement is a major component involved in the setting of the ____b____ membrane potential at -70 mV.

3a. leakage 3b. resting

3.3 4. In dividing cells, most of the cell's growth occurs during _______.

4. interphase

3.7 4. The binding affinity of ATP for the allosteric site on the KATP channels is very ____a____ meaning that the Km for binding is ____b____.

4a. low 4b. high

1.5 Part D Which molecule shows a cis configuration around a C=C (carbon, carbon double bond)? Note there are actually two molecules from the figure that fit this discription. You only need to enter one correct answer. Enter the number of the molecule for your choice in the box provided

5 (see ppt)

5.3 Part B If the template is transcribed by RNA Pol what is the mRNA produced? A DNA template strand has the following base sequence same as above repeated for convenience. 5' TTACACGTGGACTGAGGACCTCTCCAT 3'

5' AUGGAGAGGUCCUCAGUCCACGUGUAA 3' (mRNA read alway 5'-->3')

5.22 Part E 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' What would be the coding strand DNA for the third codon

5'GTT3'

5.22 Part B 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Write the third codon of this message and label the ends of the codon appropriately.

5'GUU3'

1.11 If one strand of a DNA molecule has the sequence of bases 5'ATTGCA3', the other complementary strand would have the sequence _____.

5'TGCAAT3'

3.3 5. The __________ is a cell structure consisting of microtubules, which forms during early mitosis and plays a role in cell division.

5. mitotic spindle(s)

4.21 What proportion of chromosomes in a human skin cell are paternal chromosomes?

50%

3.7 5. Only when ATP levels significantly increase will there be any significant binding to the KATP channels but when ATP does bind it ___a___ a gate in these channels which leads to a significant ___b____ of the membrane due to the retention of many positively charged K+ ions that previously ___c___ from the cell.

5a. closes 5b. depolarization 5c. leaked

1.5 Part C Which monosaccharide molecule is found linked together in long chains through 1,4 alpha linkages with occasional 1,6 branches to form the polysaccharides of starch in plants or glycogen in animals.

6 (see ppt)

3.3 6. During interphase, most of the nucleus is filled with a complex of DNA and proton in a dispersed form call _________.

6. Chromatin

3.7 6. When the depolarization of the beta membrane reaches __a__ mV which is the ___b___ voltage, numerous voltage-gated ___c___ channels open leading to a ___d___ of calcium ions.

6a. -55 6b. threshold 6c. calcium 6d. influx

1.5 Part A - ID amino acid with hydrophobic R-gourp Which of the following molecules is an amino acid with a hydrophobic R-group or side chain?

7 (see ppt)

1.5 Part B - ID molecules to form peptide bond Which of the following pairs of molecules could be joined together by a peptide bond in a dehydration synthesis (condensation) reaction?

7 and 8 (see ppt)

3.3 7. In most eukaryotes, division of nucleus is followed by ________, when the rest of the cell divides.

7. cytokinesis

3.7 7. The calcium signal leads to the ___a___ of the secretory vesicles, which are storing ____b___.

7a. exocytosis 7b. insulin

3.3 8. The __________ are the organizing centers for microtubules involved in separating chromosomes during mitosis.

8. centrosome(s)

5.22 Part A 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' How many bases are found on the 5' UTR of this mRNA?

9.00

4.33 Which statement is correct concerning the relationship between chromosomes and chromatids?

A replicated chromosome contains two sister chromatids.

2.39 Consider the two-step metabolic pathway: A—(enzyme 1)—>B—(enzyme 2)—>C How would inactivating enzyme 1 affect the concentrations of molecules A, B, and C relative to what they would be if the pathway were fully functional?

A would increase; B and C would decrease

2.6 Part F - When the ATP to ADP+AMP ratio is low (indicating low energy charge) the excess _________ binds to an _______________ site on the enzyme and the binding causes a overall shape change that alters the active site in such as way that enhances the binding of substrate. The effect of this regulation speeds the production of the oxidative metabolism during times when the cell has inadequate number of energy carrier molecules available to fuel the endogonic biochemical work of the cell.

ADP, allostric

2.31 Part B If this represents an exergonic reaction, identify which of the five substances would have the highest-energy electrons. [(AH2) + (B^+) -----> (A) + (BH) + (H^+)]

AH2

2.5 Why is ATP production during cellular respiration characterized as indirect?

ATP is not produced directly by the ETC but instead via the proton gradient generated during electron transport through the ETC.

1.1 Which statement accurately explains how you could use the structural formula of an amino acid's R-group (side chain) to determine if it is acidic, basic, or nonpolar?

Acidic R-groups contain a carboxyl functional group. (amino acid R-side group chart; Although all amino acids contain at least one carboxyl group, the only side chains that do belong to acidic Asp and Glu.)

5.16 Part B Which of the following regulatory elements is not composed of DNA sequences?

Activators

1.13 Part A - Active transport by the sodium-potassium pump All cells contain ion pumps that use the energy of ATP hydrolysis to pump ions across the plasma membrane. These pumps create an electrochemical gradient across the plasma membrane that is used to power other processes at the plasma membrane, including some transport processes. In animal cells, the main ion pump is the sodium-potassium pump. Complete the diagram below using the following steps.

Active transport by the sodium-potassium pump follows this cycle. 1. Three Na+ ions from the cytosol bind to the pump. 2. The binding of Na+ stimulates the phosphorylation of the pump protein by ATP. 3. Phosphorylation causes a conformational change in the pump that moves the three Na+ ions against their concentration gradient and releases them outside the cell. 4. The release of the Na+ ions permits two K+ ions from outside the cell to bind to the pump, and the phosphate group is released. 5. Release of the phosphate group causes another conformational change in the pump. 6. The conformational change in the pump moves the two K+ ions against their concentration gradient and releases them into the cytosol.

1.40 Which statement best explains the effect on membrane permeability of cholesterol and/or temperature?

Adding cholesterol reduces permeability because its steroid rings fill gaps in the hydrophobic membrane interior. (Cholesterol's bulky steroid rings result in a denser membrane interior, making it more difficult for materials to pass through.)

2.35 Which of the following results provided evidence of a nuclear localization signal in the nucleoplasmin protein?

After cleavage of the protein, only the tail segments appeared in the nucleus.

4.2 Part B - Gene linkage and phenotypic ratios Now, suppose that the three tomato genes from Part A did not assort independently, but instead were linked to one another on the same chromosome. Would you expect the phenotypic ratio in the offspring to change? If so, how?

All eight possible phenotypes could occur, but a greater proportion of the offspring would have the parental phenotypes.

4.32 Which of the following statements best explains the paradox of sex?

All other things being equal, asexual organisms should produce more offspring than sexual organisms.

3.20 Based on what you have learned about how cells ensure that proteins end up in the right place (Chapter 7), what type of signal would you expect to be exposed on a cytosolic receptor after a steroid hormone changes the receptor's conformation?

Amino acids required for transport through the nuclear pore complex

2.32 Which answer best explains why aerobic respiration produces more ATP per mole of glucose than either anaerobic respiration or fermentation?

Among known electron acceptors, O2 is most electronegative. (Oxygen's high electronegativity means there is a larger potential energy drop in aerobic respiration than in either anaerobic respiration or fermentation.)

2.27 The polymerization of amino acids into a protein is an example of _____.

Anabolic pathway (Anabolic pathways use energy to build cell structures.)

2.28 Part B Using what you have learned about changes in free energy, would you predict the ΔG value of anabolic reactions to be positive or negative?

Anabolic reactions will often have a positive ΔG based on an increase in enthalpy and decrease in entropy

3.5 Which answer correctly associates a phase of mitosis with what happens to chromosomes during that phase?

Anaphase: Sister chromatids separate.

1.18 An RNA molecule that can catalyze chemical reactions is called a_____.

ribozyme ( Altman and Cech shared a Nobel Prize for showing that RNA could catalyze reactions. Such catalytic RNAs were termed ribozymes.)

2.37 Part A Drag the labes to identify each molecule in the cycle acting as an oxidizing agent and reducing agent respectively.

see powerpoint

2.37 Part B Identiy enzymatic reactions of the Krebs (Citric Acid) Cycle Drag the labels to identify the enzymatic function of the indicated steps.

see powerpoint

3.13 Part B - Voltage-gated channels and the action potential The fixed pattern of changes in membrane potential during an action potential is coordinated by the sequential opening and closing of voltage-gated ion channels. Can you identify the status (open/closed) of the voltage-gated Na+ and K+ channels during each phase of an action potential? Drag the appropriate labels onto the graph to indicate the status (open or closed) of the voltage-gated Na+ and K+ channels during each phase of an action potential. Labels may be used once, more than once, or not at all.

see powerpoint for labeling a. resting potential - Na+ & K+ channels closed b. rising phase (depolarization) - Na+ channels open & K+ channels closed c. falling phase (repolarization)- Na+ channels closed & K+ channels open d. undershoot (hyperpolarization) - Na+ channels closed & K+ channels open e. resting potential - Na+ & K+ channels closed

3.10 Part A and Part B

see ppt

3.18 Part A - Ion channels and chemical synapses Chemical synapses transmit information from the sending (presynaptic) cell to the receiving (postsynaptic) cell in the form of neurotransmitters. The release of neurotransmitter into the synaptic cleft and the resulting changes in the membrane potential of the postsynaptic cell (postsynaptic potentials) all depend on the presence of several different types of gated ion channels and the distribution of these channels in the pre- and postsynaptic cells. The image here illustrates a chemical synapse.

see ppt

3.27 Mitosis Events

see ppt

3.4 Diagram of mitosis

see ppt

4.2 Part A

see ppt

4.2 Part C - Building a linkage map Suppose that you perform the cross discussed in Part B: MmDdPp x mmddpp. You plant 1000 tomato seeds resulting from the cross, and get the following results:

see ppt

4.30 Diagram of independent assortment

see ppt

5.4 Exon and intron splicing mutation

see ppt

4.10 Part B - The inheritance of both a sex-linked trait and an autosomal trait in humans Red-green color blindness is due to an X-linked recessive allele in humans. A widow's peak (a hairline that comes to a peak in the middle of the forehead) is due to an autosomal dominant allele. Consider the following family history: A man with a widow's peak and normal color vision marries a color-blind woman with a straight hairline. The man's father had a straight hairline, as did both of the woman's parents. Use the family history to make predictions about the couple's children. Drag the correct label to the appropriate location in the table. Not all labels will be used.

see ppt (1/4, 1/2, 0, 1)

5.18 Part A- Types of Mutations

silent mutation, missence mutation, nonsense mutation, frameshift mutation

2.17 Which is true of the metabolic pathway shown here? enzyme 1 enzyme 2 enzyme 3 A ———> B———> C ———> D

B is the product of enzyme 1 and the substrate for enzyme 2. ( B is an intermediate along this pathway, serving as both a product and a reactant.)

5.2 Use this information to answer the question(s) below. Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the promoter for the lac operon to the region between the beta galactosidase (lacZ) gene and the permease (lacY) gene, which of the following would be likely?

Beta galactosidase will not be produced.

2.21Part A - Compare and contrast the regulation of isocitrate dehydrogenase in step 3 of the citric acid cycle with what you have learned about phosphofructokinase in glycolysis. What do they have in common?

Both enzymes are regulated by feedback inhibition.

2.41 Which of the listed statements describes the results of the following reaction? C6H12O6 + 6 O2 → 6 CO2 + 6 H2O + Energy

C6H12O6 is oxidized and O2 is reduced.

5.23 Transcription of structural genes in an inducible operon _____.

starts when the pathway's substrate is present

2.28 Part A Using what you have learned about changes in free energy, would you predict the ΔG value of catabolic reactions to be positive or negative?

Catabolic reactions will often have a negative ΔG based on a decrease in enthalpy and increase in entropy

4.6 Part A - Identifying the genotype How could the botanist best determine whether the genotype of the green-pod plant is homozygous or heterozygous?

Cross the green-pod plant with a yellow-pod plant.

4.24 Part B - Changes in ploidy and DNA content during meiosis The parent cell that enters meiosis is diploid, whereas the four daughter cells that result are haploid. Which statement correctly describes how cellular DNA content and ploidy levels change during meiosis I and meiosis II?

DNA content is halved in both meiosis I and meiosis II. Ploidy level changes from diploid to haploid in meiosis I, and remains haploid in meiosis II.

3.15 What evidence suggests that during anaphase, kinetochore microtubules shorten at the kinetochore?

Daughter chromosomes were observed to move toward the pole faster than do the marked regions of fluorescently labeled kinetochore microtubules.

4.16 What is meant by the claim that Mendel worked with the simplest possible genetic system?

Discrete traits, two alleles, simple dominance and recessiveness, no sex chromosomes, and unlinked genes are the simplest situation known.

4.27 Which of the following is true?

Down syndrome is caused by an extra copy of chromosome 21.

3.22 Which statement is correct concerning the relationship between chromosomes and either genes, chromatin, or sister chromatids?

Each replicated chromosome consists of two sister chromatids.

2.25 Which of the following is a statement of the first law of thermodynamics?

Energy cannot be created or destroyed.

5.16 Part D Which of the following regulatory DNA sequences might be located thousands of nucleotides away from the transcription start site of a gene?

Enhancer

2.20 Which of the following statements is a logical consequence of the second law of thermodynamics?

Every chemical reaction must increase the total entropy of the universe.

1.25 Part B - Comparing RNA and DNA Sort the parts of a nucleic acid according to whether each occurs exclusively in DNA, exclusively in RNA, or in both types of nucleic acid. (see ppt)

Exclusively DNA: thymine, deoxyribose Exclusively RNA: uracil, ribose Both: adenine, guanine, cytosine, phosphate (DNA is used for storage of genetic information. The presence of deoxyribose as the sugar in DNA makes the molecule more stable and less susceptible to hydrolysis. The 2'-oxygen on the ribose found in RNA makes RNA much more susceptible to breakdown. It is important that mRNA be easily broken down, to ensure that the correct levels of protein are maintained in the cell.)

2.33 The spontaneity of a reaction depends both on the enthalpy change, ΔH, and entropy change, ΔS. Reactions that release energy produce more stable products, and the universe tends toward disorder. Thus, an exothermic reaction with a positive entropy change will always be spontaneous. Mathematically, this relationship can be represented as ΔG=ΔH−TΔS where ΔG is the change in Gibbs free energy and is the Kelvin temperature. If ΔG is negative, then the reaction is spontaneous. If ΔG is positive, then the reaction is nonspontaneous as written but spontaneous in the reverse direction

Explanation

5.16 Part C True or false? Regulatory and basal transcription factors regulate transcription by binding to the promoter.

False (Basal transcription factors do indeed bind to the promoter, but regulatory transcription factors bind to promoter-proximal elements and enhancers.)

5.16 Part F True or false? One possible way to alter chromatin structure such that genes could be transcribed would be to make histone proteins more positively charged.

False (The positive charge on histone proteins allows them to interact tightly with negatively charged DNA, thus inhibiting transcription. To disrupt this interaction, the histone proteins would have to be made more negatively charged.)

4.25 Which statement is FALSE concerning gametes produced by meiosis?

False statement: Gametes contain nonrandom combinations of maternal and paternal chromosomes. (it is random) True Statements: Gametes contain a random assortment of maternal and paternal alleles. Gametes contain a random assortment of maternal and paternal chromosomes. Gametes contain half as many chromosomes as the parent cell.

3.1 Part B - Cytokinesis in Plant cells Cytokinesis in animal cells is accomplished by constriction of the cell along the plane of cell division (formation of a cleavage furrow). In plant cells, which have cell walls, a completely different mechanism of cytokinesis has evolved. Which of the following statements are true of cytokinesis in plant cells? Select the two that apply.

Find correct answer: -The cell plate consists of the plasma membrane and cell wall that will eventually separate the two daughter cells. -Vesicles from the Golgi apparatus move along microtubules, coalesce at the plane of cell division, and form a cell plate.

3.1 Part A - Comparing chromosome separation in bacteria and eukaryotes In all cells, separation of replicated chromosomes is a prerequisite for cell division. However, the mechanism of chromosome separation in bacteria is distinct from that in eukaryotes in several ways. Sort the following statements into the appropriate bin.

Find correct answer: Bacteria Only: Chromosome separation begins at the origin of replication in DNA Eukaryotes Only: Before separation duplicated chromosomes condense; Nuclear envelope fragments, allowing chromosome separation; two copies of duplicated chromosomes are attached at centromeres before separating Both bacteria and eukaryotes: Replicated chromosomes are separated by attaching to some other structural feature in the cell; chromosomes replicate before cell division;

3.23 Which answer correctly identifies a cell-cycle checkpoint with a criterion for passing it?

G2 checkpoint: Chromosomes have replicated successfully.

4.34 Pure breeding AAbb 'dwarf' corn plants are crossed with pure breeding aaBB 'dwarf' corn plants and all of the F1 dihybrid plants are tall. When the F1 is selfed a 9/16th to 7/16th tall to dwarf is seen in the F2. From this information it can be concluded that for plants to be tall there must be a product from both the 'A' gene and the 'B' gene with each gene producing a polypeptide that together forms a functional enzyme that produces the plant growth hormone, __________.

GA

2.6 Part A - Glucose is taken up into cells through a carrier (transport) protein called a _________ transporter.

GLUT

1.22 In many animal cells, the uptake of glucose into the cell occurs by a cotransport mechanism, in which glucose is cotransported with Na+ ions. Complete the diagram below using the following steps. (see Drag and Drop on ppt)

In cotransport, the energy required to move one solute against its concentration or electrochemical gradient is provided by an ion moving into the cell down its electrochemical gradient. The ion that moves into the cell down its gradient is usually the same ion that is pumped out of the cell by an active transport pump: for example, Na+ in animal cells using the sodium-potassium pump, or H+ in plants and prokaryotes using the proton pump. In the case of the glucose-sodium cotransporter in animals, Na+ moves back into the cell down its electrochemical gradient, providing the energy for glucose to move into the cell against its concentration gradient. The energy for glucose transport into the cell is supplied indirectly by the sodium-potassium pump's hydrolysis of ATP, and directly by the Na+ electrochemical gradient created by the pump.

4.22 Which of the following occurs in meiosis but not in mitosis?

synapsis of chromosomes

1.17 Which statement best explains why a relatively small difference in the location of a carbonyl or hydroxyl group can lead to dramatic changes in the properties and function of a monosaccharide?

It changes the shape of the monosaccharide. (Monosaccharides function by interacting in precise ways with other molecules based on their shapes, so changing the spatial arrangement of functional groups can dramatically alter function.)

1.10 Which statement best describes the electrochemical gradient for chloride ions in Figure 6.20, assuming the chloride concentrations are equal on both sides of the membrane? (high concentration of Na+ (w/net + charge outside) - lipid bilayer - low concentration of Na+ (w/net - charge inside the cell)

It favors the movement of chloride ions from the inside to the outside of the cell. (Although there is no concentration gradient, the electrical gradient (net negative charge inside and net positive charge outside) favors movement of negatively charged chloride from inside to outside.)

1.21 The R-group, or side chain, of the amino acid serine is -CH2-OH. The R-group, or side chain of the amino acid leucine is -CH2-CH-(CH3)2. Where would you expect to find these amino acids in a globular protein in an aqueous solution?

Leucine would be in the interior, and serine would be on the exterior of the globular protein. (Serine with the -OH (hydroxyl) group on the end of the R group would be polar and would be exposed on the exterior of a folded protein and in contact with water (the OH group can hydrogen bond with water), whereas the leucine which contains only carbon and hydrogen would be hydrophobic and burried in the center of the folded protein.)

3.28 What would happen if the kinase that adds the inhibitory phosphate to Cdk were defective?

M phase would begin prematurely. (Inhibitory phosphorylation of Cdk normally occurs in interphase, when cyclin levels are increasing, and inhibits the Cdk subunit of MPF from prematurely catalyzing the phosphorylation reactions that trigger M phase.)

4.24 Part A - The stages of meiosis Can you recognize the eight stages of meiosis based on the location and behavior of the chromosomes? Drag the diagrams of the stages of meiosis onto the targets so that the four stages of meiosis I and the four stages of meiosis II are in the proper sequence from left to right. (Note that only one of the two daughter cells is shown for meiosis II.)

Meiosis involves two sequential cellular divisions. In meiosis I, homologous chromosomes pair and then separate. Thus, although the parent cell is diploid (containing two chromosome sets, one maternal and one paternal), each of the two daughter cells is haploid (containing only a single chromosome set). In meiosis II, the sister chromatids separate. The four daughter cells that result are haploid. (see ppt)

3.13 Part A - Initiating an action potential Under most circumstances, once an axon's membrane potential reaches threshold (about -55 mV in mammals), an action potential is automatically triggered. The graph below shows the changes in membrane potential that occur in an axon membrane that is initially at resting potential. In response to a stimulus, the membrane slowly depolarizes until the membrane potential reaches a particular value, called threshold. At threshold, a rapid depolarization of the membrane occurs and an action potential is initiated. Drag the labels onto the flowchart to show the sequence of events that occurs once the membrane potential reaches threshold. You may use a label once or not at all.

Membrane potential reaches threshold --> a. many voltage-gate Na+ channels open ---> b. Na+ rushes into the cell --> c. membrane potential rises (depolarization rapidly)

5.3 Part C Using the mRNA in Part B above, Give the polypeptide that this message would produce. 5' AUGGAGAGGUCCUCAGUCCACGUGUAA 3'

Met-Glu-Arg-Ser-Ser-Val-His-Val

2.13 Part E - Strong Reducing Agent Considering the standard reduction potential (SRP), which of the following molecules would be the strongest reducing agent? (oxidized best)

NADH (SRP -0.322 Volts) - most negative

2.13 Part C - SRP Energy Storage Considering the standard reduction potential (SRP), which of the following molecules is storing the most energy?

NADH (SRP -0.322 Volts); the most negative

2.30 What would happen to NADH levels in a cell in the first few seconds after a drug has poisoned the enzyme that converts acetyl CoA to citrate?

NADH levels would decrease (Because 6 of 10 NADH molecules produced during glucose oxidation are products of the citric acid cycle.)

2.24 Part A - Necessity of pyruvate processing Pyruvate Processing either by a fermentation reaction or by entry to the Krebs cycle and subsequent oxidative phosphorylation, is essential to prevent glycolysis from grinding to a halt. The key need for pyruvate processing is to regenrate ________________.

NADH+

2.40 Part C - Citric Acid Cycle In the citric acid cycle (also known as the Krebs cycle), acetyl CoA is completely oxidized. From the following compounds involved in cellular respiration, choose those that are the net inputs and net outputs of the citric acid cycle. Drag each compound to the appropriate bin. If a compound is not involved in the citric acid cycle, drag it to the "not input or output" bin. (Note that not all of the inputs and outputs of the citric acid cycle are included.)

Net Input: NAD+, acetyl CoA, ADP Net Output: CO2, ATP, NADH, coenzyme A Not input or output: glucose, pyruvate, O2 (In the citric acid cycle, the two carbons from the acetyl group of acetyl CoA are oxidized to two molecules of CO2, while several molecules of NAD+ are reduced to NADH and one molecule of FAD is reduced to FADH2. In addition, one molecule of ATP is produced.)

2.40 Part D - Oxidative Phosphorylation In the last stage of cellular respiration, oxidative phosphorylation, all of the reduced electron carriers produced in the previous stages are oxidized by oxygen via the electron transport chain. The energy from this oxidation is stored in a form that is used by most other energy-requiring reactions in cells. From the following compounds involved in cellular respiration, choose those that are the net inputs and net outputs of oxidative phosphorylation. Drag each compound to the appropriate bin. If a compound is not involved in oxidative phosphorylation, drag it to the "not input or output" bin. (Note that not all of the inputs and outputs of oxidative phosphorylation are listed.)

Net Input: NADH, O2, ADP Net Output: NAD+, ATP, water (H2O) Not input or output: glucose, CO2, pyruvate, coenzyme A, acetyl CoA (In oxidative phosphorylation, the NADH and FADH2 produced by the first three stages of cellular respiration are oxidized in the electron transport chain, reducing O2 to water and recycling NAD+ and FAD back to the first three stages of cellular respiration. The electron transport reactions supply the energy to drive most of a cell's ATP production.)

5.8 The lactose operon is likely to be transcribed when _____.

the cyclic AMP and lactose levels are both high within the cell

2.40 Part A - Glycolysis From the following compounds involved in cellular respiration, choose those that are the net inputs and net outputs of glycolysis. Drag each compound to the appropriate bin. If the compound is not involved in glycolysis, drag it to the "not input or output" bin.

Net Input: glucose, NAD+, ADP Net Output: ATP, pyruvate, NADH Not input or output: O2, acetyl CoA, coenzyme A, CO2 (In glycolysis, the six-carbon sugar glucose is converted to two molecules of pyruvate (three carbons each), with the net production of 2 ATP and 2 NADH per glucose molecule. There is no O2 uptake or CO2 release in glycolysis.)

5.5 When an amino acid is specified by more than one codon, what is usually shared by the set of codons that specify this amino acid?

the first and second bases

2.40 Part B - Acetyl CoA Formation In acetyl CoA formation, the carbon-containing compound from glycolysis is oxidized to produce acetyl CoA. From the following compounds involved in cellular respiration, choose those that are the net inputs and net outputs of acetyl CoA formation. Drag each compound to the appropriate bin. If a compound is not involved in acetyl CoA formation, drag it to the "not input or output" bin. (Note that not all of the inputs and outputs of acetyl CoA formation are included.)

Net Input: pyruvate, NAD+, coenzyme A Net Output: CO2, acetyl CoA, NADH Not input or output: glucose, ATP, ADP, O2 (In acetyl CoA formation, pyruvate (a product of glycolysis) is oxidized to acetyl CoA, with the reduction of NAD+ to NADH and the release of one molecule of CO2.)

2.29 Can an enzyme make a nonspontaneous reaction occur spontaneously? Why or why not?

No, because enzymes do not affect the overall ΔG of a reaction.

4.3 Mendel's rules do not correctly predict patterns of inheritance for tightly linked genes or the inheritance of alleles that show incomplete dominance. Does this mean that his hypotheses are incorrect?

No, it just means that his hypotheses are limited to certain conditions.

5.16 Part A Which of the following terms describes the DNA-protein complexes that look like beads on a string?

Nucleosome

4.17 The genes for the traits that Mendel worked with are either located on different chromosomes or so far apart on the same chromosome that crossing over almost always occurs between them. How did this circumstance help Mendel recognize the principle of independent assortment?

Otherwise, his dihybrid crosses would not have produced a 9 : 3 : 3 : 1 ratio of F2 phenotypes.

2.7 For eukaryotic cells, which answer best describes the function of the indicated component?

Peroxisome: detox center

2.6 Part C - A key enzyme in glycolysis, whose catalytic activity is controlled by feedback regulation is ____________________. This enzyme balances the need for energy with the production of ATP.

Phosphofructokinase

3.11Which statement is most accurate concerning how the molecular composition of a plant cell wall compares with the ECM of animal cells?

Plant cell wall fibers consist primarily of carbohydrates (cellulose); ECM fibers are dominated by proteins (collagen).

1.4 Which statement best summarizes a key difference in the structure of polysaccharides that function in energy storage versus those used in structural support?

Polysaccharides that function in energy storage are built from α glycosidic linkages, whereas polysaccharides used in structural support form straight chains that bond with adjacent chains. (α linkages are readily hydrolyzed to release glucose; straight chains bond to adjacent chains to form tough fibers.)

5.1 Use this information to answer the question(s) below. Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the repressor gene (lacI), along with its promoter, to a position at some several thousand base pairs away from its normal position, we would expect the _____.

the lac operon will function normally

5.9 Of the three modes of gene regulation shown in Figure 18.1, which is the fastest in response time?

Post-translational control

3.21 For the experiment shown in Figure 11.9, which answer correctly states the prediction of the "hypothesis" or "null hypothesis"?

Prediction of hypothesis: Antibodies to some membrane proteins will block cell-cell adhesion.

5.16 Part E Which of the following events in transcription initiation likely occurs last?

RNA polymerase binds to the promoter of the gene.

5.20 Suppose that an induced mutation removes most of the 5' end of the 5' UTR of an mRNA. What is most likely to happen?

Removal of the 5' UTR also removes the 5' cap and the mRNA will quickly degrade.

4.18 Which event makes meiosis a reductional division and why?

Separation of homologs in meiosis I, because it produces 2 haploid (n) daughter cells from a single diploid (2n) parent cell

4.31 For species that alternate between sexual and asexual reproduction, which statement is most accurate?

Sexual reproduction is common when environmental conditions change rapidly

2.18 Part A - Organelles of the endomembrane system The various parts of the endomembrane system serve different functions in the cell. In this activity, you will identify the roles of each part of the endomembrane system. (Drag and Drop)

Smoot ER - lipid synthesis, calcium ion storage, poison detoxification Rough ER - protein synthesis Golgi apparatus - cisternal maturation, protein modification and storage Lysosomes - atrophy, macromolecule digestion

1.2 Part A - Compare and contrast the structures and functions of starch and glycogen. How are these molecules similar? Check all that apply.

Starch and glycogen both: - consist of monomers joined by α-1,4-glycosidic linkages -used for energy storage. -consist of glucose monomers linked into a polysaccharide.

3.14 Part B Some disease-causing microbes attack the body by turning on or off specific signal transduction pathways. In the disease cholera, the bacterium Vibrio cholera causes massive diarrhea by interfering with such a pathway. A toxin from this bacterium enters intestinal cells and chemically modifies G proteins. Once modified, the G proteins can no longer cleave GTP into GDP, What would you expect to see with the intestinal cells of a person with cholera?

The G proteins remain activated and continually activate adenylyl cyclase.

2.2 Part A - Use the figure shown above of Lineweaver-Burk Plots of a mutant enzyme and a normal enzyme. Remember that when genes are mutated (change in DNA sequence), leading to changes in amino acids in the primary sturcture of the protein, this often leads to changes in the overall shape of the protein. Consider that mutant enzymes with altered shapes almost aways have lower catalytic efficiency when compared to the normal enzyme (use this information to interpret the question below). Which Plot represents the mutant enzyme?

The blue line represents the mutant enzyme since it has the higher slope and the higher Km

3.19 For the experiment shown in Figure 12.6, which answer best describes what the prediction would be if chromosome movement were based on microtubule shortening at the spindle pole?

The darkened section will move toward the spindle pole but the distance between chromosomes and the darkened section will remain constant.

1.24 What is/are the variable structure(s) of a nucleotide?

the sugar and the base (deoxyribose sugar, ribose sugar, uracil nitrogenous base, thymine nitrogenous base, adenine nitrogenous base, guanine nitrogenous base, and cytosine nitrogenous base)

1.23 How would you expect the structure of ribozymes in organisms that grow in very hot environments, such as hot springs or deep-sea vents, to differ from those in organisms that grow in cooler environments?

The hairpins would have more G's and C's in the primary structure.

3.9 How can a hormone that is present in very small quantities within the bloodstream elicit such a large response within a cell?

The message from the hormone is amplified many times within the cell.

2.33 Part B What can be said about an exothermic reaction with a negative entropy change?

The reaction is spontaneous at low temperatures. ΔG=ΔH−TΔS

2.33 Part A What can be said about an endothermic reaction with a negative entropy change?

The reaction is spontaneous in the reverse direction at all temperatures. ΔG=ΔH−TΔS

3.18 Part B - Transmission of information across the synaptic cleft All chemical synapses exhibit the same general sequence of events during the transmission of information across the synaptic cleft. This sequence is always initiated by an action potential that travels down the presynaptic cell (the sending neuron) to its synaptic terminal(s). Drag the labels onto the flowchart to indicate the sequence of events that occurs in the presynaptic cell (orange background) and the postsynaptic cell (blue background) after an action potential reaches a chemical synapse.

The sequence of events at a chemical synapse is centered around the release of neurotransmitter into the synaptic cleft, in response to an action potential in the presynaptic cell. Recall that it is the neurotransmitter that "transmits" information from the presynaptic cell to the postsynaptic cell. The following steps occur as a result of an action potential reaching a synaptic terminal of the presynaptic cell. The diagram below indicates where each step occurs in a chemical synapse. Presynaptic cell 1.Voltage-gated Ca2+ channels in the presynaptic membrane open briefly, allowing Ca2+ ions to enter the cell. 2. This higher cytosolic Ca2+ concentration in the synaptic terminal causes some synaptic vesicles to fuse with the presynaptic membrane. 3. By fusing with the presynaptic membrane, the synaptic vesicles release neurotransmitter into the synaptic cleft. Postsynaptic cell 4. The increased concentration of neurotransmitter in the synaptic cleft causes it to bind to ligand-gated ion channels in the postsynaptic membrane. As a result, the channels open. Ions may then diffuse through the channels, causing a change in the membrane potential of the postsynaptic cell. 5. Quickly, the neurotransmitter concentration in the synaptic cleft falls (due to degradation or removal), causing the release of neurotransmitter from the ligand-gated ion channels. As a result, the channels close.

5.24 Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the operator to the far end of the operon, past the transacetylase (lacA) gene, which of the following would likely occur when the cell is exposed to lactose?

The structural genes will be transcribed continuously.

1.27 Part B Sort the images according to the level of structure in the proteins shown. (see ppt)

The tertiary and quaternary structures of proteins—how they fold into their overall three-dimensional shapes, and how different protein subunits come together to interact—both ultimately depend on the primary structure, the sequence of amino acids in the proteins. A different sequence of amino acids will lead to different secondary structures and a different shape of the overall protein.

2.4 Which statement most accurately explains why ATP hydrolysis is highly exergonic?

There is a large drop in potential energy because charge repulsion is reduced

2.26 Which statement most accurately explains why ATP hydrolysis is highly exergonic?

There is a large drop in potential energy because charge repulsion is reduced, accompanied by a large increase in entropy. (Potential energy drops because ATP's four negative charges become spread between two molecules as opposed to being clustered on one molecule; products are also more disordered than reactants.)

3.16 Which statement about the daughter cells following mitosis and cytokinesis is correct?

They are genetically identical with each other and with the parent cell.

1.29 Which of the following structural features is common to cellulose, chitin, and peptidoglycan?

They can all form bonds between polymer chains that create parallel strands.

1.38 What feature of single nucleotides provides the energy needed for polymerization when nucleic acids are formed?

their phosphate groups

5.10 Of the three modes of gene regulation shown in Figure 18.1, which is the most efficient in resource use?

Transcriptional control

1.14 Starting at the 5' end, what is the base sequence of the RNA strand shown in Figure 4.3?

UAGC (see ppt for chemical image)

5.3 Part D Which amino acid in Part C above is found on the C-terminal end? Use the 3 letter code for the amino acid

Val

5.22 Part F What amino acid would be attached to the 3' end of the tRNA containing the anticodon for the third codon in the mRNA?

Val- 3'CAA5' anticodon 5'GUU3'*codon

2.11 When is the overall free energy change ΔG in a reaction most likely to be negative (meaning that the reaction is exergonic)?

When products have lower potential energy and higher entropy than reactants

4.12 In Drosophila the gene for eye color is located on ____.

X chromosome

2.24 Part E - Carbon atoms entering Krebs cycle How many carbon atoms are fed into the Krebs (citric acid)cycle as a result of the oxidation of one molecule of pyruvate?

two

4.10 Part A - The inheritance of a skin condition in humans Consider the following family history: Bob has a genetic condition that affects his skin. Bob's wife, Eleanor, has normal skin. No one in Eleanor's family has ever had the skin condition. Bob and Eleanor have a large family. Of their eleven children, all six of their sons have normal skin, but all five of their daughters have the same skin condition as Bob. Based on Bob and Eleanor's family history, what inheritance pattern does the skin condition most likely follow?

x-linked dominant

5.18 Part B - Severity of point mutations Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

a frameshift deletion at the beginning of a gene (would likely result in a early stop)

5.21 Which of the following secondary mutations might restore normal regulation to the lac operon in a lacOc mutant?

a lac I mutation that produces a repressor than can recognize the mutated lacOc DNA sequence

1.39 Which of the following descriptions best fits the class of molecules known as nucleotides?

a nitrogenous base, phosphate group, and sugar

5.19 Allosteric regulation occurs when ______.

a regulatory molecule binds to a protein to change its shape and activity

5.14 Which of the following nucleotide triplets best represents a codon?

a triplet in the same reading frame as an upstream AUG

2.24 Part C - Decarboxylation Which of the following intermediary metabolites enters the citric acid cycle and is formed, in part, by the removal of a carbon (CO2) from one molecule of pyruvate?

acetyl CoA

2.24 Part B - Transport of pyruvate The transport of pyruvate into mitochondria depends on the proton-motive force across the inner mitochondrial membrane. How does pyruvate enter the mitochondrion?

active transport (requires energy)

3.14 Part A Complete the flowchart showing the process of epinephrine signal transduction from the epinephrine receptor on liver cell membranes. Note that the hormone epinephrine is released from the adrenal glands and to help get you started the first cell in the flowchard should be filled with the statement "Adrenal Gland releases hormone"

adrenal gland releases hormone --> epinephrine binds to G protein receptor in liver cell membrane --> G protein changes shape causing dissociation of GDP --> GTP binds to G protein producing two activated complexes --> alpha complex activates enzyme adenylyl cyclase --> amplifier enzyme produces second messenger cAMP --> second messenger activates numerous protein Kinase A enzymes --> G protein is switch 'off' by converting GTP to GDP

2.6 Part D - When the ATP to ADP+AMP ratio is high (indicating high energy charge) the excess ATP binds to an _______________ site on the enzyme and the binding causes a overall shape change that prevents the binding of substrates at the acitve site. The effect of this regulation slows the production of the oxidative metabolism during times when the cell has more than enough energy carrier molecules available to fuel the endogonic biochemical work of the cell.

allosteric

2.23 A series of enzymes catalyze the reaction X → Y → Z → A. Product A binds to the enzyme that converts X to Y at a position remote from its active site. This binding decreases the activity of the enzyme. With respect to the enzyme that converts X to Y, substance A functions as _____.

allosteric inhibitor

5.13 Altering patterns of gene expression in prokaryotes would most likely serve an organism's survival by _____

allowing an organism to adjust to changes in environmental conditions

1.12 By convention, biologists write the sequence of amino acids in a polypeptide in which direction?

amino- (N-terminus) to carboxy- (C-terminus) terminus

1.32 What two functional groups are present on every amino acid?

an amino group and a carboxyl group

2.8 Canine phosphofructokinase (PFK) deficiency afflicts Springer spaniels, affecting an estimated 10% of the breed. Given its critical role in glycolysis, one implication of the genetic defect resulting in PFK deficiency in dogs is _____.

an intolerance to exercise

1.35 Proteins that interact with DNA often interact with the phosphates that are part of this molecule. Which of the following types of amino acids would you predict to be present in the DNA binding sites of these proteins?

basic amino acids

1.33 Which of the following would you expect to have the most free energy per gram? The most free energy per gram would be found in a molecule with _____.

carbon and hydrogen atoms only

1.34 Which of the following polysaccharides composes the cell wall of fungi?

chitin (Chitin is a structural polysaccharide that forms the cell wall of fungi and is also found in the exoskeleton of insects.)

1.31 A "mystery molecule" was isolated in a laboratory and scientists found that the molecule readily crossed artificial membranes. Which of the following molecules can be ruled out as the "mystery molecule?"

chloride ion (Charged molecules do not cross membranes on their own because it is energetically unfavorable for them to break their interactions with water and enter the hydrophobic interior of the membrane. Thus, a chloride ion cannot be the mystery molecule that easily crossed membranes.)

3.12 The drug cytochalasin B blocks the function of actin. Which of the following aspects of the cell cycle would be most disrupted by cytochalasin B?

cleavage furrow formation and cytokinesis

3.24 The most abundant protein found in the extracellular matrix of animal cells is _____.

collagen

4.5 know dominance

complete, incomplete, codominance, and over-dominance

2.13 Part D - Strongest Oxidizing agent Considering the standard reduction potential (SRP), which of the following molecules would be the strongest oxidizing agent? (which would be reduced the best)

cytochrome a3 (SRP +0.624 Volts) - the most positive

3.8 The division of the cytoplasm following mitosis is called _____.

cytokinesis

1.36 Which of the following includes all of the pyrimidines found in RNA and DNA?

cytosine, uracil, and thymine

2.3 Enzymes speed up chemical reactions by ____.

decreasing the activation energy

1.25 Part C - Identifying a DNA nucleotide Identify three possible components of a DNA nucleotide.

deoxyribose, phosphate group, thymine (DNA and RNA have similar structures: a pentose sugar with a nitrogenous base and a phosphate group. DNA and RNA differ in the type of pentose sugar each possesses (DNA has deoxyribose; RNA has ribose) and in one base (DNA has thymine; RNA has uracil).)

4.1 The dominant allele ____.

determines the phenotype in a heterozygote

2.12 Lysosomes that lack mannose-6-phosphate receptors _____.

do not receive enzyme shipments from the Golgi apparatus

2.13 Part A - Oxidation/reduction gain/loss Oxidation and reduction reactions are chemical processes that result in a gain or loss in _______________

electrons

5.15 Part B Which of the regulatory sequences above would be bound by transcription factors that would result in the production of uniquely different proteins in liver cell compared to muscle cells?

enhancer region

5.15 Part A Details of a Eukaryote promoter

enhancer region - site where specialized TFs bind CAAT Box and TATA Box - site where general or basal TFs bind Multiple exons and introns - I= areas removed from mature RNA

2.9 When ATP is hydrolyzed into ADP and inorganic phosphate, _____.

free energy is released (because hydrolysis is exergonic)

2.6 Part B - Immediately after Glucose enters the cell it is phosphorylated by the enzyme __________, which adds a phosphate from ATP to Glucose to produce Glucose -6- phosphate and ______________.

hexokinase,ADP

3.13 Part C - What determines how soon one action potential can follow another? The strength of a stimulus (for example, whether you feel a slight pain versus an intense pain) determines the number of action potentials sent along an axon. As the graphs show, a strong stimulus produces more action potentials spaced more closely together than a weak stimulus. The time between when a first action potential ends and a second action potential can be triggered is determined by the axon's refractory period. A second action potential cannot be triggered until the end of the refractory period. Which of the following characteristics determines when the refractory period ends?

how long it takes for the voltage-gated Na+ channels to reactivate at the end of an action potential

1.16 Humans can digest starch but not cellulose because _____.

humans have enzymes that can hydrolyze the α-glycosidic linkages of starch but not the β-glycosidic linkages of cellulose

1.19 In a DNA double helix, what kind of chemical bonds form between the complementary nitrogenous bases?

hydrogen bonds (3 hydrogen bonds form between GC base pairs and 2 hydrogen bonds form between AT base pairs.)

1.37 The condensation reaction that forms nucleic acid polymers occurs between a _____ group on the 3' carbon of one nucleotide and a 5' _____ group on a second nucleotide.

hydroxyl, phosphate (A phosphate group on the 5' carbon of the sugar forms a phosphodiester bond with a hydroxyl on the 3' carbon of a second sugar, forming a sugar-phosphate backbone.)

4.29 The statement, "It is a matter of chance which homolog goes to which daughter cell" best describes _____.

independent assortment