LS7C Final Combined

HER2+ breast cancer therapy

cancer therapy that acts in an antigonistic way by binding of estrogen to block signaling

PAM

"Photospacer Adjacent Motif" - where the complex locks on The Cas9 cuts 3bp upstream of PAM sequence (3' end) 5'-NGG-3'

Kinesin

A large family of motor proteins that uses the energy of ATP hydrolysis to move toward the plus end of a microtubule, near the edge of the cell.

nodes of Ranvier

Sites on an axon that lie between adjacent myelin-wrapped segments, where the axon membrane is exposed

resilience

if a change happens the ability to return to its original state

what are cytokines?

chemical signals that phagocytes send to recruit other immune cells to travel to the site of infection

tropic hormone

hormone that controls the release of other hormones

commensal

host benefits, no effect on microbe, or vice versa

parasite

host is disadvantaged, microbe benefits

VDJ recombination

how B cells make different kinds of antibodies -> unique antibody recognizes unique antigen - how B cells create diverse antibodies

Glucagon

A protein hormone secreted by pancreatic endocrine cells that raises blood glucose levels; an antagonistic hormone to insulin.

The three DNA fragments below are about to be sequenced using the primer 5'-CCGGG-3'. What is the 4th nucleotide in the sequencing read for first DNA fragment below? 5'-AATGGCGTCCTGATCCCGG-3' A. A B. T C. C D. G

A. A

You discover a new type of marine organism that has the kidneys of a fish but no gills. What effect would the absence of gills have on excretion of nitrogenous waste? A. Nitrogenous excretion increases at the kidneys because it cannot be lost at the gills. B. No effect. Nitrogenous wastes diffuse across the skin. C. Nitrogenous excretion decreases because no nitrogen uptake is occurring at the gills. D. No effect. Fish kidneys excrete all nitrogenous waste.

A. Nitrogenous excretion increases at the kidneys because it cannot be lost at the gills.

What happens when a cut gets inflamed? Mark A for True or B for False: This cut is infected by a pathogen

A. True

If a skeletal muscle is no longer able to make enough ATP, then: A. actin and myosin in the sarcomeres will remain bound. B. actin and myosin in the sarcomeres are in the unbound state. C. there will be low levels of acetylcholine at the motor endplate. D. the muscle will be unable to shorten.

A. actin and myosin in the sarcomeres will remain bound.

Components of the Adaptive Immune System

B cells, T cells (helper & cytotoxic)

amine hormone

-hormone that is derived from a single aromatic amino acid (such as tyrosine) -more abundant than steroid hormones + more diverse in their actions -bind on cell surface (most) -timescales of minutes to hours

steroid hormone

-hormone that is derived from cholesterol -timescales of days to months.

NHEJ

-non homologous end junction -efficient but error prone (insertions and deletions) -glue together mechanism -endogenous (meaning it is coming from the body)

steroid hormones

-nonpolar signaling molecules -endocrine signaling

hydrophilic hormones

-peptide hormones and amine hormones -nearly all these hormones bind to membrane receptors on the surface of the cell

PDGF

-platelet-derived growth factor -growth factor secreted by platelets

CAS9

-protein (enzyme) that uses CRISPR sequence as a guide to recognize AND cleave the pathogenic DNA

hemidesmosome

-type of desmosome in which integrins are the main cell adhesion molecules -EC domain binds ECM proteins -cytoplasmic domains connect to intermediate filaments

growth factor

-type of signaling molecule that causes the responding cell to grow, divide, or differentiate -typically the signal in paracrine signaling

autocrine signaling

-where signaling cell and responding cell are 1 and the same -especially important to multicellular orgs during the development of embryo

phagocytes

-white blood cell -engulf/destroy foreign cells via phagocytosis -three types: macrophages, neutrophils, dendritic cells -innate

B cells

-white blood cell -expresses antibodies -differentiate into plasma and memory cells -mature in bone marrow -adaptive immunity

mast cells

-white blood cell -releases histamines (contributor to allergic reactions and inflammation) -innate

T cells

-white blood cells -lymphocytes provided by thymus that hunt down and kill pathogens -mature in thymus -adaptive immunity

Steps to determine Microbial Diversity (16S rRNA)

1. Extract all DNA from samples 2. Sequence the DNA of 16s rRNA genes 3. Compare the sequences to a database of known bacterial sequences 4. Determine bacterial species & quantity of each species

1 megabase

10^6 bp

If 200 Na+ ions are required to enter a postsynaptic nerve cell to cause its membrane to reach threshold potential and 25 Na+ ions enter through each ligand-gated sodium channel upon binding to its stimulatory ligand, how many ligands will need to bind to their receptors in order to cause the postsynaptic cell to have an all-or-none action potential?

8

What are two similarities between B cells and T cells?

Both B cells and T cells are capable of having "memory" and both of them must be "trained" for their functions (in the bone marrow and thymus, respectively).

Where will Cas9 cut the DNA if you use a sgRNA for the boxed PAM motif? 5'ATGAGATCTCATGTACTAGTCCGTCATTACTGTACTTCTCTTGACAGGCTGTGTCGTGGAATATCTAAGAGCT 3' 3'TACTCTAGAGTACATGATCAGGCAGTAATGACATGAAGAGAACTGTCCGACACAGCACCTTATAGATTCTCGA 5'

D

Tumor 1 vs. Tumor 2 circle plot Which tumor has more SNPs? A. Tumor 1 B. Tumor 2 C. They are about the same D. Not enough information

D. Not enough information

The neurotransmitter involved with positive reinforcement in the mesolimbic system is: Chronic exposure to a neurotransmitter can lead to: Ethanol (or alcohol) affects receptors for which neurotransmitter(s): Lack of coordination resulting from errors in the speed, force, and direction of motor movements is called:

Dopamine Desensitization Dopamine, glutamate, GABA, and serotonin Aaxia

You have discovered a mutation in adenylyl cyclase that prevents it from binding the G protein. This mutation will lead to elevated cAMP levels in the absence of a signal

False

Suppose this cut gets infected by the bacterium Staphylococcus aureus. While fighting off the infection, some of your immune cells learn to recognize and "remember" this particular bacterium. Several days later, the same person gets another cut and is infected by the bacterium Streptococcus pyogens. What point on the graph (A-E) best represents the maximum response to S.pyogens?

E

How many cell membranes does a carbon dioxide molecule diffuse through to move from the cytosol of a red blood cell to the inside of an alveolus in the lungs? A. 1 B. 2 C. 3 D. 4 E. 5 or more

E. 5 or more

Describe ways in which the host can alter the microbiota and vice versa

Host: If host take antibiotics, develops new diet, the microbiota in the gut could be altered, or can come in contact, ingest, microbes Microbiota: Allows host to digest food it host cannot or microbiota can take over host systems (i.e vibrio makes smooth muscle contract)

Explain how and when the human microbiome is formed

Human microbiome is formed when we are born => human microbe is formed during birth during the birthing process, first contact with the mother=> microbes look most similar to mothers microbes sterile womb (so birthing canal = first environment w/microbes) Babies born vaginally have microbiome more similar to mother's vaginal microbiome Babies born with c-section have a microbiome more similar to mother's skin microbiome

What kind of cell-to-cell junctions would be most useful for anchoring these cells together (multicellular tissue) to form a strong tissue? A. gap junction B. tight junction C. desmosomes D. Any of the above E. None of the above

C. desmosomes

Regulates hunger/thirst, autonomic nervous system, circadian rhythms, and body temperature= Relay center for sensory input, Arousal from sleep=

Hypothalamus Thalamus

When a neurotransmitter binds to a nicotinic receptor, the ion channel opens and ________.

Na+ diffuses into and K+ diffuses out of the cell simultaneously

What is the function of acetylcholinesterase?

It catalyzes hydrolysis of ACh to remove it from the synaptic cleft.

Which of the following is/are a location of nicotinic ACh receptors?

Specific regions of the brain, skeletal muscle, Autonomic ganglia

temporal summation

Summation by a postsynaptic cell of input (EPSPs or IPSPs) from a single source over time.

low levels of iodine cause a decrease in the synthesis of:

T3 and T4, as well as thyroxine production

transposable elements

a DNA sequence that can replicate and move from one location to another in a DNA molecule

B cells

a cell type that matures in the bone marrow of humans & produces antibodies

Adherens junctions

a dense layer of proteins on the inside of the plasma membrane that attaches both to membrane proteins and to microfilaments of the cytoskeleton

LH (luteinizing hormone)

a hormone that causes the secretion of sex hormones by the testes and ovaries

Deletion

a missing region of a gene or chromosome

what are mast cells?

WBC's that release histamine (chemical messenger for allergies/inflammation)

Explain the role of model organisms in research

Want to pick one that has high conservation of the region that you want to study => usually mice

desmosomes

What kind of cell-to-cell junctions would be most useful for anchoring these cells together to form a strong tissue

What are some flaws of ChIP-sequencing?

When analyzing the frequency of different epigenetic factors at different sites, data may vary across different cell types and different cell states. Also, the threshold frequency of an epigenetic factor to be considered "significant" isn't very clear.

frog

Which animal has a heart in which oxygenated and deoxygenated blood mix

triple helical structure and bundling

collagen's strength comes from its

metagenome

collection of *genes and genomes* from a microbial community

Metagenome

collection of genes & genomes from a microbial community

metagenome

collection of genes and genomes from microbiota

Human Milk Oligosaccharides (HMOs)

component of breast milk that can NOT be broken down by host cells - can only be digested by bacteria/microbes -> necessary for infants - early microbiota => milk-oriented biota (1st food for microbes)

Genome sequencing

determining the order of nucleotide bases that make up the DNA molecule

symbiont

different organisms that live together

what is immunodeficiency? give examples.

disease where immune system does not function properly ex: allergies,

G protein-coupled receptors effects

effects tend to be rapid/short-lived, and easily reversible

final activated kinase in series

enters the nucleus where it phosphorylates target proteins (some which include transcription factors that turn on genes needed for cell division so that the cut heals)

microbiome

entire habitat including microorganisms, their genomes, and their surroundings conditions

what signal molecule is responsible for most breast cancers?

estrogen, when estrogen binds > leads to cell division

Genetic approach

evaluates the phenotypic consequence of genome variation - changing genome to a mutation to see result -> look at mutant genotype *** NOT found on genome browser -> look at mutations & conduct experiments (use reporter genes ie. GFP to meausure expression)

Action potentials can travel in both directions on the axon.

false

homology directed repair (HR)

far more precise used to introduce a very specific mutation because you have to add in the sequences you want to the gene sequences would look different than the reference sequence, but identical to each other

sympathetic NS

fight-or-flight

describe the primary response.

first encounter with an antigen, short lag before an antibody is produced bc B cells need time to differentiate into plasma cells and secrete antibodies

Resilience

ability to return to original state following strong perturbation (ie antibiotics)

The primary neurotransmitter at the neuromuscular junction is

acetylcholine.

G protein bound to GTP

active/on

what kind of cell junction must be broken for cells to metastatize?

adherens (cell-cell adhesion)

Hemidesmosomes

anchor cells to the basement membrane

what are antigens?

any molecule that leads to the production of antibodies

As long as the G protein is bound to GTP, it is in the on position

as long as the G protein is bound to GTP it is in the _______ position

desmosome

buttonlike point of adhesion that holds the p membranes of adjacent cells together -made of cadherins -connect to intermediate filaments.

cytoskeleton

internal protein scaffold In eukaryotes that helps to maintain cell shape and serves as a network of tracks for the movement of substances

When voltage-gated sodium channels are open, sodium flows _____________ the neuron making the inside of the cell more ___. This describes the _____________ phase of an action potential.

into, positive repolarization

pathogen

microbe that causes disease

Bacteroides

microbe w/ enzymes for digesting high-fiber foods (polysaccharides) into short chain fatty acids - bacteria enrich based on food preferences -> diet changes microbiome & are inherited

how is maternal milk important for the growth of the microbiome?

mother's milk contains oligosaccharides that can only be digested by bacteria so then the bacteria is able to feed the baby a form it can use

kinesin

motor protein that transports cargo TOWARD the PLUS end of microtubules

model organism

model organism which is multicellular in order to study the affect of mutation on the function of cadherin (or other cell-cell adhesions) Flies are cheap for ex. Just want to make sure a model organism has the same gene

The convergence of many presynaptic terminals onto one postsynaptic neuron is called ________.

spatial summation

in what part of the genome do most cancer mutations occur?

noncoding region

Dopaminergic neurons of the mesolimbic dopamine system originate in the midbrain and terminate in the ________.

nucleus accumbens

Pathogens

organisms & other agents that cause disease Ex: viruses, bacteria, fungi, protists, worms

Metastasis

state of tumors where individual cells can spread out to different regions of the body

hydrophobic hormones

steroid hormones

receptor-steroid complexes

steroid hormones bind to receptor proteins located in the cytosol or in the nucleus to form

describe of tamoxifen treatment works.

taximofen is a competitive estrogen receptor antagonist, binds to the cell receptors instead of estrogen

colinization resistance

healthy microbes take up space and nutrients from invading bacteria --> prevents disease/ infection stability

mutualist

host and microbes benefit

spacer region of sgRNA

region of sgRNA that hybridizes w/ complementary DNA

what is inversion?

region on chromosome reverses its orientation

Alpha Diversity

relative abundance of bacteria/ bacterial diversity within a biologic sample how many microbes are in my poop? each bar represents a biological sample each color within a bar is a different phylum of a microbe and shows relative abundance

knock out

replace a region of the gene that is long enough so it doesn't make a protein at all

what is DNA editing?

researchers can "rewrite" a nucleotide sequence of DNA so that specific mutations can be introduced into genes

Stability

resistance to change in response of shifting environmental conditions

polarized (negative)

resting membrane potential of the cell is said to be

step 1 to 2

initial inheritance of microbiota mothers milk lactose, lipids, proteins

Primary Immune response

the 1st encounter with an antigen, during which there is a short lag before antibody is produces - lag time = time required for B cells to divide & form plasma cells which secrete antibodies

When threshold is reached in a neuron, depolarization occurs with the same amplitude of potential change. This is known as ________.

the All-or-None principle

Genome

the DNA molecules that are transmitted from parents to offspring

define the genome.

the genetic material (DNA or RNA) passed from parent to offspring

proteins and chloride ions

the interior of a neuron is more negative than the outside due to the presence of

The sodium-potassium pump is involved in establishing

the resting membrane potential.

what is sanger sequencing?

uses dideoxynucleotides (chain terminators) that prevent daughter strand from growing, helpful in DNA sequencing

systole

ventricles contract

complement activation

when antibodies bind to antigens, it activates the complement system

neutralization

when antibodies prevent bacteria's function

what are autoimmune diseases? give examples.

when immune system reacts inappropriately towards itself ex: MS, type 1 diabetes

dephosphorylation

when you remove a phosphate group

low levels of calcium

would cause fewer signals to be sent between the presynaptic and postsynaptic cell

can we use the same primer for all DNA fragments when sequencing?

yes! bc they all have the same adapter to bind to

Define: phagocyte macrophage dendritic cell neutrophil mast cells natural killer cells

Phagocyte: a type of WBC that engulfs antigens/pathogens Macrophages: a standard, large sized phagocyte Dendritic Cell: a phagocyte with dendrite-like extensions Neutrophil: a phagocyte that is a first defender during infection Mast Cells: release histamine (improves blood flow) when there is injury or infection Natural Killer Cells: target and kill affected host cells

What are pathogens and what are some examples of pathogens to humans?

Pathogens are any invading microorganisms or agents that cause disease. Some examples are viruses, bacteria, and fungi.

How do phagocytes recognize pathogens and signal other immune cells?

Phagocytes have toll-like receptors (TLRs) that bind to molecules on the pathogen's surface. Phagocytes can release cytokines which can activate mast cells, WBCs, or lymphocytes.

Compare and contrast what happens during primary and secondary immune responses

Primary Immune Response: immune system has to learn to recognize antigen and how to make antibody against it and eventually produce memory lymphocytes => lag time, short lag before antibody is produced Secondary Immune Response: memory cells remember antigen and the immune system can start making antibodies immediately The response to re-exposure to an antigen, which is quicker, stronger, and longer than the primary response => produces more antibody than primary exposure and has longer duration

Imagine an animal inhales a compound that damaged the olfactory receptor cells in the olfactory epithelium that resulted in a temporary (~3 week) period of the loss of the sense of smell. After three weeks, the sense of smell returned. Based on our discussion of the sense of smell, provide an explanation as to why the loss of the sense of smell was only temporary.

The loss of smell was temporary because within the olfactory epithelium there are also basal cells present. These cells are stem cells that are able to rise to new sustentacular and olfactory receptor cells. This means even though the present olfactory receptor cells were damaged, the basal cells are able to give rise to new olfactory receptor cells, thus making the loss of smell temporary.

(Review) How is the genetic code used in translation? How is it depicted in the browser genome?

The mRNA is scanned by ribosomes from 5' to 3'. The 5' end of mRNA corresponds to the amine group end of the protein and the 3' end of mRNA corresponds to the carboxylic acid end. The mRNA, ribosomes, and the protein is all built/directed from 5' to 3'. The browser genome depicts the coding strand if transcription is left to right and the template strand if the transcription is right to left.

If more sodium ions than usual were inside the nerve cell membrane, the length of the depolarization phase of the action potential could actually increase.

True

Myasthenia gravis is a disease in which the number of acetylcholine receptors in the myoneural junction is greatly reduced. Thus compared to a normal person, a person with Myasthenia gravis might not be guaranteed to have a muscle contraction after an action potential in the alpha motor nerve cell.

True

Some neurotransmitters are inhibitory and have the purpose of preventing action potentials in post-synaptic nerve cells. One way that an inhibitory neurotransmitter might work is by binding to and opening a ligand-gated potassium channel.

True

You are studying Peptide-X, which binds and activated the glucagon receptor with much higher affinity than glucagon itself. Glycogen phosphorylase will be phosphorylated for a longer time in cells treated with Peptide-X than in cells treated with glucagon.

True

Introns

a sequence that is excised from the primary transcript & degraded during RNA splicing - thin line of genome browser

Exons

a sequence that is left intact in mRNA after RNA splicing -> regions of protein-coding sequences - thick line/box on genome browser - thickest boxes of exons= Open Reading Frame

General transcription factor

a set of proteins that bind to the promoter of a gene whose combined action => necessary for transcription

what are large scale mutations?

any chromosomal mutation! duplication, deletion, inversion, reciprocal translocation

how to determine evolutionary evidence?

if the gene is conserved (conservation= gene must be important)

Which region on the EKG corresponds to number 2 on the figure??

D

You are designing your first template for homologous recombination to insert a mutation (A→C) into Exon 1 of a gene using the CRISPR/Cas9 system. Which of the HR templates below would be a better option for this experiment?

D (No PAM Sequence)

The same red blood cell leaves the heart again, but this time instead of traveling to the liver, it travels to a skeletal muscle that is actively respiring. At each point on its journey (A - D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell. What is the approximate O2 saturation at point D? A.75% B.25% C.40% D.10% E.None of the above

D. 10%

A retrotranspon known as LINE1 is about 1000 base pairs in length and is present in the human genome in about 516,000 copies. Approximately what percentage of the human genome is accounted for by this transposon? A. 0.017% B. 0.17% C. 0.0017% D. 17% E. 1.7%

D. 17%

Suppose this cut gets infected by the bacterium Staphylococcus aureus. While fighting off the infection, some of your immune cells learn to recognize and "remember" this particular bacterium. Which immune cells are these? A. Neutrophils B. Macrophages C. Mast Cells D. B Cells E. T Cells

D. B Cells

A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. What is acting as the homeostatic sensor? A. Oxygen B. Carbon Dioxide C. Heart D. Brainstem E. Diaphragm

D. Brainstem

The new data added below shows the source of mutations for each kind of tumor. What is the most prominent source of mutations in glioblastoma tumors? A. Ultraviolet light B. BRCA1/2 mutations C. Tobacco smoke/products D. CpG deamination

D. CpG deamination

Suppose you want to model a large scale mutation. How would you use CRISPR to generate a chromosomal translocation? A. Cut double stranded DNA at one locus and use HR B. Cut double stranded DNA at one locus and use NHEJ C. Cut double stranded DNA at two loci and use HR D. Cut double stranded DNA at two loci and use NHEJ E. No silly, you can't use CRISPR for this!

D. Cut double stranded DNA at two loci and use NHEJ

In the proximal convoluted tubule, which of the following molecules is being secreted? A. Sodium B. Potassium C. Glucose D. Urea E. All of the above

D. Urea

You are curious about the mechanism of completive exclusion present in the larval zebrafish gut so you fluorescently label Vibrio and Aeromonas and run the same colonization challenge experiment as before but measure the presence of each species over a smaller time scale (hours vs. days). The results from your experiment are shown below. Based on my groups interpretation of the data and information provided, we can conclude: A. In the larval zebrafish gut, Aeromonas are able to out compete Vibrio because they were the first colonizers. B. Vibrio are able to utilize food sources present in the larval zebrafish gut better than Aeromonas C. Vibrio are able to out compete Aeromonas in the larval zebrafish gut because the zebrafish host selectively eliminates only Aeromonas D. Vibrio are able to out compete Aeromonas in the larval zebrafish gut because Vibrio are resistant to intestinal contractions

D. Vibrio are able to out compete Aeromonas in the larval zebrafish gut because Vibrio are resistant to intestinal contractions

Bisphosphoglyceric acid (BPG) is a byproduct of glycolysis released into the bloodstream when an animal's supply of oxygen is low. Like protons, it decreases hemoglobin's affinity for O2. The effect ofhigh BPG levels would be that: A. hemoglobin now binds more oxygen at low partial pressures than at high partial pressures. B. hemoglobin picks up more O2 in the lungs than it would without BPG. C. hemoglobin loses its cooperative binding of oxygen. D. hemoblobin releases more of its bound O2 than it would without BPG. E. hemoglobin holds on to more of its O2 than it would without BPG.

D. hemoblobin releases more of its bound O2 than it would without BPG.

Most nutrient absorption takes place in the: (Select all that apply.) A. stomach. B. pancreas. C. liver. D. small intestine. E. large intestine.

D. small intestine.

Knockin

DNA sequence substitution/insertion within a wild type genetic locus - uses HDR/HR

(Review) What is the central dogma of molecular biology? Define coding region vs. open reading frame.

DNA serves as a template for transcribing mRNA, which is used to translate into proteins. The coding region is the region that produces the mRNA and the open reading frame is the region that has all the codons.

antidiuretic hormone (ADH)

Hormone produced by the neurosecretory cells in the hypothalamus that stimulates water reabsorption from kidney tubule cells into the blood and vasoconstriction of arterioles. When people have to urinate post drinking alcohol, it is because alcohol inhibits the release of ADH.

Explain how we can assess the functionality of a section of DNA based on evolutionary conservation.

High levels of evolutionary conservation of particular regions of DNA (eg. promoter, enhancer, open reading frame) across different species can indicate high importance of that region.

What is the effect of having higher microbiota diversity?

Higher microbiota diversity allows for higher resistance to colonization but not necessarily higher metabolic specialization.

Microtubules

Hollow rod that is responsible for various kinds of movement across eukaryotic cells. Involved heavily in intracellular transport.

Describe the homeostasis between microbiota species themselves and between them and the host.

Homeostasis between microbiota species of the same host is when they can coexist and have specialized roles. Homeostasis between microbiota and the host is when the host's immune system recognizes its symbiotic microbiota.

Exercise might help with seasonal affective disorder (depression associated with decreasing day length) by: Inhibiting the reuptake of serotonin Increasing "will to live" (protective vigilance) by increasing the synthesis of norepinephrine Decreasing the insulin release and fat storage caused by eating lots of soluble carbohydrates Increasing circulating rather than stored nutrients and thus providing increased stimulus for serotonin release

Increasing "will to live" (protective vigilance) by increasing the synthesis of norepinephrine Decreasing the insulin release and fat storage caused by eating lots of soluble carbohydrates Increasing circulating rather than stored nutrients and thus providing increased stimulus for serotonin release

Which of the following should cause the relative membrane potential to move farther away from the threshold potential? Increasing the amount of sodium ions inside the nerve cell membrane Increasing the amount of potassium ions inside the nerve cell membrane Adding a divalent cation like Ca2+ to the inside of the nerve cell membrane Increasing the amount of Cl- inside the nerve cell membrane Allowing K+ ions to leak out of the nerve cell along their concentration gradient

Increasing the amount of Cl- inside the nerve cell membrane Allowing K+ ions to leak out of the nerve cell along their concentration gradient

Describe inflammation and why this is sometimes observed with injury

Inflammation caused by mast cells that release histamine (acts directly on blood vessels to cause vasodilation and increases permeability of blood vessel wall, so that fluid leaks out of blood vessel, carrying WBC into damaged tissue) 1. Bacteria and other pathogens enter a wound 2. Mast cells release histamine that increases blood flow (causing redness and heat) and makes blood vessels leaky (causes swelling) => histamine acts directly on blood vessels casing vasodilation, increasing blood flow to site of infection or injury => histamine causes fluid to leak out of the blood vessel, carrying white blood cells into the damaged tissue. The increased fluid in the tissue surrounding the blood vessels is visible as swelling 3. Immune system cells (such as dendrite and mast cells) recognize pathogen as foreign and release cytokines that bind to and recruit phagocytes in nearby blood vessels 4. Phagocytes enter infected site from blood and remove pathogens by phagocytosis

Discuss what constitutes a "healthy" microbiome

One that has high resilient microbiomes (fast to recover and withstand change) and has high biodiversity (many functions, able to extract more nutrients with more microbes) Healthy: high diversity => higher resilience, more function (more microbes a lot more energy utilization, because more genes for organism to utilize), high stability Not healthy: lower diversity => lower resilience, function, and stability

Pretend that the resting nerve cell has 100,000 sodium ions outside and 100 sodium ions inside and no ATP to run the Na/K pump for the moment. During the first normal action potential, which of the following is likely to be true? 50,050 sodium ions would enter during depolarization and overshoot Only enough sodium ions should enter to cause opening of nearby voltage-gated sodium channels, so maybe 1,000 sodium ions would enter During repolarization, only enough potassium ions need to leave to bring the charge on the inside of the membrane back to its normal RMP value, so the number of potassium ions leaving should be approximately equal to the number of sodium ions entering The nerve cell could not have an action potential without ATP

Only enough sodium ions should enter to cause opening of nearby voltage-gated sodium channels, so maybe 1,000 sodium ions would enter During repolarization, only enough potassium ions need to leave to bring the charge on the inside of the membrane back to its normal RMP value, so the number of potassium ions leaving should be approximately equal to the number of sodium ions entering

The normal voltage gated sodium channel: Opens at threshold potential Starts to become inactive at 0 mV but is slightly slow to fully inactivate Becomes fully inactive at the top of overshoot Resets itself to the starting position at about the same time the voltage gated potassium channel becomes fully open Would remain in the inactive state if the potassium concentration gradient did not exist, or until the Na+/K+ pump had removed enough sodium to repolarize the cell membrane

Opens at threshold potential Starts to become inactive at 0 mV but is slightly slow to fully inactivate Becomes fully inactive at the top of overshoot Would remain in the inactive state if the potassium concentration gradient did not exist, or until the Na+/K+ pump had removed enough sodium to repolarize the cell membrane

(Review) What occurs during RNA processing?

Before it leaves the nucleus as mRNA, the RNA's introns must be spliced out. A 5' cap is added and a poly-adenine tail is added at the 3' end.

How do repeated sequences in DNA complicate assembly in shotgun sequencing?

Repeated sequences, such as dispersed repeats, simple-sequence repeats, and tandom repeats, complicate assembly because they can belong to any one of the repeated segments and can lead to two incorrectly paired segments due to identical overlaps. Ideally, you want a short amount of repeats.

endocrine signaling

Specialized cells release hormone molecules into vessels of the circulatory system, by which they travel to target cells in other parts of the body.

Mark A for True and B for False Increased circulating estrogen can activate cell proliferation in HER2+/ER+ cancer cells

A. True

where does Cas9 cut?

3 nucleotides upstream of PAM (toward 5' end)

How can you use a circle plot when analyzing a genome annotation?

A circle plot is a way to organize data from genome annotation that compares a cancerous genome to a normal one. It shows ratios of segments present in cancer genomes to normal genomes (indicates duplication or deletion events) and also shows where intrachromosomal (inversions) and interchromosomal (translocations) rearrangements occur.

What is a transgenic model and what are three ways that we can create one?

A transgenic model is a model organism whose genome we altered with genetic engineering. The ways we can create one is viral delivery, lipid nanoparticle insertion, or direct DNA injection (the DNA codes for Cas9 and sgRNA).

Dynein

ATP hydrolysis drives changes in dynein shape that lead to bending of cilia and flagella. Moves toward the minus end of a microtubule, near the cell center.

Cis-regulatory modules

Adjacent to the promoter Something that affects the expression of the same gene that it is on the same chromosome with

What are copy-number variations?

CNVs are a polymorphism in humans where they differ in how many duplicated sections they have on their chromosomes.

The electrical activity that generates the normal heart beat is initiated in: The sinus cavities Cells that are naturally leaky to sodium The SA node in the right ventricle The AV node The SA node in the right atrium The central nervous system

Cells that are naturally leaky to sodium The SA node in the right atrium

Coordinates complex motor skills A role in drug addiction Cardiac, respiratory, and vasomotor control centers, Crossing of nerve tracts to the contralateral side Contains the apneustic center which aids in respiration control

Cerebellum Midbrain Medulla oblongata Pons

You have discovered a mutation in adenylyl cyclase that prevents it from binding the G protein. This mutation will cause the G protein to stay stuck in its inactive GDP-bound state.

False

What structures are involved in electrical synapses?

Gap junctions

Hyperpolarization that leads to postsynaptic inhibition is a/an ________.

IPSP

At which of the following times should the voltage-gated sodium channel be open such that sodium ions could move through it? After the application of any stimulus, Immediately after reaching threshold potential, Any time the membrane voltage is between threshold potential and 0 mV, While the membrane is repolarizing from the top of overshoot back to threshold potential, After the membrane has repolarized past threshold potential through the end of reverse overshoot

Immediately after reaching threshold potential

Microfilaments

Long, thin fibers that function in the movement and support of the cell

tight junctions

Membranes of neighboring cells are pressed together, preventing leakage of extracellular fluid. If inhibited, transport of material will increase between cells.

paracrine signaling

Signal released from a cell has an effect on neighboring cells.

Cytotoxic T cells

T cells activated by cytokines, released from helper T cells, that can kill other cells

How do lymphocytes learn to distinguish self from nonself?

T cells in the thymus must learn to recognize self-MHC proteins on epithelial cells. If they overreact or underreact to self-antigens, they are killed off. This test ensures that T cells only react to the correct MHC proteins and can tolerate self antigens. A similar process occurs for B cells in the bone marrow.

What is the C-value paradox? What is a good explanation for the paradox?

The C-value paradox says that genome size and gene number do not have a relationship with the complexity of the organism. In the case of humans, most of our genome is transposons, retrotransposons, and tandem repeats. Our genome isn't as dense with functional DNA as bacterial DNA, for instance.

Explain how the senses of body position, balance, and equilibrium would be impacted if the auditory ossicles were damaged. Provide a clear and concise rationale to support your answer.

The auditory ossicles are involved in the sense of hearing, not the senses of balance, equilibrium, and body position.

What is the correlation between number of sequences obtained and number of OTUs?

There is a positive correlation between number of sequences obtained and number of OTUs identified, but at some quantity of sequences obtained, the number of OTUs identified is saturated.

Compare chromosomal deletions and duplications. How can they be dangerous?

These large-scale mutations are exactly what they sound like. Duplications are harmful if they're excessively duplicated. Deletions are more risky as they can delete necessary genes, but they can persist in a population if the homologous chromosome has those genes.

A mutated version of P2 that cannot be phosphorylated would cause the glycogen enzyme to always be phosphorylated. T or F

True

What is the second line of defense against pathogens?

White blood cells serve as the second line of defense against pathogens. They are nonspecific and there are many types of them.

different ways to define functionality

biochemical evolutionary genetic

what are natural killer cells?

cells that recognize and kill host cells that have been infected by a virus

spatial summation

converging of multiple receptors onto a neighboring neuron increasing its firing rate proportionally to the number of signals received.

what is a microarray

copies of oligonucleotides (single-stranded DNA) bound to glass surface,

G protein bound to GDP

inactive/off

what are antibodies and where are they found?

large proteins that bind to antigens, each has unique structure that is specific to certain antigen found on B cell surface or free in blood and tissues

The suppression of neurotransmitter release from presynaptic terminals by retrograde release of endocannabinoids is called ________.

long-term depression

translocation

part of 1 chromosome breaks off and sticks to another

Adaptive (acquired) immunity

part of the immune system that is specific to given pathogens - Acquired & adapted over time -> remembers past exposures - unique to vertebrates (evolved later than innate immunity)

Innate Immunity

part of the immune system that provides protection in a nonspecific manner against all kinds of infection -> NOT dependent of previous exposure to a pathogen

metastasis

the movement of a cell which escapes tumor because unregulated cell division can escape into circulatory system and effect other tissues

We discussed three common cell-to-cell adhesion molecules in class. Name each of these three adhesion molecules. Clearly and concisely describe how each molecule allows adjacent cells to remain closely opposed to each other, be sure to identify the unique attributes of each of these molecules (that is, what is the major, fundamental attribute of each one?).

tight junctions-closely adhered, integral proteins and peripheral proteins that link adjacent cells together gap junctions- Connexon proteins form conduit that joins cytoplasm between two cells to communicate between two adjacent cells. Membranes are attached to each other. desmosomes- tight cell adhesion molecules that are linked with fiber like connections that bind to cytoskeleton.

what is the point of DNA editing?

to "rewrite" a nucleotide sequence of DNA to introduce new mutations and study gene function

The area between the pre-synaptic nerve cell and the post-synaptic muscle cell is termed the synaptic cleft.

true

The nerve impulse is an electrical current that travels along dendrites or axons.

true

a protein is phosphorylated by a kinase

typically becomes active and is switched on

cancer therapies

we can block HER2 monomer from dimerizing --> causes a stop at the very initial point of cell signaling cascade to do this can use antibodies (herceptin) block receptor sites (tamoxifen blocks estrogen receptor sites)

reference sequence

we have a single reference sequence which we align all of our sequences to ex. genome browser is a reference sequence

At point A there are no B Cells present in the blood that can bind to S. aureus

B. False

Cas9

enzyme which cleaves DNA

microbiota

*microorganisms* in a particular environment

ligand binds to G protein receptor

G protein lets go of GDP and binds to GTP

Ethanol, benzodiazepines, barbiturates and anesthetics all affect which neurotransmitter: Why does Claritin not make an individual drowsy whereby Benadryl will? The reason why cocaine and amphetamines can become so addictive is that:

GABA Benadryl crosses the blood brain-barrier. The receptors for dopamine become desensitized and now more of the drug is needed to produce the same effect.

Explain the process of shotgun sequencing. Which strands can the fragments form?

Shotgun sequencing requires multiple copies of the DNA strand of interest. Shotgun sequencing fragments many of the DNA strand copies and relies on the overlap to produce the chain. Some fragments will represent an exact copy of the reference strand and some fragments will represent the complementary strand to the reference.

Identify selective pressures present in the developing and adult microbiome

Stability - ability to resist change (resistance to shifting environmental conditions) and protection against exogenous microbes/pathogens. Resistance to change in response to shifting environmental conditions Indirect colonization resistance: microbes signal to immune system, leading host production of antimicrobial peptides, antibodies, mucous Resilience - ability to return to original state following perturbations => bounce back to original state very quickly Antibiotics kill off disease microbes, but also normal microbes (normal microbe never fully recovers). Not perfect recovery, even though there is some recovery, microbiome does not look the same after antibiotic treatment. Presence of normal microbiota important for defending against infectious diseases => antibiotics can kill these good bacteria, which can cause colonization resistance to be breached, and cause microbiota shifts (CDI)

Inflammation

physiological response of the body to injury that removes the inciting agent if present & begins the healing process - 1st response of innate immune system - good & natural response as long as it isn't overreacting -> allergies

what do B cells differentiate into?

plasma cells = secrete antibodies that bind to antigen, elicit immune response memory cells = long-lived daughters of B cells with specific antibody

faster assembling end (micro's)

plus end

what are considered small-scale mutations?

point mutations (silent, missense, nonsense) frameshift insertion of transposable elements

what is evolutionary functionality?

selective constraints (conservation of genes)

Aldosterone

"salt-retaining hormone" which promotes the retention of Na+ by the kidneys. na+ retention promotes water retention, which promotes a higher blood volume and pressure. Hydrophobic/lipid soluble in nature, it can cross the cell membrane with the help of transport proteins.

ACTH and resultant elevated cortisol

(via adrenal cortex) are healthy physiological responses that enable animals to respond to STRESSFUL situations

holobliont

*host plus* of all its microbial symbionts, including transient and stable members

Skin & mucous membranes

- 1st line of defense - acts as physical & chemical barrier & provides a home to many nonpathogenic microbes - microbes provide additional protection by competing w/ pathogens for food & space

Describe the structure and function of the CRISPR/Cas9 system and its application to human gene editing

- Cas9 is a protein that binds to a single-guide RNA (sgRNA), once bound the complex searches for a PAM sequence (5'-NGG), once it finds a PAM sequence, it binds to the opposite strand that the Pam sequence is on and if the single-guide RNA can hybridize, it does, and then Cas9 cuts the DNA (both strands) 3 nucleotides downstream from the N - The DNA is then repaired by: Non-Homologous End Joining (NHEJ) - DNA is broken, the single strand tails are removed and then ligase stitches the remaining ends back together => make/introduce mutation, deletions/insertion can cause frameshift mutations that shift ORF and cause protein to become nonfunctional, disrupt gene=> knockout Very imprecise, generally lose lots of nucleotides Good for BIG changes (large insertion or gene, translocation, etc) Homology Directed Repair (HR) - DNA is broken, single stranded tails find homologous DNA and use that as a template to recreate missing nucleotides → other single stranded tail uses newly synthesized nucleotides as a template strand → double strand back together => trick cell into using donor template by using same flanking regions, precise editing, can change sequence of genome (knockin) Much more precise Good for small mutations! 1. create complex with specific sgRNA (small guide RNA that consists of pre-designed RNA sequence complementary to right of genome want to manipulate) and CAS 9 protein (RNA-guided endonuclease enzyme that acts as pair of molecular scissors that can cut stands of DNA at specific location) 2. insert into nucleus of cell 3. resulting complex binds onto PAM sequence and unzips the DNA - must match perfectly - PAM is 5'NGG'3 (DNA sequence immediately following DNA targeted by Cas9) 4. if matches to sgRNA CAS 9 cuts DNA 3 bp upstream (in 5' direction) 5. cell repairs DNA by either - Non homologous end joining (NHEJ) - error prone, mutation that can disable gene so researchers understand its function - Homology directed repair - use repair template, how to make specific mutation, targeted mutations

necessary parts for CRISPR/Cas9 gene editing

- Cas9 protein - sgRNA (complementary) -> 2 parts: spacer & scaffold region - PAM sequence (5' NGG 3' or 5' NCC 3')

temporal summation

-frequency of synaptic stimuli -integration of sensory stimuli that are received repeatedly over time by the same sensory cell

Phagocytes

- WBCs that engulf & destroy foreign cells or particles (phagocytosis) - 3 major types: macrophages, dendritic cells, neutrophils

Mast cells

- WBCs that release histamine, an important contributor to allergic reactions & inflammation

Complement System

- collective name for certain proteins (~25) circulating in the blood that participates in innate immune function & complements other parts of the immune system - bridge between Innate & Adaptive Immune systems - 3 effects: formation of Membrane Attack Complex (MAC), Opsonization, Cell Signaling

what can be a response to cell signaling

-Cell signals are released to communicate with other cells. -Cell division is triggered. -Enzyme activities are changed. -Gene expression patterns are changed.

Components of the innate immune system

- skin & mucous membranes - phagocytes - mast cells - complement system

steps in cell signaling

-1. receptor activation -2.signal transduction -3. response -4. termination

If a postsynaptic nerve cell had a resting membrane potential of -72 mV and it received a neurotransmitter that binds to but prevents the opening of ligand-gated sodium channels, you'd expect the RMP to move to: -72 mV -80 mV Threshold potential 0 mV

-72 mV

If resting membrane potential is at -72 mV in a post-synaptic nerve cell, you'd expect that activation of a ligand-gated potassium channel would move the RMP to: -65 mV -80 mV Threshold potential 0 mV

-80 mV

Ras

-G protein w single subunit used in kinase receptor complexes -triggers activation of a protein kinase that is the 1st in series of kinases that are activated in turn, as each is phosphorylated (series of kinases=MAP kinase pathway)

antibody

-a protein found on the surface of a B cell or free floating after the B cells release them -responds to an antigen (a protein found on the surface of bacteria) -antibody will bind to a specific pathogen

Dimerization

-activates the cytoplasmic kinase domains of the paired receptors-> phosphorylate each other at multiple sites on their cytoplasmic tails -addition of phosphate groups provides places on the receptor for other proteins bind/activate

α subunit binds to/activates

-adenylyl cyclase (enzyme in the cell membrane that converts ATP into cAMP)

why are adherens junctions crucial to prevent metastasis

-adherens junctions are responsible for contact inhibition -when normal cells become in contact with each other, they will stop growing -when cancer cells grow, they don't have this function---> they grow on top of each other creating a tumor

tight junction

-band of interconnected strands of integral membrane proteins (mostly claudins/occluding) -proteins forming this junction in 1 cell bind to the proteins forming the junction in adjacent cells -connect to actin microfilaments

adherens junction

-beltlike junctional complex composed of cadherins that attaches a band of actin to the p membrane -connect to actin microfilaments

ligand-binding site bond

-bond is noncovalent -highly specific (binds only to a specific receptor)

signaling molecule

-carries info from 1 cell to the next -binds to a receptor protein on/in the responding cell -vary immensely and include peptides, lipids, and gases

integrins

-cell adhesion molecules that attach to proteins of the ECM -transmembrane proteins -cytoplasmic domain is linked to microfilaments/intermediate filaments -of many different types each binding to a specific ECM protein -also act as receptors that communicate info about the ECM to the interior of the cell

complement system

-enhances immune function -certain proteins that circulate the blood in an inactive form -activated when proteins bind to invading microorganisms -sets off a biochemical cascade 1. formation of MAC ---> cell lysis 2. opsonization ----> phagocytosis 3. cell signaling ----> inflammation -innate

cadherins

-especially important in the adhesion of cells to other cells -transmembrane proteins -extracellular domain binds to the extracellular domain of the same type on an adjacent cell -cytoplasmic portion of the protein is linked to the cytoskeleton (including microfilaments/intermediate filaments) -structural continuity from the cytoskeleton of 1 cell to that of another

microfilament

-helical polymer of actin monomers (present randomly in the cytoplasm) -that helps make up the cytoskeleton -enables movement of substances within cells + changes in cell shape

how to determine biochemical evidence?

-histone acetylation: makes histones negative so DNA is repelled and unwinds from histone which activates transcription

microtubule

-hollow/tubelike polymer of tubulin dimers -helps make up cytoskeleton -enables movement of substances within cells + changes in cell shape -In animals they radiate outward to the cell periphery

HR

-homologous repair -highly specific but not efficient -adds homologous chains -template sequence----> complementary strands----> template strand falls off ----> complementary strands bind together.

peptide hormone

-hormone that is a short chain of linked amino acids -more abundant than steroid hormones + more diverse in their actions -bind on cell surface (most) -timescales of minutes to hours

how to determine genetic evidence?

-if GFP (green fluorescent protein) is present -the more fluorescent---> the more activity

gap junction (in animals)

-let materials pass directly from cytoplasm of 1 cell to cytoplasm of another (allowing communication) -complex of integral membrane proteins (connexions) arranged in a ring -the ring connects to a similar ring of in the membrane of an adjacent cell

plasmodesma (in pants)

-let materials pass directly from cytoplasm of 1 cell to cytoplasm of another (allowing communication) -p membranes of the 2 connected cells is actually continuous -size of opening is larger than gap junctions (enough for cells to transfer RNA molecules + proteins) -allow plant cells to send signals to 1 another despite being enclosed within rigid cell walls

extracellular matrix

-meshwork of proteins and polysaccharides outside the cell -main constituent of connective tissue

myosin

-motor protein that carries cargo TO the PLUS ends of microFILAMENTS

intermediate filament

-polymer of proteins (which vary according to cell type) that form strong/cable-like filaments -provide animal cells with mechanical strength.

original function of CRISPR/Cas9 system in bacteria?

-prokaryotic immune system is able to recognize viral DNA and cleave it, thus deactivating the DNA -originally a protection mechanism -implications for humans to use in genome editing at a single nucleotide

PAM sequence

-protospacer adjacent motif -NGG where N=any nucleotide *Cas9 will not bind to or cleave the target DNA sequence if it is not followed by PAM

skin and mucous membranes

-provide first line of defense as physical barriers -innate immunity

Phosphatase

-remove a phosphate group -when a protein is dephosphorylated by this it typically becomes inactive and is switched off

Cas9/sgRNA complex?

-sgRNA is synthetically made in the lab, stands for single-guided -scaffold: sgRNA sequence necessary for Cas 9 binding -spacer: sgRNA sequence that recognize and hybridizes to target DNA *there's a different spacer for different nucleotides/regions

Cellular comm consists of 4 essential parts

-signaling cell -signaling molecule -receptor protein -responding cell

paracrine signaling

-signaling molecule can simply move by diffusion between 2 cells -signal is usually a small + water-soluble molecule such as a growth factor

what is a SNP?

-single nucleotide polymorphism -region of variability that at least 1% of the population has

basal lamina

-specialized form of ECM that underlies and supports all epithelial tissues -connects connective tissue and epithelial tissue

How many ATP molecules should be used up to repolarize a nerve cell if 90 sodium ions are allowed to enter through both the sodium leak channel and the voltage-gated sodium channel during the application of a stimulus and depolarization?

0

Match each of the following events that occur during skeletal muscle contraction with the number corresponding to their proper order in the sequence: 1- 2- 3- 4- 5- 6- 7- 8- 9- 10- 11- 12- 13- 14- 15- 16-

1- AP in sarcolemma 2- AP in t-tubules 3-Activation of DHP 4-Activation of RyR 5-Initial Ca2+ efflux from SR 6-Opening of calcium-gated RyR channles in SR 7-Additional Ca2+ efflux from SR 8-Calcium binding to troponin C 9-Rotation of tropomyosin 10-Binding of myosin to actin 11- Dropping of Pi by myosin head 12-Rotation of myosin head to 45 degrees 13-Dropping of ADP by myosin 14- Binding of ATP by myosin 15- Convsersion of ATP to ADP+Pi by myosin 16-Rotation of myosin 45 to 90 degrees

Match each of the following events of synaptic transmission of the action potential with the number corresponding to their proper order in the sequence: 1- 2- 3- 4- 5- 6- 7- 8- 9- 10-

1- Action potential reaches nerve cell terminal 2-Opening of VG Ca2+ Channels 3- Rapid influx of Ca2+ 4-Ca2+ surrounds neurotransmitter vessicles 5-NT fuse with nerve cell membrane 6- Exocytosis of neurotransmitter 7- NT diffuses across the synaptic cleft 8- NT binds to its receptor on the postsynaptic nerve cell 9- Influx of sodium through LG sodium channels 10- TP and aciton potential in postsynaptic nerve

Match each of the following structures of the heart with the number corresponding to the correct sequence with which a blood cell would pass through them starting in the liver and then eventually heading (har!) to the brain. 1- 2- 3- 4- 5- 6- 7- 8- 9- 10- 11-

1- Caudal vena cava 2- Right atrium 3-Tricuspid valve 4-Right ventricle 5-Pulmonary artery 6-Lung 7-Pulmonary vein 8-Left atrium 9-Mitral valve 10-Left ventricle 11-Aorta

Match each of the following events of the action potential with the number corresponding to their correct order in the sequence: 1 2 3 4 5 6 7 8 9 10

1- Leakiness to sodium 2-Threshold potential 3- Opening of a voltage gated sodium channel 4-Rapid influx of sodium & Depolarization 5-Inactivation of voltage gated sodium channels 6- Overshoot 7- Fully open voltage gated K+ channels; fully inactivated Na+ channels 8-Rapid efflux of potassium and repolarization 9-Resetting of voltage gated Na+ channels 10- Reverse Overshoot

Match each of the following events that occur at the myoneural junction with the number corresponding to their proper order in the sequence: 1- 2- 3- 4- 5- 6- 7- 8- 9- 10-

1-Action potential in alpha motor nerve 2-Opening of VG Ca2+ channels 3-Rapid influx of Ca2+ 4-Ca2+ surrounding ACh vessicles 5-Interaction of proteins in the vessicle with proteins in the cell membrane 6- Exocytosis of ACh 7- Diffusion of ACh across the synaptic cleft 8-Binding of ACh to LG Na+ channels 9-Conversion of ACh to acetate and choline by ACh-ase 10-Reuptake of choline by alpha motor nerve cell

Steps of Inflammation

1. Bacteria & other pathogens enter a wound 2. Mast cells release histamine that increases blood flow (causing redness & heat) & makes the blood vessels leaky (causing swelling) 3. Immune system cells in the tissue release chemical messengers (cytokines) that bind to & recruit phagocytes in nearby blood vessels 4. Phagocytes enter the infected site from the blood & remove pathogens by phagocytosis

steps of CRISPR/Cas9 gene editing

1. CRISPR sgRNA combines with Cas9 protein 2. CRIPR sgRNA guides Cas9 to target DNA -> scans for a PAM sequence (5' NGG 3') 3. if the complementary sgRNA is completely complementary -> target DNA is cleaved 4. an exonuclease widens the gap in target DNA 5. HR: the editing template is used to repair the gap in target DNA 6. the result = edited DNA with an altered sequence

CRISPR-Cas9 simple

1. Cas9 binds to a sgRNA 2. Cas9/sgRNA scan DNA for PAM sequence 3. sgRNA hybridizes with target DNA 4. Cas9 cuts target DNA (double strand break)

Steps in Activation of Adaptive Immune Response

1. Establishment of Infection- if antigen levels reach threshold -> innate immune system activates adaptive immune response 2. Inductive Phase- time where Adaptive immune system gets prepared to fight infection - transition between innate & adaptive response) 3. Effector Phase- where adaptive immunity effectively gets rid of pathogen 4. Memory Phase- next time comes into contact w/ same pathogen => stronger & quicker response

Describe the process of sequencing used to generate genome sequences

1. Fragment DNA => first break long string of DNA into smaller pieces 2. Add adapters to end of all DNA => important because we can add the same nucleotide sequence to the end of every fragment means that the same primers can be used to sequence all of the genome fragments 3. Denature fragments (each piece is separated) and are attached to a solid surface 4. Each fragment is copied (amplified) to make thousands of copies of each genomic piece => cluster of identical DNA fragments 5. Each DNA fragment is used as a template to synthesize the complementary strand. Each new nucleotide that is added has a fluorescent molecule attached, so A, T, C, and G show up as different colors under a microscope 6. Then, short sequences are put together in correct order to generate long continuous sequence of nucleotides in DNA molecule => assembly accomplished according to their overlaps (shot gun sequencing)

2 cellular repair pathways

1. Non-Homologous End Joinig (NHEJ) 2. Homology Directed Repair (HDR/HR)

order of events that occur at the post-synaptic side of a neuromuscular junction.

1. Sodium ions move into muscle cell 2. Depolarization of the post-synaptic membrane 3. Action potential is propagated over the muscle cell membrane

What are three ways we can introduce cancer into an organism to study it?

1. We can inject DNA that codes for a Cas9 and sgRNA that causes a cancerous mutation, such as one that inactivates a tumor suppressor. 2. We can isolate stem cells in a petri dish, apply CRISPR to them, then reintroduce them back into the organism. 3. We can collect a tumor sample from a biopsy to introduce it into an organism.

Presynaptic neuron order= Postsynaptic neuron order=

1. action potential conducted by axon 2. opens voltage gated Ca2+ channels (terminal boutons) 3. release of excitatory neurotransmitter 1. opens chemically (ligand) gated channels (dendrites and cell bodies) 2. inward diffusion of Na+ causes depolarization (EPSP) 3. localized, decremental conduction of EPSP 4. opens voltage-gated Na+ and then K+ channels 5. conduction of action potential

The events of neurotransmitter release from the synaptic terminal in order=

1. action potential reaches axon terminal 2. voltage-gated ca2+ channels open 3. extracellular Ca2+ enters terminal and binds to sensor protein in the cytoplasm. 4. Ca2+ protein complex stimulates fusion of the docked synaptic vesicle with the plasma membrane 5. exocytosis of neurotransmitter into synaptic cleft

process of inflammation

1. bacteria and other pathogens enter wound 2. mast cells release histamine which will allow blood flow to increase (releases heat to wound). Blood vessels become leaky from histamine release. 3. Dendritic cells release cytokines that bind to and recruit phagocytes to site of injury and flow into blood vessels 4. Phagocytes that were recruited engulf pathogens by phagocytosis *this process is innate

Steps of genome sequencing

1. break long string of DNA into tiny pieces - each piece => separated in space & sequenced individually 2. use enzyme to make thousands of copies of each genome piece 3. a mixture of special colored letters (A,T,G,C) & enzymes are added to genome you are trying to read 4. On each strand, each special colored letter binds to its complementary letter 5. take pictures of each snippet of genome 6. read sequences by seeing the order of colors present 7. sequences of millions of pieces of DNA = stitched together using computer programs to create complete sequence of entire genome 8. Interpret genome & what it means

cancer causes

1. exposure to carcinogens (tobacco, UV light, etc.) damages DNA 2. inherited mutations in risk factor genes (ex. BRCA1)

what are the 3 major actions the complement system leads to?

1. form membrane attack complex, cell lysis 2. Opsonization (phagocytosis) 3. cell signaling to cause inflammation

what are the basic steps of DNA sequencing?

1. fragment a strand of DNA 2. add the same adapters to the ends of each fragment (so primers know where to bind) 3. attach each fragment to a solid surface 4 .amplify each fragment (make copies) by PCR 5. use each fragment as a template to make complementary DNA, insert flourescent dideoxynucleotides

different ways to define functionality

1. genetic approach: evaluates the phenotypic consequence of genome variations. 2. evolutionary approach: quantifies selective constraint as a proxy for functionality. 3. biochemical approach: measures evidence for molecular activity.

Sequencing by Synthesis

1. genomic DNA --> fragment DNA (200-300 bp) small 2. add adapters to ends of all DNA 3. denature dsDNA and attach fragments to a solid surface 4. copy each fragment to make a cluster of identical DNA fragments 5. use each fragment as a template to synthesize the complementary strand; each new nucleotide which is added has a fluorescent molecule attached so A,T,C, and G show up as different colors

what are the major steps of CRISPR

1. insert sgRNA, which binds to Cas9 2. Cas9/sgRNA complex scans target DNA for PAM sequence 3. DNA sequence unwinds, sgRNA hybridizes with DNA upstream of PAM 4. Cas9 cuts target DNA (double strand break) 5. target DNA is restored by HR or NHEJ

how do cancers metastasize?

1. loss of function of tumor suppressor genes 2. gain of function of proto-ocogenes 3. needs to spread to another part of the body

3 functions of antibodies

1. neutralization 2. opsonization 3. complement activation

how do B cells create a memory of an infection?

1. population of B cells produce diverse antibodies 2. selection: foreign antigen interacts with one of the B cells 3. differentiation: B cells differentiates into plasma (released antibodies) or memory (will still have antibodies on B cells) *know graph for primary vs secondary response

describe the major steps of CRISPR.

1. sgRNA is engineered to match target DNA 2. sgRNA combines with Cas9, RNA guides Cas9 to target DNA 3. editing template of DNA (complementary to what we want to create) is inserted, matches the cleaved ends of target DNA 4. result: target DNA is edited with an altered sequence

Let's say that there are 0.5 mutations per megabase in the patient's thyroid tumor. What is the approx. mutation rate? A. 10-6 B. 10-7 C. 10-8 D. 10-9

10-8

Based on the graph below, about how much more antibody is produced in the secondary response compared to the primary response? A. 2x B. 3x C. 10x D. 100x E. 1000x

1000x

Why might a deficiency in Vitamin A contribute to reduced vision? Be specific and concise in your answer. You must explain how vitamin A fits in with the critical proteins, cells, structures, and/or compounds that impact vision, and how a reduction in available Vitamin A could result in a change in visual perception.

11-cis-retinol is derived from vitamin A. 11-cis-retinol is a key component of the photosensitive pigment Rhodopsin. Rhodopsin is important to the perception of light in eyes and is coupled with the rods of the eye. Without an adequate amount of Vitamin A the detection of light or darkness intensity will be affected. If the deviancy is great enough, this could cause night blindness or even complete blindness depending on severity.

How do we study microbes present in gut?

16S Sequencing Protocol look at specific sequences on a gene that codes for ribosomes They code for protein This region is conserved

What is the difference between 16S rRNA sequencing and metagenomic sequencing? What type of analyses (in regards to diversity) do they provide?

16S rRNA sequencing sequences DNA to identify the different microbiota species present (OTUs) and in their relative proportions. Metagenomic sequencing sequences and identifies all the genes present in the microbiota sample. 16S rRNA sequencing can measure both alpha and beta diversity but metagenomic sequencing is limited to comparing gene functions and beta diversity.

what is reciprocal translocation?

2 nonhomologous chromosomes exchange parts

how much of our DNA codes for proteins?

2%

coding regions of genome

2% codes for proteins

How many ATP molecules should be used up to restore the sodium concentration gradient after an action potential in which a total of 90 sodium ions are allowed to enter through both the sodium leak channel and the voltage-gated sodium channel during the application of a stimulus and depolarization?

30, 0

what is the PAM sequence?

5' NGG 3'

primer

5' to 3' so can only add to the 3' end in order to synthesize 5' to 3'

Which arrow points to a region of the genome with functionality supported by biochemical evidence? A B C D. More than one E. None of them

A (first point of hills)

You are excited to try your first CRISPR experiment. You decide to target the sgRNA to the genomic locus depicted in the diagram. You introduce Cas9 and sgRNA into dish of cultured human cells. You then sequence DNA from five different cells and obtain the results below. Mark A for TRUE and B for FALSE: The results below could all result from using the same sgRNA sequence.

A TRUE

What is a benign tumor? What is a malignant tumor?

A benign tumor does not spread and can be removed without worrying about it coming back. A malignant tumor can spread throughout the body via the blood or lymphatic system and can possibly come back even after removal.

Which of the following should work as an effective local anesthetic for nearly-immediate relief of pain (such as could be used for giving stitches in the dermis, for example): A drug that blocked the opening of voltage-gated sodium channels A drug that blocked the opening of voltage-gated potassium channels A drug that blocked the opening of voltage-gated calcium channels A drug that blocked the opening of ligand-gated sodium channels A drug that prevented the activity of the Na/K pump A drug that dramatically increases the size of the overshoot

A drug that blocked the opening of voltage-gated sodium channels A drug that blocked the opening of voltage-gated potassium channels A drug that dramatically increases the size of the overshoot

Which of the following should work better as a systemic anesthetic rather than a local (i.e. it should be injected into the blood rather than into the local site of the wound)? A drug that blocks the opening of voltage-gated sodium channels A drug that blocks the opening of voltage-gated potassium channels A drug that blocks the opening of voltage-gated calcium channels A drug that blocks the opening of ligand-gated sodium channels A drug that causes opening of ligand-gated Cl- channels on postsynaptic pain neurons A drug that acts as an agonist to the normal neurotransmitter A drug that prevents calcium from binding to calcium-binding proteins on neurotransmitter vesicles

A drug that blocks the opening of voltage-gated calcium channels A drug that blocks the opening of ligand-gated sodium channels A drug that causes opening of ligand-gated Cl- channels on postsynaptic pain neurons A drug that prevents calcium from binding to calcium-binding proteins on neurotransmitter vesicles

Describe the structure and function of an antibody

A large protein produced by plasma cells that binds to molecules called antigens => large protein found on the surface of B cells or free in the blood or tissues => binds to pathogen to target them for destruction Binding of antibodies to antigens is the first step in recognition and removal of pathogens => the function of an antibody is to recognize the pathogen, then recruit other cells of the immune system or activate the complement system, or prevent virus or toxin from binding to their target Y-shaped protein made up of four polypeptide chains—two identical light (L) chains and two identical heavy (H) chains, so called because of their relative molecular weights => has variable region (A region of the heavy (H) and light (L) chains of an antibody; the variable region distinguishes a given antibody from all others, the variable region is unique to each antigen that the antibody targets) and a constant region (Describes an unchanging region of the H and L chains, the same in all antibodies of a given class)

Antibody

A large protein that binds to antigens & has a specific structure - recognize pathogens, recruit other cells of immune system/ activate the complement system

Insulin

A protein hormone synthesized in the pancreas that regulates blood sugar levels by facilitating the uptake of glucose into tissues. Glycogen synthesis is blocked in both type I and II diabetes.

Suppose this cut gets infected by the bacterium Staphylococcus aureus. While fighting off the infection, some of your immune cells learn to recognize and "remember" this particular bacterium. Several days later, the same person gets another cut and is infected by the bacterium Streptococcus pyogens. What point on the graph (A-E) best represents when the first cut is initially infected by S. aureus?

A.

Consider the single-stranded DNA template below. Which of the following primers would allow you to sequence this piece of DNA? 5'-ACCACTAACGTCAGT-3' A. 5'-ACTGAC-3' B. 5'-GTCAGT-3' C. 5'-AGTGGT-3'

A. 5'-ACTGAC-3'

What type of gain of function mutations could lead to over expression of the HER2 protein? A. A mutation in the HER2 promoter. B. A mutation in the coding region of the HER2 gene. C. A mutation in a gene for the HER2 repressor protein. D. A mutation in the enhancer region of the HER2 gene.

A. A mutation in the HER2 promoter. D. A mutation in the enhancer region of the HER2 gene.

Which of the following would shut the pathway off the most quickly? A. Activating a phosphatase that targets the receptor B. Activating a phosphatase that targets glycogen enzyme C. Activating a phosphatase that targets P2

A. Activating a phosphatase that targets the receptor

In order to metastasize, cancer cells must break away from the tissue they were originally associated with. Loss of function of which of the following adhesions would most likely allow cancer cells to metastasize? A. Adherens junctions B. Gap junctions C. Hemidesmosomes D. Tight junctions

A. Adherens junctions

When a person has a few drinks containing alcohol, they often feels the need to urinate. This response suggests interplay between alcohol and antidiuretic hormone (ADH). Which of the following could explain how alcohol and ADH interact? A. Alcohol decreases the release of ADH. B. Alcohol inhibits the binding of ADH to receptors in the brain, so individuals "feel" the need to urinate. C. Alcohol increases the release of ADH. D. Alcohol facilitates the binding of ADH to receptors in the brain, so individuals "feel" the need to urinate.

A. Alcohol decreases the release of ADH.

Experimental setup: db/db & lean db/db & ob/ob ob/ob & ob/ob & lean What is your prediction: A. All experimental groups will show changes in body weight. B. Only the db / db + ob/ ob experimental group will show changes in body weight C. Only the db / db + Lean (WT) and ob/ob + Lean (WT) experimental groups will show changes in body weight D. None of the experimental groups will show changes because they all die from septic shock

A. All experimental groups will show changes in body weight.

Sensory transduction requires: A. All of these choices are correct. B. a change in membrane potential. C. reaction of a receptor protein with a stimulus. D. alteration of the conformation of a channel protein.

A. All of these choices are correct.

Dr. Bello's data What type of diversity is being evaluated? A. Alpha B. Beta C. Both D. Neither

A. Alpha

A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. Chemoreceptors on the ________ sense oxygen levels in the blood and relay this information to respiratory control centers in the brain. A. Aorta B. Pulmonary trunk C. Pulmonary vein D. Superior vena cava

A. Aorta

The ventricles finish filling with blood after the _______. A. Atria depolarize B. Atria repolarize C. Ventricles depolarize D. Ventricles repolarize

A. Atria depolarize

What happens during the P wave? A. Atria depolarize B. Atria repolarize C. Ventricles depolarize D. Ventricles repolarize

A. Atria depolarize

During a typical cardiac cycle, the atria of the heart contract ______ the ventricles contract. A. Before B. After C. At the same time as

A. Before

Which of the approaches to evaluating functionality may depend on the particular state or identity of a cell? A. Biochemical approach B. Evolutionary approach C. Genetic approach D. More than one of the above E. None of the above

A. Biochemical approach C. Genetic approach D. More than one of the above

What happens when a cut gets inflamed? Mark A for True or B for False: In addition to cells, individual proteins from the blood are helping to fight this infection

A. True

Many birth-control pills release a constant amount of synthetic estradiols and progesterone for 21 days, followed by 7 days when no hormones are ingested. Which of the following statements MOST accurately describes the effects of birth-control pills? A. Birth-control pills maintain constant levels of estrogens and/or progesterone so there is no surge in FSH and ovulation does not occur. B. The 7 days with no hormones does not allow a thick enough uterine lining to form so a fertilized oocyte cannot implant. C. Birth-control pills maintain constant levels of estrogens and/or progesterones and mask the release of the oocyte from the follicle. D. Birth-control pills inhibit the development of the uterine lining so implantation of a fertilized oocyte cannot occur.

A. Birth-control pills maintain constant levels of estrogens and/or progesterone so there is no surge in FSH and ovulation does not occur.

Which of the following statements explains why there is an elastic layer found in arteries, but not veins? A. Blood pressure is higher in arteries than veins, and the elastic layer helps maintain the structure of the artery. B. The total length of arteries in the body is more than the total length of veins, and the elastic layer helps push the blood over the longer length. C. Arteries are thicker than veins, and the elastic layer is necessary to support the additional weight of arteries. D. Valves present in veins provide a mechanism for withstanding high blood pressure flow going through veins.

A. Blood pressure is higher in arteries than veins, and the elastic layer helps maintain the structure of the artery.

One of the functions of the cardiovascular and respiratory systems is to rid the body of CO2. Where does the CO2 come from? A. CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration. B. CO2 is a breakdown product of the carbohydrates reduced in cellular respiration. C. CO2 is produced when inhaled oxygen combines with carbon atoms from carbohydrates. D. CO2 is produced when the oxygen atoms of water combine with carbon atoms.

A. CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration.

Patient A received a complete blood count while Patient B received a chemistry panel. Based on the results, which test analyzes the composition of the cellular portion of the blood? A. Complete blood count B. Chemistry panel C. No way to know

A. Complete blood count

You are developing a fever. Your core body temperature set point has just increased. As a result you... A. Feel cold and shiver B. Feel cold and sweat C. Feel hot and shiver D. Feel hot and sweat E. None of the above

A. Feel cold and shiver

The GATA1 binding data shown here was measured in adult blood cells. CRM B is an enhancer for HBG1 and HBG2. How would you expect GATA1 binding to CRM B to compare in fetal blood cells compared to adult blood cells? A. Higher B. Lower C. About the same

A. Higher

At the beginning of ventricular diastole, blood pressure in atria is _______ blood pressure in the ventricles A. Higher than B. Lower than C. The same as D. No way to know!

A. Higher than

In the figure below, panel a shows a photoreceptor and its postsynaptic cell in the dark, and panel b shows both cells in the light. What causes the change observed in this figure? A. Hyperpolarization of the rod cell in the light inhibits release of a neurotransmitter. B. Depolarization of the rod cell in the light inhibits release of neurotransmitter. C. Hyperpolarization of the rod cell in the dark causes release of a neurotransmitter. D. This figure is incorrect; dark and light are reversed.

A. Hyperpolarization of the rod cell in the light inhibits release of a neurotransmitter.

Consider the figure below. Around point F, the extracellular fluid surrounding the nephron is _______ compared to the fluid in the lumen of the nephron. A. Hypertonic B. Hypotonic C. Isotonic

A. Hypertonic

A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. When brainstem senses hypoxic conditions, the rate of ventilation will ... A. Increase B. Decrease C. Not change

A. Increase

Signals from the sympathetic nervous system cause arteriole B to constrict. As a result, the amount of blood flowing through the other three arterioles will ____________. A. Increase B. Decrease C. Not change

A. Increase

Decreased Na+ in body fluids (Na+ depletion) __________ renin secretion A. Increases B. Decreases C. Has no effect on

A. Increases

Increased osmolarity of body fluids__________ ADH secretion A. Increases B. Decreases C. Has no effect on

A. Increases

The lungs are highly branched. What is the primary purpose of this branching? A. It increases the surface area of the lungs B. It increases the volume of the lungs C. A and B are correct D. None of the above

A. It increases the surface area of the lungs

A key difference between hormonal regulation of the reproductive systems of males and females is that: A. LH and FSH are released cyclically in females but nearly continuously in males. B. LH and FSH are released only in females. C. LH and FSH are released only in males. D. LH is released in males and FSH is released in females. E. LH is released continuously in males and FSH is released cyclically in females.

A. LH and FSH are released cyclically in females but nearly continuously in males.

What happens when a cut gets inflamed? What kind of cell is most directly responsible for the inflammation observed in this cut? A. Mast Cell B. Neutrophil C. Macrophage D. B Cell E. T Cell

A. Mast cell

Dr. Bello's Data If I increased the amount of sequences evaluated in a sample (independent variable; x- axis). Would I expect to detect... A. More bacterial species. B. Fewer bacterial species. C. What is sequencing?

A. More bacterial species

Where does most of the food we eat get digested? A. Mouth, Stomach, and Small Intestine B. Stomach C. Small Intestine D. Large Intestine

A. Mouth, Stomach, and Small Intestine

When stomach acid reaches the duodenum, it triggers the release of bicarbonate ions, which increase the pH of the duodenum. This is an example of: A. Negative feedback B. Positive feedback C. Neither; this is not a feedback system

A. Negative feedback

When compared to the leg muscles of an Olympic sprinter, the muscles of an Olympic marathoner would likely show a greater proportion of oxidative slow-twitch fibers. A. True B. False

A. True

Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement

A. Net movement to the right

The HER2 protein is a type of epidermal growth factor receptor, which when activated promotes cell proliferation. What type of gene is HER2 ? A. Proto-oncogene B. Tumor suppressor gene

A. Proto-oncogene

You are studying the function of two different noncoding regions of the genome. You conduct a reporter assay to test how these regions affect expression of GFP and you obtain the results shown below. Which region(s) is (are) supported by genetic evidence of functionality? A. Region 1 B. Region 2 C. Both region 1 and 2 D. Neither region 1 and 2

A. Region 1

Fish deal with similar issues. If a saltwater fish were unable to regulate chloride - what would happen? A. The fish would swell with water. B. Nothing, sodium would still be actively secreted. C. The fish would find fresh water to live in. D. The fish would loose water and shrivel up.

A. The fish would swell with water

Compare the results for thyroid tumors and glioblastoma tumors. Which tumors vary more in mutation number? A. Thyroid B. Glioblastoma C. They are roughly the same

A. Thyroid

Depolarization and repolarization... sounds like we're talking about action potentials. Do muscles have action potentials? A. Totally! B. No way! C. How should I know?

A. Totally!

Consider the genome browser data associated with TP53. Do any of these tracks provide biochemical evidence for functionality? A B C A. Track A -Layered H3K27Ac histone acetylation B. Track B- Conservation among 100 vertebrates C. Track C - Conservation among selected vertebrates D. More than one of the above E. None of the above

A. Track A -Layered H3K27Ac histone acetylation

All six reads map to this genome reference sequence. A. True B. False

A. True

Circle plots show changes in cancer genomes vs. the reference genome A. True B. False There is a sequencing read from this tumor genome that maps to both chromosome 17 and chromosome 9 of the reference genome

A. True

Experimental setup: db/db & lean db/db & ob/ob ob/ob & ob/ob & lean Based on these results, it can be concluded that db / db mice do not produce the hormone leptin. A. True B. False

A. True

Experimental setup: db/db & lean db/db & ob/ob ob/ob & ob/ob & lean Based on these results, it can be concluded that db/db mice lack the receptor for the hormone leptin.

A. True

Experimental setup: db/db & lean db/db & ob/ob ob/ob & ob/ob & lean Mark A for True and B for False. Is this an accurate null hypothesis: None of the experimental groups will exhibit changes in body weight.

A. True

For your summer internship you decide to help farmers characterize the microbiotas of their pigs. Below is a graphical representation of the diversity observed after sampling and sequencing the microbiotas present in the small intestine (jejunum and ileum) and large intestine (cecum) of their fattest pigs. Reference the data presented below to address the following statement. Points that cluster together have greater 16s rRNA gene sequence similarity than points that are farther apart. A. True B. False

A. True

Mark A for TRUE and B for FALSE: The Cas9-sgRNA complex must separate double stranded DNA in order to carry out its function.

A. True

Mark A for True and B for False Aromatase inhibitors would reduce the proliferation of HER2+/ER+ cancer cells.

A. True

Mark A for True and B for False During the ovarian and menstrual cycles, females exhibit rapid proliferation of cells in breast and uterine tissues.

A. True

One of the roles of the kidneys is to help buffer body fluids so that they are not too acidic or too basic. The cells of the renal tubule secrete H+ into the tubule lumen, and absorb bicarbonate (HCO3-), passing it into the tissue fluid. Consider the reaction catalyzed by the enzyme carbonic anhydrase, shown in the accompanying figure and below. During heavy exercise, the reaction shifts to the right in the nephron (lumen of the tubule). A. True B. False

A. True

Patient B likely exhibits some swelling of the body tissues ("edema") due to an osmotic imbalance in his blood. A. True B. False

A. True

Patient B's blood pH is buffered by the appropriate amount of bicarbonate A. True B. False

A. True

The graph provides a quantitative (numerical) representation of types of bacteria present in a sample Mark A for True or B for False: The data presented below is a measure of alpha diversity.

A. True

The osmolarity of tissue fluids surrounding the nephron is higher at point D than at point G. A. True B. False

A. True

Use the data provided below to answer the following question: Children with recurrent tonsillitis have microbiomes that are more similar to other children with recurrent tonsillitis than healthy adults. A. True B. False C. Cannot be determined

A. True

What about TP53? Mark A for True or B for False: The exons of TP53 are more highly conserved across vertebrates than the introns.

A. True

Consider the figure below showing an EKG trace below the typical action potential for the sinoatrial node. Note: You haven't seen the action potential for the pacemaker cells in the text. Ventricular diastole occurs at the interval labeled 3 on the graph. A. True B. False Atria are emptying at the interval labeled 4 on the graph. A. True B. False

A. True A. True

Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. Circulating levels of aldosterone will increase. true false Circulating levels of renin will decrease. true false The sympathetic nervous system stimulates the adrenal glands. true false Water absorption by the distal convoluted tubule will decrease. true false Circulating levels of angiotensin II will increase. true false

A. True B. False A. True B. False A. True

Tumor 1 vs. Tumor 2 circle plot Which tumor has more chromosomal rearrangements? A. Tumor 1 B. Tumor 2 C. They are about the same D. Not enough information

A. Tumor 1

The runner begins to experience a headache, and their body temperature has risen slightly. The first aid station gives them water thinking they have heat stroke The runner's headache will get A. Worse B. Better C. Stay the same

A. Worse

Dr. Bello's Data Which group has the most bacterial species diversity? A. Yanomami B. Guahibo C. Malawi D. US

A. Yanomami

What are desirable characteristics for a gas exchange surface, such as the endothelial cells lining the inside of lung? (Select all that apply.) A. a large surface area B. a small surface area C. a thickness of 100 micrometers D. a thickness under 10 micrometers

A. a large surface area D. a thickness under 10 micrometers

A decrease in cell adhesion, by the introduction of an experimental substance to a tissue, compromises the structural integrity of the tissue. Which cell junction would MOST likely be affected by this treatment causing a decrease in the strength of the tissue? A. adherens junctions B. hemidesmosomes C. tight junctions D. gap junctions

A. adherens junctions

A decrease in cell adhesion, by the introduction of an experimental substance to a tissue, compromises the structural integrity of the tissue. Which cell junction would MOST likely be affected by this treatment causing a decrease in the strength of the tissue? A. adherens junctions B. gap junctions C. hemidesmosomes D. tight junctions

A. adherens junctions

Carbonic anhydrase inhibitors are commonly prescribed to treat glaucoma. A side effect could be ___________ in stomach pH. A. An increase B. A decrease C. No changeS

A. an increase

Kisspeptin is a protein in humans that has an important role in initiating secretion of the releasing factor gonadotropin-releasing hormone (GnRH). Endocrinologists are finding that the protein kisspeptin and its receptor are central to sexual maturation at puberty. Neurons that release kisspeptin carry estrogen receptors. If this is a negative feedback system, high levels of estrogen would be expected to: A. decrease kisspeptin synthesis. B. neither increase nor decrease kisspeptin synthesis because steroid hormones do not affect protein synthesis. C. increase kisspeptin synthesis.

A. decrease kisspeptin synthesis.

During certain stressful moments, some individuals will begin to hyperventilate—that is, their breathing will be very shallow and quick. A by-product of hyperventilation is much lowered levels of CO2 in the blood. Which of the following would you also expect to find? (Select all that apply.) A. decreased stimulation of chemoreceptors in the brainstem B. decreased blood pH, less than 7.2. C. increased stimulation of chemoreceptors in the brainstem D. increased blood pH, greater than 7.2

A. decreased stimulation of chemoreceptors in the brainstem D. increased blood pH, greater than 7.2

Bisphosphoglyceric acid (BPG) is a byproduct of glycolysis released into the bloodstream when an animal's supply of oxygen is low. Like protons, it decreases hemoglobin's affinity for O2. The effect ofhigh BPG levels would be that: A. hemoblobin releases more of its bound O2 than it would without BPG. B. hemoglobin now binds more oxygen at low partial pressures than at high partial pressures. C. hemoglobin picks up more O2 in the lungs than it would without BPG. D. hemoglobin holds on to more of its O2 than it would without BPG. E. hemoglobin loses its cooperative binding of oxygen.

A. hemoblobin releases more of its bound O2 than it would without BPG.

Sometimes while traveling, people are infected with a protist parasite, Giardia. One of the side effects of Giardia infection is diarrhea. When someone has diarrhea, they lose excessive water and salt from the body. The result is loss of Na+, dehydration that leads to decreased extracellular volume and plasma volume, and decreased arterial blood pressure. Given this would the vasopressin secretion of a person infected with Giardia: A. increase B. decrease C. stay the same

A. increase

In many cells, the adhesion to the extracellular matrix through integrins causes the activation of kinases in the cytoplasm. This suggests that:

A. integrins promote the activation of signal-transduction pathways

In many cells, the adhesion to the extracellular matrix through integrins causes the activation of kinases in the cytoplasm. This suggests that: A. integrins promote the activation of signal-transduction pathways. B. extracellular matrix proteins are receptors and integrins are ligands. C. integrins are kinases.

A. integrins promote the activation of signal-transduction pathways.

The random thermal motion of molecules from a region of higher concentration to a region of lower concentration is called diffusion. The rate of diffusion across a barrier is defined by Fick's law of diffusion: Rate of diffusion = k * A * (C2 -C1) / L k = diffusion coefficient, which depends on solubility and temperature A = surface area for exchange C2 - C1 = difference in partial pressure of gas on either side of the barrier L = thickness of the barrier to diffusion In the design of respiratory systems, respiratory membranes 1 and 2 represent membrane barriers between the outside medium and the inside of the organism. 9. Which would have the higher rate of diffusion, respiratory membrane 1 or respiratory membrane 2? A. respiratory membrane 2 B. respiratory membrane 1

A. respiratory membrane 2

Which of the following would result in tetanus? A. stimulating the muscle fiber so frequently that it cannot relax at all B. stimulating a muscle fiber to contract when it has partially relaxed C. All of these choices are correct. D. stimulating a muscle fiber to contract immediately after it has relaxed E. allowing a muscle fiber to relax for several seconds between twitches

A. stimulating the muscle fiber so frequently that it cannot relax at all

Figure 9.15 shows how normal signaling works with a Ras protein acting downstream of a receptor kinase. You examine a cell line in which Ras is always activated even in the absence of a signaling molecule. This causes constant activation of the kinases in the MAP kinase pathway. Which of the following conditions would be MOST likely to turn off this abnormally active signaling pathway? A. the addition of a drug that prevents the final kinase from interacting with its target protein in the nucleus B. the addition of a drug that prevents the dimerization of the receptor kinase C. the addition of a drug that increases the binding affinity of Ras for MAP kinase enzymes in the cytoplasm D. the addition of a drug that prevents the phosphorylation of the receptor kinase

A. the addition of a drug that prevents the final kinase from interacting with its target protein in the nucleus

Referring to Figure 10.14, identify which type of cell-cell interaction is most likely to force the products of digestion to be absorbed across microvilli of intestinal cells rather than allowing them to leak between cells. A. tight junctions B. hemidesmosomes C. gap junctions D. plasmodesmata E. desmosomes

A. tight junctions

Refer to the figure if needed to complete the following: The transduction of sound waves to changes in membrane potential takes place: A. when stereocilia bend against the tectorial membrane, causing hair cell depolarization. B. as the vibrations received by the outer ear cause the eardrum to vibrate. C. within the tectorial membrane as it is stimulated by the hair cells. D. in the basilar membrane as it vibrates at different locations. E. in the oval window, which vibrates at the same frequency as the original sound.

A. when stereocilia bend against the tectorial membrane, causing hair cell depolarization.

A red blood cell has just left the right ventricle of the heart. It travels to the lungs, back to the heart, to the liver, and then back to the heart again. At each point on its journey (A-D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell. (You may assume the pH of the blood is 7.4.) What is the approximate O2 saturation at point D? A.75% B.30% C.40% D.10% E.None of the above

A.75%

Potassium chloride was once used as a local anesthetic. Which of the following might be a mechanism of K+Cl- to decrease transmission of action potentials across a nerve cell membrane? Adding potassium to the extracellular fluid could cause more potassium than usual to move inside the cell during repolarization, thus moving RMP and TP farther apart Extra potassium on the outside of the nerve cell would make the outside of the cell more positive than normal, thus lowering the threshold potential Potassium efflux is required to open VG Ca2+ channels at the nerve cell terminal; thus with too much potassium outside the nerve cell membrane there would be much less potassium efflux and reduced opening of VG Ca2+ channels and less likelihood of neurotransmitter exocytosis Added potassium on the outside of the nerve cell membrane would prevent repolarization, and thus the nerve cell would no longer have action potentials because VG Na+ channels would remain inactivated

Added potassium on the outside of the nerve cell membrane would prevent repolarization, and thus the nerve cell would no longer have action potentials because VG Na+ channels would remain inactivated

Choose any of the following that should cause the relative membrane potential to move closer to the threshold potential: Allowing sodium ions to move into the cell, Adding increased numbers of potassium ions to the inside of the cell, Adding more sodium ions to the outside of the cell, Adding more potassium ions to the outside of the cell, Adding more chloride ions to the inside of the cell , Reducing the number of potassium ions inside the cell.

Allowing sodium ions to move into the cell, Adding increased numbers of potassium ions to the inside of the cell.

Explain how the process of VDJ recombination leads to the production of a diverse set of antibodies

Allows there to be various different genetic combinations for antibodies, allows antibodies to diversify, it is how B cells make different kinds of antibodies The process of joining different gene segments as a B cell differentiates to produce a specific antibody => as B cells differentiate, different gene segments are joined and this produces specific antibodies => An antibody gene is assembled by recombining a single copy of each of these segments (two gene segments, which they called the V (variable) and C (constant) segments) => Antibody genes are assembled by recombination of individual gene segments, providing a mechanism for generating antibody diversity As a result of genomic rearrangement, the DNA in each mature B cell is different from the DNA in every other mature B cell and different from the DNA in other cells in the body

Differentiate between alpha diversity and beta diversity

Alpha diversity => quantitative measure of different microbes present in a sample, graph uses OTUs on its y-axis, tell you how many unique species of bacteria there are and what species they are in one unique sample 1 sample, looking at qualitative differences (different species, comparing #s), measure of quantity and diversity of microbes Beta diversity => multiple samples, looking at similarities in function (PCA2), relatedness of certain microbes - each dot represents a sample Look at differences between microbes from one sample to another sample qualitative measure of how similar or different microbiome communities are across different samples, use PC2 and PC1 (Principle Coordinate Analysis (PCoA): Method to visualize similarities versus differences between large datasets from multiple samples, all different raw values of OTUs that cluster similar to each other) For Beta diversity can also use to show abundance of certain phyla (different bacteria) in relation to different body parts

What does alpha diversity data look like? What does beta diversity data look like?

Alpha diversity measures diversity in samples based on OTU count composition. Alpha diversity is very quantitative and explicit. Beta diversity measures diversity between samples based on gene types or PC grids (that are obtained by comparing 16S rRNA data).

(Review) Describe the chemical properties of amino acids and proteins.

Amino acids are sp3 carbons with a hydrogen, a primary amine (5'), and a carboxylic acid end (3'). Proteins are polypeptides of amino acids that can have primary, secondary, tertiary, or quaternary structures. There structures (and thus functions) must operate within a certain pH and temperature.

sensory neuron (somatic neurons) afferent neuron

An afferent neuron that conducts impulses from peripheral sensory organs into the CNS, where they may synapse with association neurons that transmit the signal within the CNS. conduct impulses toward CNS

motor neuron efferent neuron The motor neurons in the autonomic ganglia

An efferent neuron that conducts action potentials or impulses away from the central nervous system to effector organs or cell (muscles and glands). It forms the ventral roots of spinal nerves. conduct impulses away from the CNS

protein kinase

An enzyme that transfers phosphate groups from ATP to a protein, thus phosphorylating the protein.

Desmosomes

Anchoring junctions that prevents cells subjected to mechanical stress from being pulled apart; button like thickenings of adjacent plasma membranes connected by microfilaments.

Describe the structure and properties of antibodies.

Antibodies are produced by B cells and can be either bound to them or secreted. Antibodies have constant protein chains and variable protein chains. Each B cell has a unique antibody.

What are the three main things that antibodies can do?

Antibodies can neutralize pathogens, opsonize pathogens, or trigger the complement system proteins.

When and how do human babies obtain their first microbiota?

Assuming that the womb is completely sterile, babies obtain their first microbiota during childbirth. If it is conventional birth, then the child receives microbiota from the mother's vagina. If it is a C-section birth, then the child receives microbiota from the mother's skin.

Which type of neuroglia supports the metabolic needs of the blood-brain barrier?

Astrocytes

Which arrow points to a transcribed region of the genome? A B C D. More than one E. None of them

B (region between big hills and small hilL)

Mark A for TRUE and B for FALSE: 5'ATGAGATCTCATGTACTAGTCCGTCATTACTGTACTTCTCTTGACAGGCTGTGTCGTGGAATATCTAAGAGCT 3' 3'TACTCTAGAGTACATGATCAGGCAGTAATGACATGAAGAGAACTGTCCGACACAGCACCTTATAGATTCTCGA 5' The same sgRNA sequence can be used with all three of these PAM sites

B False

You hypothesize that mice with microbes have less body fat than mice without microbes. You conduct a follow-up experiment, the results of which are shown below. What can you conclude from these data? A. The data support the hypothesis B. The data refute the hypothesis C. The data don't provide enough information to support or refute

B. The data refute the hypothesis

A retrotransposon known as Alu1 is about 300 base pairs in length and is present in the human genome in about 1 million copies. Approximately what percentage of the human genome is accounted for by this transposon? A. 0.1% B. 10% C. 1% D. 30% E. 0.03%

B. 10%

Your computer records the raw sequencing data shown below. How many different sequences are represented in this dataset? A. 1 B. 2 C. 3 D. 4 E. 5 or more

B. 2

The three DNA fragments below are about to be sequenced using the primer 5'-CCGGG-3'. How many different sequencing reads will be recorded by this sequencing reaction? 5'-AATGGCGTCCTGATCCCGG-3' 3'-GGCCCGTTATCAGTGGTAA-5' 5'-CCGGGATCAGGACGCCATT-3' A. 1 B. 2 C. 3 D. More than 3 E. No way to know

B. 2 3'-GGGCC-5' 5'-CCGGG-3'

Which sequence could you use for your sgRNA? A. 5' AGTAATGACATGAAGAGAAC 3' B. 3' AGTAATGACATGAAGAGAAC 5' C. 5' TCATTACTGTACTTCTCTTG 3' D. 3' TCATTACTGTACTTCTCTTG 5'

B. 3' AGTAATGACATGAAGAGAAC 5'

How many exons are in this gene model? A. 9 B. 7 C. 6 D. 5 E. None of the above

B. 7

Which term in the equation above is different between respiratory membranes 1 and 2? A. C2 - C1 B. A C. L D. k

B. A

A common ER+ cancer therapy drug (Tamoxifen) Inhibits the activation of estrogen receptor. Which of the following is most likely NOT the function of the Tamoxifen? A. A molecule that tags the estrogen receptor for degradation. B. A competitive agonist to estrogen receptors. C. A competitive antagonist to estrogen receptors. D. A molecule that binds to estrogen receptor mRNA and prevents translation.

B. A competitive agonist to estrogen receptors.

A common HER2+ cancer therapy drug (Herceptin) utilizes a protein that inhibits the activation of the receptor tyrosine kinase HER2. Which of the following is most likely the function of the Herceptin protein? A. A protein that binds the intracellular portion of the HER2 protein dimers B. A protein that prevents the dimerization HER2 proteins C. A protein that competitively binds the HER2 promoter D. A protein that competitively binds the HER2 enhancer

B. A protein that prevents the dimerization HER2 proteins

Dr. Bello's data What type of microbial diversity is depicted here? A. Alpha B. Beta C. Both D. Neither

B. Beta

How does blood pH at muscle tissue compare to blood pH at the lungs? A. Blood pH is higher at the muscle B. Blood pH is lower at the muscle C. Blood pH is the same at the muscle

B. Blood pH is lower at the muscle

If a mutation occurred in the cadherin gene so that the cytoplasmic region no longer attached to the cytoskeleton, which of the following would occur? A. Cadherins in adherens junctions would no longer be anchored to microtubules B. Cadherins in desmosomes would no longer be anchored to intermediate filaments C. Cadherins in desmosomes would no longer be anchored to microfilaments.

B. Cadherins in desmosomes would no longer be anchored to intermediate filaments

If a mutation occurred in the cadherin gene so that the cytoplasmic domain no longer attached to the cytoskeleton, which of the following would occur? A. Cadherins in adherens junctions would no longer be anchored to microtubules. B. Cadherins in desmosomes would no longer be anchored to intermediate filaments. C. Cadherins in hemidesmosomes would no longer be anchored to intermediate filaments. D. Cadherins in desmosomes would no longer be anchored to microfilaments.

B. Cadherins in desmosomes would no longer be anchored to intermediate filaments.

During a typical cardiac cycle, cell depolarization triggers muscle _______ and repolarization triggers muscle ________. A. Contraction; contraction B. Contraction; relaxation C. Relaxation; contraction D. Relaxation; relaxation

B. Contraction; relaxation

ACE inhibitors are drugs that inhibit an enzyme called ACE that converts angiotensin I into angiotensin II. Treatment with an ACE inhibitor will cause blood pressure to _________. A. Increase B. Decrease C. Stay the same

B. Decrease

If carbonic anhydrase stopped working, the amount of oxygen delivered to systemic tissues would _________. A. Increase B. Decrease C. Not change

B. Decrease

When the volume of blood passing through the kidney increases, renin production by the kidney will most likely _________. A. Increase B. Decrease C. Stay the same

B. Decrease

A climber is scaling Mt. Everest. As her elevation increases, the average amount of oxygen bound to the hemoglobin in her red blood cells ________. A. Increases B. Decreases C. Does not change

B. Decreases

Increased ADH secretion__________ urine output A. Increases B. Decreases C. Has no effect on

B. Decreases

16s rRNA sequencing utilizes RNA to identify microbial species present in a microbiota sample. A. True B. False

B. False

All of the reads are identical to the reference genome sequence. A. True B. False

B. False

All of these fragments have different nucleotide sequences! The same primer could be used to sequence all of the DNA fragments shown here. A. True B. False

B. False

All protein-coding regions of the genome have genetic, evolutionary, and biochemical evidence supporting their function.

B. False

Cas9 recognizes the PAM sequence 5'-NGG-3' where "N" denotes any nucleotide. There are millions to billions of PAM sequences present throughout the human genome. Mark A for True or B for False sgRNA can hybridize with DNA next to any of these PAM sequences.

B. False

Circle plots show changes in cancer genomes vs. the reference genome A. True B. False This tumor has more rearrangements in chromosome 10 than in chromosome 20

B. False

Circle plots show changes in cancer genomes vs. the reference genome A. True B. False This tumor probably has an extra copy of chromosome 8

B. False

Dr. Bello's data Surprisingly, the Yanomami tribe have similar microbiomes to the US. A. True B. False C. Cannot be determined.

B. False

Experimental setup: db/db & lean db/db & ob/ob ob/ob & ob/ob & lean Based on these results, it can be concluded that db / db mice do not make the hormone leptin. A. True B. False

B. False

For your summer internship you decide to help farmers characterize the microbiotas of their pigs. Below is a graphical representation of the diversity observed after sampling and sequencing the microbiotas present in the small intestine (jejunum and ileum) and large intestine (cecum) of their fattest pigs. Reference the data presented below to address the following statement. Each point on the graph above represents one microbial species present in the either the small intestine or the large intestine. A. True B. False

B. False

From the information provided, mutations in this breast cancer-associated gene tend to be primarily synonymous substitutions. A. True B. False

B. False

Mark A for TRUE and B for FALSE Cas9/ sgRNA can hybridize with target DNA if the scaffold region of sgRNA is mutated

B. False

Mark A for TRUE and B for FALSE Changing the spacer sequence of sgRNA makes the Cas9-sgRNA complex unable to cleave DNA

B. False

Mark A for True and B for False Males and females both exhibit constant estrogen hormone levels

B. False

Patient A's blood will likely exhibit difficulty clotting. A. True B. False

B. False

Person 1 has bacteria from all 5 phyla including Tenericutes and Bacteroidetes. Person 2 only has bacteria from 3 phyla Person 2 contains a greater alpha diversity than person 1. A. True B. False

B. False

Regions of the genome with higher tumor/normal cell read copy ratios are more likely to be associated with intrachromosomal rearrangements. A. True B. False

B. False

Small mutations are usually found in the protein-coding regions of the genome. A. True B. False

B. False

Stimulation by the parasympathetic nervous system increases the permeability of the SA node to potassium ions, whereas stimulation by the sympathetic nervous system decreases the permeability of the SA node to this same ion. A. True B. False

B. False

Suppose two patients have inherited mutated copies of BRCA1 and have developed breast cancer. You collect tumor samples from each patient and look at the mutations. Mark A for True or B for False: If they have children, these patients can pass all of the new tumor mutations on to their offspring.

B. False

Suppose two patients have inherited mutated copies of BRCA1 and have developed breast cancer. You collect tumor samples from each patient and look at the mutations. Mark A for True or B for False: These tumors will have mostly the same mutations.

B. False

The arrow in the figure below, pointing at an "empty space", represents sequences that are missing from the reference genome. A. True B. False

B. False

The cells around region B use more ATP than those in region G. A. True B. False

B. False

The loop of Henle is a countercurrent exchanger because it creates a concentration gradient rather than simply maintaining it. A. True B. False

B. False

The majority of tumor mutations occur in protein - coding regions of the genome. A. True B. False

B. False

The marathon runner's muscles aren't working well, you determine it is not due to fatigue. They have been drink water at each watering station. They are still dehydrated and should drink water. A. True B. False

B. False

The pulmonary vein carries deoxygenated blood. A. True B. False

B. False

Three memory B Cells are circulating in the blood stream of a patient. Each memory cell recognizes a different pathogen. Mark A for True or B for False: These three cells have identical DNA sequences

B. False

Using current DNA-sequencing technology, it is possible to sequence an entire chromosome (e.g., human chromosome 1, which contains approximately 250 million nucleotides) as one long molecule. A. True B. False

B. False

What about TP53? Mark A for True or B for False: The 3'UTR of TP53 is conserved in zebrafish.

B. False

What happens when a cut gets inflamed? Mark A for True or B for False: The cut appears this ways because the immune system has failed

B. False

You are designing your first template for homologous recombination to insert a mutation (A→C) into Exon 1 of a gene using the CRISPR/Cas9 system. Mark A for True or B for False You will be able to successfully introduce the mutation (A→C) into Exon 1 of the gene.

B. False

Suppose you sequence the genome of the healthy cells and the genome of the HeLa cells and map both to the reference genome. There will be _____ sequencing reads that map to chromosome 15 for the healthy cells compared to the HeLa cells. A. More B. Fewer C. About the same number of

B. Fewer

Compare the results for thyroid tumors and glioblastoma tumors. Which tumors have more mutations on average? A. Thyroid B. Glioblastoma C. They are roughly the same

B. Glioblastoma

Glucose enters the epithelial cells of the small intestine against its concentration gradient. Select the BEST explanation from the following. A. Glucose is transported through a glucose pump in the apical membrane that hydrolyzes ATP to ADP and Pi. B. Glucose is co-transported with Na+, which moves down its concentration gradient into the cell. C. Glucose follows the water that is pumped into the cell. D. Glucose enters by diffusion. E. Glucose is co-transported in the Na+/K+ pump.

B. Glucose is co-transported with Na+, which moves down its concentration gradient into the cell.

You are studying Peptide-X, which binds and activated the glucagon receptor with much higher affinity than glucagon itself. Glycogen phosphorylase will be phosphorylated for a longer time in cells treated with Peptide-X than in cells treated with glucagon. True A mutation in P3 causes it to be active all the time (even when phosphorylated). What would be the most likely consequence of this mutation? A. Glycogen will be made in the absence of insulin B. Glycogen will not be made in the presence of insulin C. P2 will be active in the absence of insulin D. P2 will be inactive in the presence of insulin

B. Glycogen will not be made in the presence of insulin

When the diaphragm contracts, the volume of the lungs _____ and the pressure in the lungs ______ A. Increases; increases B. Increases; decreases C. Decreases; increases D. Decreases; decreases

B. Increases; decreases

Let's assume there are about 6 total mutations that accumulate in a cell after 20 rounds of division. How does your answer to the previous question compare to the data for thyroid tumors shown here? A. It's pretty similar (within an order of magnitude) B. It's totally different (more than 10x different) C. There's no way to say from these data

B. It's totally different (more than 10x different)

Antacids like pepto- bismal are commonly taken to increase the pH of the stomach. If you take an antacid with your meal, _____ secretin will be released by your duodenum compared with eating an identical meal without an antacid. A. More B. Less C. An equivalent amount of

B. Less

The percentage of the genome supported by evolutionary and genetic evidence is _______ the percentage of the genome supported by high biochemical evidence. A. Greater than B. Less than C. About the same as

B. Less than

At high altitudes, the partial pressure of oxygen is ______ the partial pressure of oxygen at sea level. A. Higher than B. Lower than C. The same as

B. Lower than

At the time that the ventricles begin to empty, blood pressure in aorta is _______ blood pressure in the ventricles. A. Higher than B. Lower than C. The same as D. No way to know!

B. Lower than

The DNA sequence shown comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACAGAAGGGC...C...TGACTCAGACTGACATTCTCC-3' ...AAGTTCTGTCTTCCCG...G...ACTGAGTCTGACTGTAAGAGG-5' Consider a mutation that changes the boxed nucleotide from C to A. What kind of mutation is this? A. Silent B. Missense C. Nonsense D. Frameshift E. Non -coding

B. Missense

What type of mutations would most likely lead to a loss of function of the HER2 protein A. Silent mutations in the HER2 ligand binding domains B. Missense mutations in the gene coding regions for the intracellular tyrosine residues. C. In-frame insertion mutations in the HER2 membrane spanning region D. In-frame deletion mutations in the HER2 membrane spanning region

B. Missense mutations in the gene coding regions for the intracellular tyrosine residues.

You are excited to try your first CRISPR experiment. You decide to target the sgRNA to the genomic locus depicted in the diagram. You introduce Cas9 and sgRNA into dish of cultured human cells. You then sequence DNA from five different cells and obtain the results below. Which type of endogenous DNA repair would result following a Cas9 double- strand break? A. HR B. NHEJ C. Both

B. NHEJ

Suppose you want to use CRISPR to introduce a missense mutation into an enzyme that alters an amino acid in the active site to make the enzyme faster. Which double stranded DNA repair method would work? A. Need to use NHEJ B. Need to use HR C. Could use either D. Neither will work

B. Need to use HR

Suppose you want to use CRISPR to introduce a missense mutation into an enzyme that alters an amino acid in the active site to make the enzyme faster. Which double stranded DNA repair method would work? A. Need to use NHEJ B. Need to use HR C. Could use either D. Neither will work

B. Need to use HR

Aging can sometimes lead to an increase in the stiffness at the base of the basilar membrane. What effect would this have on a person's hearing? A. The person would lose the ability to hear low-pitched sounds. B. The person would lose the ability to hear high-pitched sounds. C. The person would not be able to distinguish the amplitude of a sound. D. The person would only be able to hear loud sounds.

B. The person would lose the ability to hear high-pitched sounds.

Signals from the sympathetic nervous system cause arteriole B to constrict. Arteriole B is most likely carrying blood to ________. (Hint: fight or flight) A. The brain B. The small intestine C. A leg muscle D. The heart

B. The small intestine

You sequenced a tumor genome and a healthy tissue genome. You find that there are twice as many reads mapping to a region on chromosome 18 for the tumor sample versus the healthy cell sample. Which of the following is most consistent with this observation? A. The tumor has a deletion in chromosome 18 B. The tumor has a duplication in chromosome 18 C. The tumor has an inversion in chromosome 18 D. The tumor has a translocation between chromosome 18 and another chromosome E. None of the above; this must be an experimental error

B. The tumor has a duplication in chromosome 18

Tumor 1 vs. Tumor 2 circle plot Which tumor has more chromosomal deletions? A. Tumor 1 B. Tumor 2 C. They are about the same D. Not enough information

B. Tumor 2

Vascular endothelial growth factor (abbreviated VEGF and pronounced "Veg-F") is a peptide signaling molecule related to platelet-derived growth factor. VEGF is important in the formation of the circulatory system because its signaling pathway causes the formation of blood vessels in developing embryos during normal development. Tumors also produce and secrete VEGF, causing the formation of new blood vessels that supply these tumors. Given what you know about the different kinds of cell signaling and VEGF, which one of the following statements is TRUE? A. VEGF is an endocrine-signaling molecule because it circulates through the bloodstream inside of platelets. B. VEGF is a paracrine signaling molecule because it binds to receptors on cells at the site where new blood vessels are needed. C. VEGF is an endocrine-signaling molecule because it is released from platelets into the bloodstream and is carried throughout the body, causing widespread activation of platelet-derived growth factor receptors on cells in a variety of tissues.

B. VEGF is a paracrine signaling molecule because it binds to receptors on cells at the site where new blood vessels are needed.

With a fluorescent marker, researchers were able to visualize species specific locations in the Zebrafish gut when colonized either Vibrio or Aeromonas Based on my groups interpretation of the data provided, we can conclude: A. Zebrafish have a preference for Vibrio over Aeromonas B. Vibrio and Aeromonas are able to colonize distinct locations in the Zebrafish gut. C. Both Vibrio and Aeromonas can co-exist in the Zebrafish gut due to their gut location preferences D. We need more information to make any conclusions about this data.

B. Vibrio and Aeromonas are able to colonize distinct locations in the Zebrafish gut.

One of the effects of the hormone secretin is to stimulate the release of bicarbonate ions into the duodenum, which neutralizes the acid that enters the duodenum with food from the stomach. One consequence of neutralizing the pH in the intestine is that: A. enzymes that catalyze the hydrolysis of carbohydrates are denatured. B. enzymes that catalyze the hydrolysis of carbohydrates are active. C. the enzymatically catalyzed hydrolysis of carbohydrate that began in the stomach is halted in the duodenum. D. carbohydrates are not as easily broken down in this neutral environment.

B. enzymes that catalyze the hydrolysis of carbohydrates are active.

One of the hormones not mentioned in the text is GIP (glucose-dependent insulin trophic peptide), which stimulates the secretion of insulin. It is secreted by cells of the duodenum in response to the presence of glucose. Its secretion and action on insulin production is an example of a: A. homeostatic positive feedback mechanism amplifying the response to glucose ingestion. B. homeostatic negative feedback mechanism keeping a system near a set point. C. homeostatic negative feedback mechanism changing the set point.

B. homeostatic negative feedback mechanism keeping a system near a set point.

You measure levels of Ca2+ in various locations within a motor neuron and a skeletal muscle fiber when the motor neuron is NOT depolarized, and the muscle fiber is at rest. Where do you expect to find high levels of Ca2+? A. diffusing into the motor neuron through specialized channels in the plasma membrane B. within the sarcoplasmic reticulum of the muscle fiber C. bound to troponin D. binding to the receptors at the motor endplate of the muscle cell E. within the T-tubules

B. within the sarcoplasmic reticulum of the muscle fiber

Describe microbiota in human babies, what they are, what they do, and how they do it.

Babies receive milk-oriented microbiota (MOM), which includes bifidobacteria. Bifidobacteria help them digest human milk oligosaccharides by using glycosidases and cell importers that bring HMO's into the bacteria for a metabolic breakdown.

In the cases where microbiota species (eg. bacteria) are not in homeostasis, what are ways they compete against each other?

Bacteria species can compete against each other by utilizing nutrients better, occupying space better, or adapting to the host's physiology better (such as intestinal contractions).

What conclusions can we gather from integrating all three genomic analyses? What can we not conclude?

By analyzing biochemical, evolutionary, and genetic data of a particular region of DNA, we can assess its functionality in each of the three categories individually. However, we cannot conclude that a section does not have significance just because it fails one of the three analyses.

You are using mice to study the relationship between gut microbes and metabolism. You have three types of mice: mice with no microbes (GF), mice that gained microbes at a young age (CONV-D), and mice that gained microbes as adults (CONV-R). Results from two experiments are shown below. Mice that have gut microbes eat _____ and have ________ metabolic rate compared to germ-free (GF) mice. A. More; a higher B. More; a lower C. Less; a higher D. Less; a lower

C. Less; a higher

How many PAM motifs did you circle? 5'ATGAGATCTCATGTACTAGTCCGTCATTACTGTACTTCTCTTGACAGGCTGTGTCGTGGAATATCTAAGAGCT 3' 3'TACTCTAGAGTACATGATCAGGCAGTAATGACATGAAGAGAACTGTCCGACACAGCACCTTATAGATTCTCGA 5' A. 1 B. 2 C. 3 D. 4 E. 5 or more

C. 3

In which exon does the open reading frame start? A. 1 B. 2 C. 3 D. 4 E. None of the above

C. 3

What type of loss of function mutations could lead to over expression of the HER2 protein? A. A mutation in the HER2 promoter. B. A mutation in the coding region of the HER2 gene. C. A mutation in a gene for the HER2 repressor protein. D. A mutation in the enhancer region of the HER2 gene.

C. A mutation in a gene for the HER2 repressor protein.

Insects, reptiles, and birds excrete uric acid as their form of nitrogenous waste. Uric acid is much less water -soluble than urea. Why does this allow these organisms to conserve more water than a mammal with extensive kidney tubules for water reabsorption? A. The high solubility of uric acid allows the excretory system to reabsorb water. B. Uric acid levels stay high in the blood maintaining a strong osmotic gradient, which allows water to be reabsorbed. C. After precipitation, uric acid no longer influences osmolarity; water returns to the hypertonic tissues. D. After precipitation, uric acid no longer influences osmolarity; water leaves the hypertonic tissues.

C. After precipitation, uric acid no longer influences osmolarity; water returns to the hypertonic tissues.

Aldosterone, in the figure below, is a hormone secreted by the adrenal cortex, and insulin is a peptide secreted by the pancreas. When aldosterone contacts a target cell, it binds to an intracellular receptor and migrates to the nucleus; insulin binds to extracellular receptors on the plasma membrane. What is the MOST likely reason for this difference? A. Aldosterone is hydrophilic and, therefore, must enter the aqueous environment of the cytoplasm to have an effect. B. Aldosterone is too small to bind extracellular receptors on the plasma membrane. C. Aldosterone is lipid-soluble and, therefore, easily crosses the phospholipid bilayer of the plasma membrane. D. Insulin is too large to interact chemically with DNA.

C. Aldosterone is lipid-soluble and, therefore, easily crosses the phospholipid bilayer of the plasma membrane.

Which of the following statements explains why there is an elastic layer found in arteries, but not veins? A. Arteries are thicker than veins, and the elastic layer is necessary to support the additional weight of arteries. B. Valves present in veins provide a mechanism for withstanding high blood pressure flow going through veins. C. Blood pressure is higher in arteries than veins, and the elastic layer helps maintain the structure of the artery. D. The total length of arteries in the body is more than the total length of veins, and the elastic layer helps push the blood over the longer length.

C. Blood pressure is higher in arteries than veins, and the elastic layer helps maintain the structure of the artery.

You add a toxin that prevents the Na+ /K+ pump from hydrolyzing ATP. Absorption of which nutrient(s) will be affected? A. Glucose only B. Amino acids only C. Both glucose and amino acids D. Neither will be affected

C. Both glucose and amino acids

You are designing your first template for homologous recombination to insert a mutation (A→C) into Exon 1 of a gene using the CRISPR/Cas9 system. What will happen when you add Cas9/sgRNA? A. Only the gnomic DNA will be cut B. Only the HR template DNA will be cut C. Both will be cut D. Neither will be cut

C. Both will be cut

Which CRM(s) are supported by biochemical, genetic, and evolutionary evidence of functionality? A. CRM A B. CRM B C. CRM C D. More than one E. None of them

C. CRM C

Dr. Bello's data The Yanomami have more bacterial diversity than the US samples. A. True B. False C. Cannot be determined.

C. Cannot be determined

Use the data provided below to answer the following question: Children with recurrent tonsillitis have less microbial diversity than healthy adults A. True B. False C. Cannot be determined

C. Cannot be determined

You have successfully fought off your infection and your fever is falling. As your body returns to its original temperature, you appear flushed. This is because blood vessels in your skin have ______ to ______ heat. A. Constricted; release B. Constricted; retain C. Dilated; release D. Dilated; retain E. None of the above

C. Dilated; release

Secretin stimulates the release of bicarbonate ions into the duodenum, which neutralizes acidic chyme from the stomach. One consequence of neutralizing the pH in the intestine is that: A. Carbohydrates are not as easily broken down in this neutral environment B. Enzymes that catalyze the breakdown of carbohydrates are denatured C. Enzymes that catalyze the breakdown of carbohydrates are active D. The enzymatically catalyzed breakdown of carbohydrates that began in the stomach is halted in the duodenum

C. Enzymes that catalyze the breakdown of carbohydrates are active

The DNA sequence shown comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACAGAAGGGCCugaCTCAGACTGACATTCTCC-3' ...AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG-5' Which stop codon is used for this gene? A. UAA B. UAG C. UGA

C. UGA

Freshwater fish are in a hypotonic environment. How do their gill chloride cells function in this environment? A. Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions moving in the opposite direction. B. Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions moving in the opposite direction. C. Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions following. D. Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions following.

C. Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions following.

Suppose a point mutation occurs in the Cas9 gene that disrupts the protein's ability to cut DNA. What do you expect to observe? A. Cas9 will no longer bind to the target DNA B. sgRNA and target DNA will no longer hybridize C. Gene editing will no longer occur D. B and C E. A, B, and C

C. Gene editing will no longer occur

Suppose you have designed a sgRNA that can hybridize with a target DNA sequence, but there is no PAM sequence nearby. What do you expect to happen? A. Works just fine B. Works but is less efficient C. It doesn't work at all

C. It doesn't work at all

Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement

C. No net movement

The DNA sequence shown comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACA...G...AAGGGCCTGACTCAGACTGACATTCTCC-3' ...AAGTTCTGT...C...TTCCCGGACTGAGTCTGACTGTAAGAGG-5' Consider a mutation that changes the boxed nucleotide from G to T. What kind of mutation is this? A. Silent B. Missense C. Nonsense D. Frameshift E. Non -coding

C. Nonsense

Which one of the following is a feature of DNA that could allow you to distinguish between a DNA sequence that is protein coding and a DNA sequence that is not? A. All of these choices are correct. B. Protein-coding sequences are sets of amino acids; others are sets of nucleotides. C. Protein-coding regions frequently contain long open reading frames; others rarely do. D. Protein-coding sequences are single stranded; others sequences are double stranded. E. Protein-coding DNA sequences contain U (Uracil), and nontranscribed sequences contain T (Thymine).

C. Protein-coding regions frequently contain long open reading frames; others rarely do.

When do the atria repolarize? A. P wave B. PR segment C. QRS complex D. ST segment E. T wave

C. QRS complex

When do the ventricles depolarize? A. P wave B. PR segment C. QRS complex D. ST segment E. T wave

C. QRS complex

Where does most of the food we digest get absorbed? A. Mouth, Stomach, and Small Intestine B. Stomach C. Small Intestine D. Large Intestine

C. Small intestine

What does the ST interval represent? A. The heart is relaxing B. The ventricles are filling C. The atria are filling

C. The atria are filling

The duct that connects the pancreas to the duodenum can sometimes become blocked. What is the result? A. The digestive enzymes produced by the pancreas still enter the duodenum because they travel by the blood to reach the duodenum, not by a duct. B. The digestive enzymes are not affected because they are stored in the gallbladder until they are needed in the duodenum. C. The digestive enzymes back up into the pancreas and may start to digest the pancreas. D. The digestive enzymes produced by the pancreas enter the large intestine instead and digestion proceeds as normal. E. Nothing happens because the pancreas does not produce digestive enzymes.

C. The digestive enzymes back up into the pancreas and may start to digest the pancreas.

In systemic tissue fluids, the enzyme carbonic anhydrase catalyzes the reaction CO2 + H2O → H2CO3 (which then can dissociate into H+ and HCO3-). In fact, CO2 released from cells is converted to HCO3- ions and travels in that form in the bloodstream. HCO3- is reconverted to CO2 + H2O in the pulmonary capillaries by the same enzyme, and there the CO2 is exhaled. How is it possible for the same enzyme to catalyze reverse reactions? A. The lungs contain an allosteric inhibitor that prevents the formation of carbonic acid. B. There must be two forms of carbonic anhydrase. One form catalyzes the forward reaction CO2 + H2O → H2CO3 and the other catalyzes the reverse reaction H2CO3 → CO2 + H2O. C. The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O.

C. The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O.

Why do the functions of many receptor kinases depend on the fluid nature of the plasma membrane? A. The generation of cAMP requires a fluid membrane B. Binding of ligand to receptor requires a fluid membrane C. The receptor monomers must move together and dimerize to be activated D. Phosphorylation requires a fluid membrane

C. The receptor monomers must move together and dimerize to be activated

At high altitudes, the percentage of oxygen is ___________ the percentage of oxygen at sea level. A. Higher than B. Lower than C. The same as

C. The same as

The motility of the digestive tract and secretion of digestive enzymes are optimized for digestion and absorption. For most nutrients, once material is in the digestive tract, the digestive system does not vary its rate of absorption according to body needs. A. This is an example of a homeostatic positive feedback mechanism B. This is an example of a homeostatic negative feedback mechanism C. This response is not homeostatic

C. This response is not homeostatic

To determine if Aeromonas and Vibrio can co-exist in the Zebrafish gut you colonize germ free zebrafish Larva with Aeromonas first and then expose the Zebrafish+Aeromonas to Vibrio. You sample and count the number of bacteria present in the gut at multiple times throughout the experiment. The results from you experiment are shown below: Based on my groups interpretation of the data provided, we can conclude: A. Aeromonas and Vibrio can co- exist in the larval zebrafish gut. B. In the larval zebrafish gut, Aeromonas are able to out compete Vibrio because they were the first colonizers. C. Vibrio are able to out compete Aeromonas in the larval zebrafish gut. D. Vibrio are able to utilize food sources present in the larval zebrafish gut better than Aeromonas

C. Vibrio are able to out compete Aeromonas in the larval zebrafish gut.

During heavy exercise, the pO2 in muscle may drop to 20 mm Hg. Considering the oxygen-hemoglobin dissociation curve below, what is the approximate percent O2 saturation of hemoglobin in venous blood returning from skeletal muscles during heavy exercise? A. nearly 0% B. approximately 50% C. approximately 20% D. approximately 75% E. approximately 100%

C. approximately 20%

The ventricles begin to empty at which region of the cardiac cycle? A. 1 --> Diastole B. 2 --> Lub C. before 3 Systole down

C. before 3 Systole down

When a doctor suspects that a patient may have diabetes, she will often have the patient take a glucose challenge test. After the patient drinks a large amount of sugary solution, his blood is drawn and the circulating levels of glucose in the blood are determined. Which of the following curves do you expect from a patient with diabetes? A. curve C B. curve A C. curve B

C. curve B

Aside from whatever digestion has happened before the food reaches the small intestine, the bulk of digestion takes place in the: A. jejunum. B. ileum. C. duodenum. D. appendix. E. colon.

C. duodenum.

A newly discovered signaling molecule that binds to a G protein-coupled receptor is being studied by using cells maintained in cell culture. Preliminary results show that the binding of this new ligand causes the activation of adenylyl cyclase. In the next part of this study, a non-hydrolyzable version of GTP (a form of GTP that cannot be converted to GDP) is added to the cell culture dishes and is taken up by the cells. Which of the following would you expect to observe? A. decreased cAMP, increased protein kinase A activity B. decreased cAMP, decreased protein kinase A activity C. increased cAMP, increased protein kinase A activity D. increased cAMP, decreased protein kinase A activity

C. increased cAMP, increased protein kinase A activity

Evaluate data from short-read based genome-wide measurements to detect small-scale and large-scale genome mutations

CHARTS Small-scale => shows one nucleotide or few changes, on DNA sequence level, use data with dots (goes from 5' to 3' end), compare new sequence read to reference genome, look at graph and determine y-axis, tells you where mutations occur Large-scale => on chromosomal level, show karyotype, use circle diagrams

Explain the process of CRISPR.

CRISPR requires sgRNA, Cas9, and a template DNA. sgRNA is synthesized from engineered DNA in a vector and is placed into the Cas9 complex. The complex then finds the DNA section with the PAM motif (Nucleotide-Guanine-Guanine) as well as the DNA complementary to the sgRNA. Cas9 unzips the DNA, sgRNA hybridizes with the DNA strand opposite to the strand with the PAM sequence, and the double strand is cleaved at only one site. After exonucleases create a large gap in the DNA, the template DNA is used by the cell's repair mechanism to fill the gap in the DNA strand. After that, the ends are joined with the new, synthetic DNA by nonhomologous end joining or homology-directed repair.

Trans-regulatory modules

Can bind to many enhancer sequences Repressor proteins/ activator proteins Ex. General Transcription Factor which can be transcribed on chromosome 12 -- can also bind to promoter at lots of different genes on different chromosomes

Interpret genome browser profiles summarizing data for coding and non-coding positions in a genome

Can look at acetylation: If high acetylation in intron (non-coding region), then probably an enhancer/repressor (regulatory sequence), especially if conserved If high with gene → promoter/terminator region If high at all → biochemical evidence of importance Can look at conservation: If conserved w/o gene → probably a regulatory region If conserved w/ gene → probably a gene that produces a protein that is important for healthy living → evolutionary evidence Can also see if we can use model species to use to understand effects of gene => want one that has gene looking for highly conserved Can look at actual protein expressed → genetic evidence (not shown in genome browser, need to be given information separately)

Assemble sequencing read data based on a reference genome

Can map onto the mapping (template) or complementary strand (coding, nontemplate) strand => need to match up the overlaps to the reference genome We can detect mutations => by comparing sequence read differences from reference sequence, get sequencing reads from cancer and healthy cells and find the ration between them

Explain the process of ChIP-sequencing and what information we can extract from it.

ChIP-sequencing aims to gather biochemical data and involves fragmenting pieces of DNA associated with epigenetic factors, such as transcription factors, and pieces of DNA that do not. Segments with higher frequencies of epigenetic factors may indicate functionality.

Explain how vision would be impacted if the ciliary muscles were unable to fully contract. Provide a rationale that supports and justifies your answer.

Ciliary muscles connect zonular fibers to the lens of the eye. When they contract there is less tension on the zonular fibers. When there is less tension on the lens it allows the lens to be more convex and as it becomes more convex the sight becomes more "near". The focal distance decreases as the lens becomes more convex. If the ciliary muscles cannot fully contract, the individual may not be able to focus on objects near to their eyes. If the ciliary muscles cannot contract to their full potential their focal distance would be longer and seeing things up close would be challenging.

Interpret circle diagrams of DNA sequence data

Circle plots show changes in cancer genomes vs. the reference genome => do not show small scale mutations, need sequencing read to find this Look at large scale (chromosomal level) mutations of tumor samples

Explain how clonal selection allows for specific types of antibodies in the blood.

Clonal selection is akin to natural selection but with B cells. Clonal selection is the idea that B cells are already very diverse due to genomic rearrangement (not due to antigens). They are selected by real foreign antigens to reproduce into plasma cells (secrete antibodies) and memory cells (B cells with many of that antibody attached).

Relate exposure to pathogens to triggering the adaptive immune system for B-cell development

Clonal selection: process by which antigen binding generates a clone of B cells => clonal selection resembles natural selection => there is variation in a population of B cells, and the antigen selects among this variation, allowing some cells to proliferate more than others 1. Population of B cells: B cells express a diversity of dell-surface antibodies 2. Selection: A foreign antigen interacts with one B cell from the population. The B cell divides to form a population of clones 3. Differentiation: The B-cell clones differentiate into plasma cells that secrete antibodies and memory cells with cell-surface antibodies

Based on the diagram shown here, ______ concentration in the duodenum is homeostatically regulated. A. Bicarbonate B. Bile C. CCK D. H+ ion E. Secretin

D. H+ ion

Chemoreceptors in the circulatory system detect changes in circulating <i>p</i>CO₂. If CO₂ concentrations get too high, the rate of ventilation increases. Why does this make sense? A. It makes sense because CO₂ is formed from O₂, and therefore CO₂ is a sign that oxygen is being consumed. B. It makes sense because hemoglobin carries CO₂ and therefore blocks oxygen binding to the heme site, creating an oxygen deficiency. C. Actually it doesn't make sense. There is no relationship between CO₂ and ventilation rate. D. It makes sense because tissues that are more actively working produce more CO₂.

D. It makes sense because tissues that are more actively working produce more CO₂.

Where in the digestive tract do we see the most microbial diversity? A. Mouth and Stomach B. Stomach C. Small Intestine D. Large Intestine

D. Large intestine

Your computer records the raw sequencing data shown below. Which of the following sequences is (are) represented in this dataset? A. 5'-CCGGTA-3' B. 5'-CGGGTA-3' C. Both of these D. Neither of these Remember: DNA synthesis occurs 5' to 3'

D. Neither of these

In complex multicellular organisms, bulk flow is an important physiologic character. Why is bulk flow a necessary condition of complex multicellularity? A. Complex multicellularity reflects cell adhesion between cells, and this cannot happen without bulk flow of signaling molecules from the environment. B. Complex multicellularity is related to the increase in oxygen in the environment. Because bulk flow systems are only related to the delivery of oxygen to tissues, higher environmental oxygen selected for individuals with bulk flow systems. C. Bulk flow is necessary to move large amounts of liquid through the organism depending on physiologic needs. The tissues can all receive necessary nutrients from the environment, but bulk flow speeds the rate of diffusion. D. Organisms exhibiting complex multicellularity are large and have cells/tissues that are not in contact with their environment. Systems that can overcome the limits of diffusion must occur for basic physiologic processes to occur.

D. Organisms exhibiting complex multicellularity are large and have cells/tissues that are not in contact with their environment. Systems that can overcome the limits of diffusion must occur for basic physiologic processes to occur.

Which of the following correctly represents the order in which blood flows through structures of the heart? A. Right ventricle, left atrium, pulmonary artery B. Left atrium, pulmonary artery, right atrium C. Pulmonary artery, aorta, left ventricle D. Superior vena cava, pulmonary vein, aorta

D. Superior vena cava, pulmonary vein, aorta

You are studying the function of two different noncoding regions of the genome. You conduct a reporter assay to test how these regions affect expression of GFP and you obtain the results shown below. Which of the following is an appropriate control for this experiment? A. Region 1 serves as the control B. Region 2 serves as the control C. Testing a third region (Region 3) would serve as the control D. Testing GFP expression for the GFP gene alone would serve as the control E. What is a control?

D. Testing GFP expression for the GFP gene alone would serve as the control

You sequenced a tumor genome and have identified an interesting sequence read. The first half of this read maps to a region of chromosome 3 in the reference genome and the second half of the same read maps to a region of chromosome 20 of the reference genome. Which of the following is most consistent with this observation? A. The tumor has deletions in chromosomes 3 and 20 B. The tumor has duplications in chromosomes 3 and 20 C. The tumor has inversions in chromosomes 3 and 20 D. The tumor has a translocation between chromosome 3 and chromosome 20 E. None of the above; this must be an experimental error

D. The tumor has a translocation between chromosome 3 and chromosome 20

You are excited to try your first CRISPR experiment. You decide to target the sgRNA to the genomic locus depicted in the diagram. You introduce Cas9 and sgRNA into dish of cultured human cells. You then sequence DNA from five different cells and obtain the results below. What effect would the change in Sequence 3 have on protein function? A. Not transcribed B. Not translated C. Translated but altered function D. Translated but non-functional E. No change to translation/function

D. Translated but non-functional

Which of the four groups did Dr. Bello collect the most samples from? A. Yanomami B. Guahibo C. Malawi D. US E. Can't conclude from the data.

D. US

If PTH secretion was reduced due to hypoparathyroidism in a lactating goat, which of the following physiological consequences might you expect to see? Decreased release of acetylcholine by alpha motor nerve cells after action potentials A decrease in the likelihood of a VG Na+ channel opening in the sarcolemma after an action potential in an alpha motor nerve An increase in release of acetylcholine by alpha motor nerves after an action potential Inability to rotate tropomyosin to uncover the myosin binding site on actin due to low calcium inside the skeletal muscle cells Decreased use of ATP by the goat's skeletal muscles

Decreased release of acetylcholine by alpha motor nerve cells after action potentials A decrease in the likelihood of a VG Na+ channel opening in the sarcolemma after an action potential in an alpha motor nerve Decreased use of ATP by the goat's skeletal muscles

Describe how major life events influence the microbiome

Depending on dietary introductions, abundance of each bacteria may change over time Breast feeding early microbiota is milk oriented (have lactose, lipids, and protein digestive enzymes => HMOs (human milk oligosaccharides) Human milk has oligosaccharides and only bifidobacterium can digest them (broken down extracellularly), not the host => microbes only carry enzymes able to digest HMOs. High-fiber diet non-digestible carbohydrates (bacteria can only digest them, not host, and turn them into short chain fatty acids) => bacteroides help digest non-digestible fibers and are specific to certain sugars => use specificity of food preferences to enrich for particular species over others Food diet changes microbiome

Compare and contrast evolutionary, biochemical, and genetic approaches in determining functional elements in genomes

Different ways to define functionality: Biochemical Approach - measures evidence for molecular activity => look at H3K27 acetylation, support for given type of regulation => biochemical support for functionality, because histone modification is related to certain transcriptional activity state, found near promoter and enhancers where show high incidence of acetylation, usually important (H3K27 acetylation on genome browser) Evolutionary Approach - quantifies selective constraint as a proxy for functionality => comparing conservation tracks in the genome, if seems to show high incidence of conservation, so restricted evolutionary change, probably doing something important compared to other sequences within genome more conservation = probably really important even if its in noncoding region (look at conservation tracks, both of them) Genetic Approach - evaluates the phenotypic consequence of genome variations => actually changing genome to a mutation to see what would happen, look if region would do anything if you altered it (cannot be found on genome browser)

What is duplication and divergence and how does it relate to gene families?

Duplication refers to duplicated chromosomal sections, which are free to mutate and experiment evolutionarily to create new genes without consequence. With time, evolved genes with similarities are grouped into a gene family.

potassium ions are leaving the cell.

During hyperpolarization (or afterpotential). Re-establishes resting membrane potential, generates inhibitory postsynaptic potentials, and generates the resting potential needed.

Below is a diagram of O2 uptake at the fish gill. The values shown indicate percent fluid saturation of O2. Which choice below identifies the fluid and the direction of flow CORRECTLY?

E

If you wanted to study how an E-cadherin mutation relates to the progression and metastasis of cancer in humans, which model organism could you use? Discuss with a neighbor and justify you selection. A. Yeast B. Worm C. Fly D. Zebrafish E. Mice

E. Mice

Consider the genome browser data associated with TP53. Do any of these tracks provide genetic evidence for functionality? A B C A. Track A -Layered H3K27Ac histone acetylation B. Track B- Conservation among 100 vertebrates C. Track C - Conservation among selected vertebrates D. More than one of the above E. None of the above

E. None of the above

All of the following would lead to an increase in the force generated by a muscle contraction EXCEPT: A. maximizing the number of cross-bridges formed during a contraction. B. increasing the frequency of muscle stimulation by the motor nerve. C. increasing the number of muscle fibers activated. D. increasing the number of motor units activated. E. increasing the rate at which calcium is pumped back into the sarcoplasmic reticulum.

E. increasing the rate at which calcium is pumped back into the sarcoplasmic reticulum.

Painkillers Appetite stimulant Inhibits NT release; may aid memory and learning Blood vessel dilation, relax other smooth muscles Promotes odor adaptation Dilation of cerebral blood vessels

Endogenous opioids Neuropeptide Y Endocannabinoids Nitric oxide Carbon monoxide ATP

A drug or toxin that served to quickly degrade acetylcholine within the myoneural junction would ensure that skeletal muscle cells contracted continuously due to their having multiple action potentials that were no longer under the control of the alpha motor nerve cell.

False

During hypernatremia (excess sodium in the blood) more sodium ions will accumulate in the extracellular fluid around neurons. This physiological change should result in far more sodium influx during the depolarization stage, and also a greatly increased positive value of the overshoot.

False

If a receptor also activates a phosphatase that targets P1, it could still produce a functional signal transduction pathway.

False

If more sodium ions were outside the nerve cell membrane than usual, the size of the overshoot should increase dramatically.

False

Moving the RMP from a value of -90 mV to a value of -110 mV should make the nerve cell membrane more sensitive to having an action potential in response to a stimulus because it will become more polarized.

False

The postsynaptic nerve cell from the previous question will need to have (at least whatever number you specified in your answer) of ligand-gated Na+ channels in order to reach threshold potential.

False

When glucagon is present in the bloodstream, all cells in the body will respond to the signal. T or F

False

You have discovered a mutation in adenylyl cyclase that prevents it from binding the G protein. This mutation will lead to elevated cAMP levels in the absence of a signal. T or F

False

Explain the ability of the innate immune system to combat a variety of pathogens

First line defense: Skin and mucous membranes: mucous membranes of respiratory and GI tract acts as physical barriers Second line of defense: WBC of the innate immune system: - phagocytes engulf and destroy foreign cells or particles by phagocytosis - Mast cells release histamine an important contributor to allergic reactions and inflammation Complement system: certain proteins circulating the blood participate in innate immune function and thus complement other parts of the immune system => activation has 3 effect (activated by proteins/antibodies attach to antigens): cell lysing, phagocytosis, and inflammation

Where would you expect energy to be used directly by a serotonergic nerve cell during synaptic transmission of an action potential? For calcium influx, For reuptake of serotonin, For removal of sodium ions after serotonin reuptake, For removal of calcium ions, For opening on a ligand-gated sodium channel, For removal of sodium ions after depolarizatoin, For removal of potassium ions from the nerve cell after reuptake of serotonin

For removal of sodium ions after serotonin reuptake, For removal of calcium ions, For removal of sodium ions after depolarizatoin.

neuron= A nerve cell, consisting of cell body, dendrites, and an axon. Dendrites and axons are extensions from the cell body. Two kinds of neurons= Sensory and motor neuron.

Functional classifications of neurons- autonomic, sensory, efferent

Match each of the following descriptions with the correct sodium or potassium channel: Fully opens at threshold potential- Fully opens at the top of overshoot- Opens in response to a stimulus- Inactivates a 0mV- Resets to its starting position after repolarization to TP- Fully closed at the end of reverse overshoot-

Fully opens at threshold potential- Voltage-gated Na+ Fully opens at the top of overshoot- Voltage-gated K+ Opens in response to a stimulus- Sodium Leak channel Inactivates a 0mV-Voltage-gated Na+ Resets to its starting position after repolarization to TP-Voltage-gated Na+ Fully closed at the end of reverse overshoot- Voltage-gated K+

What are some flaws with genome annotation?

Genome annotation sometimes fails as important motifs/genes are overlooked and even when they are noticed, they are only hypotheses.

Define the terms genome, genome sequencing, sequence assembly, and genome annotation

Genome: DNA molecules that are transmitted from parents to offspring => all known cellular forms of life, all known organelles, and all viruses => the complete set of genes or genetic material present in a cell or organism genetic material transmitted from parent to offspring (not just DNA, also proteins, DNA from mitochondria, etc) Genome sequencing: Figuring out the order of DNA nucleotides in a genome. knowing the letters that make up a genome Sequence assembly - putting fragments of DNA sequences into the correct order to recreate entire genome. Process in which nucleotide sequences of a long DNA molecule are arranged in correct order to generate complete sequence => short sequences are assembled according to their overlaps Genome annotation - process by which researchers identify various types of sequences present in the genome (label function of genes, non-coding regions, etc). Process of identifying the location of genes and other functional elements in a genome. - Can look for previously cloned mRNA within DNA, to find start codon (ATG), can look for conserved sequences (similar sequence found in other genomes), can look for regulatory sequences, non-coding RNA, single copy genes, protein coding genes, and repeated regions - Can use sequence motif - sequence of nucleotides that indicate the kind of function of the particular genome region (ORF, transcription factor binding sites, non-coding regions) - Use mRNA to determine intron/exon portions - Conserved sequences - present in other animals, probably has some important function if it was conserved in two very different populations

How does one annotate a genome?

Genomes are annotated by looking for motifs, or recurring patterns in the sequence that may represent a gene, tRNA segments, enhancer sequences, tandom repeats, etc.

Explain how genomic rearrangement leads to a diverse array of different B cells with their respective antibodies.

Genomic rearrangement of V, D, J, and C segments on the DNA (during differentiation) allow for different combinations of protein segments on antibodies. Each B cell has one unique type of antibody as well as unique DNA sequences.

describe HER proteins

HER proteins are receptor kinases on cell surface, they stimulate cell growth and division lead to HER cancer - metastatic

breast cancer

HER2 overexpression of the HER2 gene --> lots of receptors being made result of duplication in the genome multiple copies of the same protein coding region being transcribed/ translated --> the tumor cell makes more receptors

HER

HER2 dimerizes not only with itself but also with other receptors important for cell division motility, invasiveness, and resistance to apoptosis growth factor receptor signal the cell to grow when receptors dimerize

If an individual possessed a mutation in a gene that resulted in the inability to create melanosomes, explain how and why skin and hair pigmentation would be impacted (if at all).

Hair and skin pigmentation would be detrimentally affected. Melanocytes produce melanin, melanin is packed and carried by melanosomes to fuse with the keratinocytes to move melanin to various parts of the body. Since melanin is what makes the skin, hair and eyes darker with pigmentation, an individual that could not transport it with the help of melanosomes and keratinocytes the individual would have lighter hair and skin.

Differentiate helper T cells and cytotoxic T cells.

Helper T cells function by releasing signal cytokines to WBCs and cytotoxic T cells. Helper T cells have CD4 glycoproteins on their surface. Cytotoxic T cells recognize any cells with an antigen and kills them. These have CD8 glycoproteins on their surface.

How do helper T cells react to an MHC on an APC? How do cytotoxic T cells react?

Helper T cells react to class 2 MHCs bound to an antigen and they signal WBCs and cytotoxic T cells with cytokines. Cytotoxic T cells react to class 1 MHCs bound to an antigen and kill the APC. One similarity between them is that they can produce memory cells after performing their job on an MHC.

Explain in general terms how 16S rDNA sequencing data is collected

Helps us study what microbes are present in a microbiota sample by identifying microbes based on genetic sequences 1. Take DNA from Biospecimens (e.g. stool, skin, lungs, reproductive tract) 2. Then, Sequence genes for 16S rRNA gene 3. Allows identify all microbes present in a sample => then, use reference database to get identification number for each of bacterial species => use identify number (microbe ID => OTU) or can use reference database to see how related microbes are to each other Use 16S rRNA sequences in DNA, because each loop (variable regions) vary from one microbe to the next => this variability in bases for different loops allows us to uniquely identify one microbe to the next => acts as a bar code

what happens when cancer metastasizes?

Hemidesmosomes help hold cells to the basil lamina When a tumor metastasizes it has to break through the basil lamina hemidesmosomes have to become "unstuck" to travel can invade capillaries and proliferate in other areas

Certain neural pathways within the brain trigger emotional or behavioral responses, and each of the neurons involved in the pathway use particular neurotransmitters. Match each of the following emotions or behaviors with the neurotransmitter that is most likely involved: I'm not going hungry- Whoa, that was fun!- What was that spooky noise?!- I have made some really good friends- Eating a lot of soluble carbohydrates- I am so ready for this marathon! Fire the starting gun already-

I'm not going hungry- Serotonin Whoa, that was fun!- Dopamine What was that spooky noise?!- Norepinephrine I have made some really good friends- Serotonin Eating a lot of soluble carbohydrates- Dopamine I am so ready for this marathon! Fire the starting gun already- Norepinephrine

Predict the type of immune response a particular pathogen would likely elicit

If it is a cancer cell or a cell that has been damaged by a virus or pathogen => Cytotoxic cells will be used to kill the host cell If penetrates through skin and mucous => use second line of defense => inflammation (mast cells) and phagocytosis White blood cells of innate immune system => mount an early response to a pathogen, if they are unable to clear the pathogen, they alert the more specialized white blood cells of the adaptive immune system (B cells)

If the Glands of von Ebner were non-functional, how might the sense of taste be impacted? Provide a clear rationale to support your answer.

If the Glands of von Ebner were non-functional then there would be no sense of taste. Even though the gustatory cells are the legitimate taste receptors, the Glands of von Ebner use a watery substance to transport the taste's to the taste pore and taste pit. So if the Glands of von Ebner were non-functional there would be no way to taste because the transport mechanism to the gustatory cells isn't present.

Evaluate the effect of immunizations on immune system development

Immunizations → creation of memory cells → better at recognizing and getting rid of pathogens Vaccines are made from dead or weakened antigens => Immune system produces antibodies and memory cells in response - allows for quicker response if subject is infected by actual disease The deliberate delivery in a vaccine of an antigen from a pathogen to induce a primary response but not the disease, thereby providing future protection from infection

How do bacteria use Cas9 to fight off viral DNA?

In the first invasion, bacteria synthesize DNA complementary to that of the virus. This new DNA is used by the Cas9 protein to find the viral DNA, bind to it via complementary bases, and cleave it. The new DNA is also stored in the bacterial DNA as a way to "remember" this invasion and quickly express sgRNA for their Cas9 proteins for the next viral invasion.

What does phosphorylation of P2 do?

Inactivates it.

What are the key components of the corticospinal pathway in a reflex arc? Are neurons in this pathway efferent, afferent, or both?

Included is the upper motor neuron and the lower motor neuron. The upper motor neuron is the pathway from the cerebral cortex to spinal cord. The lower motor neuron involves the spinal cord to effector tissue. The neurons in this pathway are efferent because they are traveling from the CNS to the PNS, or within the CNS.

Choose any of the following that should increase the strength of contraction of a skeletal muscle over and above what it should normally have: Increase the amount of acetylcholine made by the alpha motor nerve cells Increase the interaction time between DHP and RyR in the triad Increase the number of action potentials in the associated alpha motor nerves Allow the muscle to "warm up" by performing a few contractions first Increase the amount of ATP in the muscle cells so that myosin will more quickly drop actin Increase the size of the "stimulus" provided by ACh at the motor end plate Increase the number of red muscle fibers and reduce the number of white muscle fibers contracting Increase the size of the muscle fibers by adding more sarcomeres

Increase the interaction time between DHP and RyR in the triad Increase the number of action potentials in the associated alpha motor nerves Allow the muscle to "warm up" by performing a few contractions first Increase the amount of ATP in the muscle cells so that myosin will more quickly drop actin Increase the size of the muscle fibers by adding more sarcomeres

Differentiate between adaptive and innate immunity

Innate (natural): Provides protection against all types of infection in a nonspecific manner, innate because does not depend on prior exposure to pathogen => targets diverse pathogens, is not specific and does not include memory, and can distinguish self from nonself nonspecific, act immediately, and do not depend on past exposure to elicit a response Adaptive (acquired): Specific to given pathogen (B and T cells), "remembers" past infections (meaning subsequent encounters with same pathogen generate stronger response), adapts over time and is acquired after initial exposure => has specificity and memory => takes longer than innate produces an array of molecules, each of which has the potential to target a specific pathogen, remembers past infections and mounts a stronger response on re-exposure

Differentiate innate vs adaptive immunity.

Innate immunity is nonspecific and does not require memory of previous encounters. Adaptive immunity is specific and utilizes memory cells. Adaptive immunity is the second response to an infection if the innate immunity system isn't sufficient or more pathogens enter.

What are insertions/deletions in DNA? What effect can they have?

Insertions and deletions inserts/deletes nucleotides (or even transposons). They can lead to an in-frame or out-of-frame mutation. In the case where a multiple of 3 is added/deleted, entire amino acids will be added/deleted.

spatial summation

Integration by a postsynaptic neuron of inputs (EPSPs and IPSPs) from multiple sources.

reciprocal translocations

Interchange of parts between nonhomologous chromosomes both chromosomes are broken and the terminal segments are exchanged before the breaks are repaired change only the arrangement of genes and not their number, most do not affect the survival of organisms

What are chromosomal inversions, translocations, and reciprocal translocations?

Inversion: a piece is broken off and rotates 180 degrees before being put back in Translocation: a piece is broken off and attaches to a different chromosome Reciprocal Translocation: pieces are broken off from two different chromosomes and switch locations

What happens to glucagon after it binds the receptor?

It eventually dissociates from the receptor

How does glycine act to control skeletal movements?

It inhibits the antagonist's action by causing IPSPs.

Which of the following is/are a characteristic of GABA as a neurotransmitter?

It is inhibitory opens Cl- channels into the cell helps control skeletal muscle movements

What type of cells produce the myelin sheath in the central nervous system (CNS)?

Oligodendrocytes

Differentiate knockin and knockout animals.

Knockin animals are genetically modified with sequence substitutions or insertions that can lead to either gain or loss of function mutations. Knockout animals are genetically modified to strictly inactivate a gene.

The binding of ACh to the muscarinic receptor indirectly affects the permeability of ____________ channels. This can produce ____________ in some organs if channels are opened, and ____________ in others if channels are closed. For example, in the heart it is the beta-gamma complex that binds to the K+ channels of heart muscle and causes them to open. This leads to K+ diffusion ____________ of the cell and the cell becomes ____________ resulting in a decrease in heart rate. In contrast, in smooth muscle of the stomach the alpha subunit binds to K+ channels causing them to close. This reduces the outward diffusion of K+ and the cell becomes ____________ resulting in smooth muscle contraction.

K⁺ hyperpolarization depolarization out hyperpolarized depolarized

Left hemisphere= right hemisphere=

Left hemisphere= - speech, writing -left ear -main language center -calculation -right visual half field right hemisphere= -right ear -spatial concepts -left visual half field

If a mutation in a voltage gated sodium channel caused it to inactivate more quickly than normal: Less ATP would be used by the cell The cell would have a smaller overshoot than normal The action potential might not flow throughout the entire nerve cell The cell could not depolarize The cell could not repolarize

Less ATP would be used by the cell The cell would have a smaller overshoot than normal The action potential might not flow throughout the entire nerve cell

If there was lower than normal pressure in the pulmonary artery and aorta, which of the following might be true of the heart? The left ventricle would have to contract with more force to move blood into the aorta There would be more pressure on the mitral valve Less blood would likely be flowing through the pulmonary veins due to decreased blood flow and pressure to the lungs There would be less pressure on the aortic and pulmonary valves The aortic valve would open at a lower ventricular pressure, and thus the ventricle would have to work less hard than it would at normal blood pressure

Less blood would likely be flowing through the pulmonary veins due to decreased blood flow and pressure to the lungs There would be less pressure on the aortic and pulmonary valves The aortic valve would open at a lower ventricular pressure, and thus the ventricle would have to work less hard than it would at normal blood pressure

In the line of horses coming from the stallion Impressive, a mutation in the voltage-gated sodium channels in skeletal muscle sarcolemma causes the channels to "hang open" for a few milliseconds longer than normal during the action potential. Which of the following might you expect to occur in a horse that has these mutated VG sodium channels? Longer than normal depolarization Delayed repolarization Longer than normal activation of DHP More calcium than normal leaving the sarcoplasmic reticulum and entering the sarcoplasm More ATP than normal used by SERCA pumps Larger than normal overshoot More potassium leaving the sarcoplasm than normal Increased potassium in the blood

Longer than normal depolarization Delayed repolarization Longer than normal activation of DHP More calcium than normal leaving the sarcoplasmic reticulum and entering the sarcoplasm More ATP than normal used by SERCA pumps Larger than normal overshoot More potassium leaving the sarcoplasm than normal Increased potassium in the blood

Formulate a hypothesis to address the likely function of a mutation in the cancer genome taking available genomic information into consideration (week 10 discussion)

Loss of function for tumor suppressor => proliferation Loss of function in promoter/enhancer => repressed Gain of function in repressor => repressed Gain of function for proto-oncogene => proliferation Loss of function in repressor => proliferation Gain of function in promoter/enhancer => proliferation

loss of function mutation of adherins junction

Loss of function mutation --> cadherins do not associate with one another across extracellular space cells not together as a single whole tissue (easier to break apart) once they break apart they just have to make it through the basil lamina and into the pores of the capillaries to travel

Matrix is a commercially available product that contains a compound known as altrenogest; Matrix is used to synchronize estrus in swine. One of the safety instructions included with Matrix indicates the need for individuals to wear protective gloves and avoid direct skin contact with Matrix. What attributes of Matrix necessitate the caution about avoiding direct contact with the skin?

Matrix is a progestin and it shares many of the same chemical properties of other steroid hormones. So therefore, Altrenogest is a progestin, and has the molecular characteristics that make it highly absorbable by the skin. Steroid hormones are derived from cholesterol and can pass easily though cells. Substances like steroid hormones have a relatively low molecular weight and are lipophilic (or lipid soluble) and can pass easily through the cells of the epidermis and the dermis to ultimately enter blood vessels to be carried throughout the body in circulation.

Interpret data relating to microbe-microbe and microbiota-host interactions

Microbe-microbe: they can coexist or can take over causing the other microbe to no longer survive (i.e vibrio takes over and does not allow Aer to survive in gut) Micro-Host: microbes allow host to digest food that host cannot, or can take over host actions (i.e. vibrio causes smooth muscle to contract, which makes host cause Aer to be excluded it through intestinal interactions)

Define and differentiate between the terms microbiome, microbiota, metagenome, and holobiont

Microbiome - Entire habitat of microbiomes, their genomes, and their surrounding environment. All of the microorganisms that inhabit a location as well as all their functional genes. Microbes, their genes that they contain, and the products that they secrete and the environment that they live in Microbiota - bacteria that inhabit a particular environment (us) => referring to microbes themselves, the identity of the microbes => microorganisms, including bacteria, viruses, archea, fungi, and protozoa, that inhabitat particular environment => use 16S rRNA gene sequencing to find specific bacteria. Microorganisms of a particular site. The microbes themselves, their identity Metagenome - collection of genes and genomes that form a microbial community. All the genomic samples present in the microbes. The microbes and all the genes that they contain Holobiont - An organism and all of its symbiotic microorganisms. The host as well as all of the microbial symbionts that are encompassed in the host including transient and stable members. Host and all it symbiotic bacteria

Define microbiome, microbiota, metagenome, and holobiont.

Microbiome = all microorganisms and their genomes on the human body Microbiota = all microorganisms that live on humans Metagenome = collection of all genes and genomes of a microbial community Holobiont = both the host and its microbiota populations seen as one ecological unit

Explain colonization resistance and resilience in adult microbiota.

Microbiota develop resistance to colonizers as they occupy all the space and nutrients that colonizers would need. They can also attack colonizers with toxins or injections. Microbiota develop resilience in the sense that if antibiotics greatly reduce the microbiota populations, they will quickly recover. However, reduced microbiota allows open niches for pathogens.

Describe microbiota in humans later on in life (adulthood), what they are, what they do, and how they do it.

Microbiota in adult humans include bacteroides species, which help adults digest non-digestible fibers with enzymes like glycosidases.

How does microbiota in humans change as we grow from babies to adults?

Microbiota in human babies start off with little biological diversity; as they grow older, their microbiota diversify and have highly branched phylogenies. They also develop colonization resistance as well as resilience.

What is the end result of microbiota metabolism in either human babies or adults?

Microbiota in human babies/adults metabolize HMO's and nondigestible fibers into short chain fatty acids.

Enlarging the node of Ranvier should result in: Increased speed of conduction of the action potential , More ATP being used by the nerve cell, Increased numbers of voltage-gated sodium and potassium channels being involved in the action potential, Larger than normal amounts of sodium inside the cell after depolarization, An increase in the efficiency of both depolarization and repolarization

More ATP being used by the nerve cell, Increased numbers of voltage-gated sodium and potassium channels being involved in the action potential, Larger than normal amounts of sodium inside the cell after depolarization.

Evaluate the effect of a coding mutation

Mutation within coding region is rare, mostly occurs in noncoding region, however could causes issues as noncoding regions can code for regulatory mechanisms - In coding regions can cause amplification/over expression of the gene => can cause proliferation of cells that cause cancer - coding mutation can cause protein to no longer be functional => loss of function - or cause it to be over-expressed => cancer

Differentiate NHEJ and HDR.

NHEJ allows the cell to repair its modified DNA with only its repair mechanisms and no additional help. It deletes overhangs to create blunt ends that are pushed together. This method is more error-prone and less precise. It can lead to indels and mutations. HDR use specifically made template DNA for the cell to repair the joints, making HDR a more precise and accurate method.

2 ways the DNA can be fixed?

NHEJ and HR

During depolarization, which of the following statements about voltage-gated ion channels is TRUE?

Na+ gates open before K+ gates.

Define pathogen

Organisms and other agents, such as viruses, that cause disease => pathogens include viruses, bacteria, fungi, single-celled eukaryotes commonly called protists, and worms Cause disease => - Can infect a particular type of cell (HIV) - Can proliferate in an organ and interfere with its function (Pneumonia: proliferate in lung tissue and limit gas exchange) - Can produce toxins that cause disease (cholera: toxin interferes with membrane transporters in the small intestine and causes diarrhea)

What are principle coordinate graphs?

PC graphs are graphs that measure beta diversity between collected samples. They are typically obtained by comparing 16S rRNA data between samples. They can tell us if samples with a certain characteristic have a tendency to congregate in one area or if the samples of a certain characteristic are spread out and spurious.

What are point mutations in DNA and what can they lead to? What is an SNP?

Point mutations change a nucleotide at a single point and can cause silent mutations, missense mutations, nonsense mutations, and even frameshift mutations (think about it). An SNP is a variant (normal or mutated) of an allele at a single point.

the role of astrocytes in the formation and function of the blood-brain barrier?

Produce enzymes to destroy toxic substances Produce carrier proteins/ ion channels Induce tight junctions between capillary endothelial cells

Differentiate proto-oncogenes and tumor suppressors.

Proto-oncogenes code for proteins or components that promote cell division. Tumor suppressors code for proteins or components that inhibit cell division. Gain or loss of function mutations can lead to cancer depending on which type of gene it affects.

Intermediate filaments

Provide strength and support, main function is mechanical. for Anchored to by desmosomes.

(Review) Describe how RNA polymerase transcribes.

RNA polymerase is recruited by an organization of general transcription factors at promoters, transcriptional activator proteins at enhancers, and a mediator complex. RNA polymerase reads the DNA from 3' to 5' while transcribing 5' to 3'.

What is RNA-sequencing and what major problem does it present?

RNA-sequencing is another biochemical method to assess the functionality of particular regions of DNA. RNA-seq takes RNA, converts it to DNA strands, and tries to match it to the coding region in the DNA. The major problem we have to consider is the removal of introns.

Serotonin is a neurotransmitter of the brain that may impact behavior and/or "moods" or emotions. Which of the following should increase serotonin's ability to make a person feel like things are okay, that basic needs are being met? Increase the reuptake of serotonin Reduce monoamine oxidase activity Reduce the conversion of serotonin to melatonin Increase dietary tryptophan intake, which is a precursor for serotonin synthesis

Reduce monoamine oxidase activity Reduce the conversion of serotonin to melatonin Increase dietary tryptophan intake, which is a precursor for serotonin synthesis

What is reporter sequencing and how is it relevant to genetic analysis for functionality? What main flaw does reporter sequencing have?

Reporter sequencing is basically trial-and-error. We add a reporter gene near a possible regulatory sequence (like a promoter). We can have a control trial where we do not alter the possible regulatory sequence to see if the reporter gene is expressed (hence why it is called the reporter). We can have another trial where we alter the possible regulatory sequence to see how it affects expression of the reporter gene. The main flaw with reporter sequencing is similar to that of ChIP-sequencing. Different cell types and cell states may vary in epigenetic regulation and expression.

Explain the process of Sanger sequencing.

Sanger sequencing sequences one strand of DNA at a time by adding lots of luminescent chain terminators to a lot more regular nucleotides in a solution with the strand of DNA. The base pairing as well as chain terminators produces complement chains of different lengths. The lengths can be lined up to determine the complement pattern of the DNA single strand.

Explain the process of sequencing by synthesis.

Sequencing by synthesis involves segmenting the DNA, adding adapters to each segment (so the primers used can be all the same) and making copies of them, synthesizing a complement strand with colorful bases, and taking pictures every time a base is added to track which are added. The sequence read should not include the primer sequence.

endocrine signaling

Signaling by means of molecules that travel through the bloodstream

travel by diffusion.

Signaling molecules in paracrine and autocrine signaling

Differentiate between small-scale and large-scale genome mutations

Small-Scale: Point mutations: mutation in which one base pair is replaced by a different base pair - Missense mutation: point mutation (nucleotide substitution) that causes an amino acid replacement => can affect three-dimensional structure of protein and therefore change its ability to function - silent mutation: mutation resulting in codon that does not alter corresponding amino acid in polypeptide => no change in function, usually at 3' end of codon (third position) - Nonsense mutation: mutation creates stop codon, terminating translation => truncated nearly always nonfunctional, unstable and quickly destroyed - Frameshift: Mutation in which insertion or deletion of some number of nucleotides that is not multiple of 3, causes shift in reading frame of mRNA, changing following codons => all amino acids downstream, of site of insertion/deletion are changed. resulting in loss of protein function Large-Scale: on Chromosomal level - Duplication: region of chromosome that is present twice instead of once, less harmful when smaller rather than large, less harmful than deletions - Deletion: Region of chromosome is missing resulting from error in replication from joining breaks in chromosome that occur on either side of deleted region - Inversion: The reversal of the normal order of a block of genes, produced when region between two breaks in chromosome is flipped in orientation before beaks are repaired - Translocation: Interchange of parts between nonhomologous chromosomes. When two different (nonhomologous) chromosomes undergo exchange of parts. Both chromosomes are broken and terminal segments are exchanged before breaks are repaired

Choose any of the following that describe a correct type of facilitated diffusion that occurs during conductance and synaptic transmission of the action potential in the nervous system? Sodium influx through sodium leak channels after application of a stimulus Use of the Na+/K+ pump to restore and maintain concentration gradients of sodium and potassium Sodium influx through voltage-gated sodium channels Potassium efflux through voltage-gated potassium channels Sodium efflux through a ligand-gated sodium channel The event that causes overshoot Calcium influx to cause exocytosis of neurotransmitters Movement of potassium through inward rectifying potassium channels Pumping of calcium out of the axon terminal Exocytosis of neurotransmtters

Sodium influx through sodium leak channels after application of a stimulus Sodium influx through voltage-gated sodium channels Potassium efflux through voltage-gated potassium channels The event that causes overshoot Calcium influx to cause exocytosis of neurotransmitters Movement of potassium through inward rectifying potassium channels

During the action potential of a nerve cell, either a _______ opens to allow enough ______ to enter to reach _________ . At this point, ______ open and more [ion] enters until the cell membrane reaches ______ when the [protein] begins to close and stop the entry of of [ion].

Sodium leak channel or a Ligand-gated sodium channel Sodium Threshold potential. Voltage-gated sodium channels 0mV

Describe how properties of particular amino acids in a protein may affect protein structure and function

Some amino acids are polar, nonpolar, basic, acidic, etc, which would affect structure and function Changing these amino acids could seriously disrupt function, especially if the new amino acid has very different properties - Transmembrane protein should be non-polar, but if mutation causes it to change polarity would not be able to function => loss of function

What are some uses for genome annotation?

Some uses for genome annotation is comparing genomes between species to see which genes were evolutionarily conserved, finding introns between exons, and studying HIV.

Helper T cells

T cells that help other cells of the immune system by secreting cytokines, thus activating B cells to secrete antibodies

Describe the properties and function of T cell receptors (TCRs).

TCRs are similar to antibodies as they are each unique due to genomic rearrangement during differentiation. However, their chemical structures are more simple than antibodies and they cannot recognize the antigens by themselves. TCRs serve to allow T cells to recognize antigens bound to MHC complexes on APCs.

How are tandem repeats used in DNA profiling?

Tandem repeats are unique in every human homologous chromosome and can be put in gel electrophoresis (small pieces go farther) for DNA fingerprinting.

Define DNA/gene editing

Techniques that allow researchers to "rewrite" the nucleotide sequence of DNA so that specific mutations can be introduced into genes => techniques to alter the nucleotide sequence of almost any gene in a deliberate, targeted fashion. In essence, these techniques allow researchers to "rewrite" the nucleotide sequence so that specific mutations can be introduced into genes to better understand their function, or mutant versions of genes can be corrected to restore normal function

What is the significance of the PAM motif?

The PAM motif is typically three base pairs upstream (towards 5') from the cutting site and is typically NGG. The NGG must be found in the orientation 5'-NGG-3'. There needs to be a PAM motif for every cut made in the DNA.

How do you find PAM sequences, where the double strand cut is made, and the spacer sequence?

The PAM sequence is always 5'-NGG-3' or 3'-GGN-5'. The cut is made three nucleotides upstream from the PAM sequence. The spacer sequence is identical to the 20 nucleotides upstream from the PAM in terms of both sequence and directionality.

Choose any of the following that are true of the normal action potential: Sodium must be pumped out of the nerve cell in order to cause repolarization The action potential starts at one point on the nerve cell membrane and spreads throughout the nerve The action potential is the means by which information from the body to the brain is transmitted through the nervous system Every stimulus should initiate an action potential that travels all the way to the brain The action potential requires facilitated diffusion of ions

The action potential starts at one point on the nerve cell membrane and spreads throughout the nerve The action potential is the means by which information from the body to the brain is transmitted through the nervous system The action potential requires facilitated diffusion of ions

When looking at the genome browser (specifically the tracks), what kind of information is presented?

The browser shows which chromosome you are at, where you are in the chromosome, the scale at which you are viewing it, and options for moving left/right and zooming in/out. If you zoom in a lot, you can see the coding, nontemplate strand for genes that are transcribed from LEFT to RIGHT. The given strand is the template strand for those transcribed from RIGHT to LEFT. The tracks show genes, exons, introns, and the intergenic regions. The tracks below show data regarding evolutionary conservation, data regarding epigenetic modifications, data regarding genetic analyses of functionality, and data regarding the frequency of different types of repeats.

responding cell

The cell that receives info from the signaling molecule

peptide bond

The chemical bond that forms between the carboxyl group of one amino acid and the amino group of another amino acid

How does the complement system participate in both the innate and adaptive immune systems?

The complement system is a group of proteins that can bind to invaders, activate signal transduction in the blood, form a membrane attack complex that lyses invaders, and coat invaders with a protein that phagocytes can recognize.

Which of the following statements about the resting membrane potential is TRUE?

The exterior of the cell has a net positive charge and the interior has a net negative charge.

cell wall

The extracellular matrix of plants is the (made of cellulose)

Describe the body's first line of defense against pathogens.

The first line of defense is any epithelial layer that is in contact with the exterior world. It provides a physical barrier and the microbiota on your epithelial layers take up the space and resources so pathogens can't survive on it.

What are the key components of the posterior column pathway in a reflex arc? Are neurons in this pathway efferent, afferent, or both?

The first order neuron, second order neuron, and the third order neuron. The first order is the receptor, the second order brings the message to the thalamus and the third transports the message from the thalamus to the cerebral cortex. The neurons in this pathway are afferent.

Describe in general terms how the gut microbiome contributes to immune system health

The gut microbiome makes it hard for foreign pathogens to colonize Indirect colonization resistance: microbes signal to immune system, leading host production of antimicrobial peptides, antibodies, mucous Microbiota protect against opportunistic bacteria, however antibiotics can kill of this good bacteria Colonization resistance: microbiota fill up the entire dense space, protect against disease by filling up the physical space, so that new pathogen causing microbes are going to have a difficult time finding space to colonize persistently. Also, they utilize the nutrients very efficiently, so that the nutrients will be hard to utilize for any exogenous disease causing microbes => all help to resist invasion by disease causing pathogens

What are some instances when the immune system inefficiently differentiates self from nonself?

The immune system must be able to differentiate self (includes healthy host cells and beneficial microbiota) and nonself (includes malfunctioned host cells and harmful pathogens). Sometimes the immune system may attack the self as it mistakes it for nonself (autoimmune disease). Sometimes it may overrespond to a harmless nonself, like pollen. Sometimes it may recognize nonself effectively but produce an inadequate response (immunodeficiency).

Compare the first and second encounters between memory cells and antigens.

The primary response is more delayed and less in magnitude due to the creation of plasma and memory cells, but the secondary response is much quicker, higher in magnitude, and longer in duration.

How and why does inflammation occur during injury?

The purpose of inflammation is to bring WBCs to the inflicted area. Inflammation occurs when WBCs signal other WBCs and histamine is released by mast cells to improve blood flow, giving off the red color. WBCs travel to the site of injury via extravasation (rolling via glycoprotein/protein binding until they breach the site).

repolarization

The return of the resting membrane potential after depolarization has occurred. Because K+ is positively charged, the diffusion of K+ out of the cell makes the inside of the cell less positive, or more negative, and acts to restore the original resting membrane potential of −70 mV. This process is called repolarization and represents the completion of a negative feedback loop. These changes in Na+ and K+ diffusion and the resulting changes in the membrane potential they produce constitute an event called the action potential, or nerve impulse. As the Na+ channels are becoming inactivated, the gated K+ channels open and the membrane potential moves toward the K+ equilibrium potential. This outward diffusion of K+ repolarizes the membrane. Actually, the membrane potential slightly overshoots the resting membrane potential, producing an after-hyperpolarization as a result of the continued outward movement of K+. However, the gated K+ channels close before this after-hyperpolarization can reach the K+ equilibrium potential (−90 mV). The Na+/K+ pumps are constantly working in the plasma membrane. They pump out the Na+ that entered the axon during an action potential and pump in the K+ that had left. Remember that only a relatively small amount of Na+ and K+ ions move into and out of the axon during an action potential. This movement is sufficient to cause changes in the membrane potential during an action potential but does not greatly affect the concentrations of these ions. However, active transport Na+/K+ pumps are required to move Na+ out and to move K+ back into the axon after action potentials have occurred in order to restore resting conditions.

Explain the significance of the scaffold region and the spacer region of the sgRNA.

The scaffold is specifically coded for the purpose of binding the sgRNA to the Cas9. The spacer is specifically coded to bind to the correct region adjacent to the PAM sequence.

signaling cell

The source of the signaling molecule

One of the characteristics of hormones and hormone signaling involves the concept of "high affinity receptors". We see many unique receptors throughout the body for various hormones. However, we can generally identify receptors as being present as either integral proteins embedded in the cell membrane of the cells in the target tissue, or the receptors being found in the cytoplasm of the cells in the target tissue. Compare and contract how the cells of the target tissue produce their physiologic response to the hormone when receptors are found in these two locations. Explain the general mechanism by which the response takes place in each case, and provide an example of a hormone (or class of hormone) for each mechanism.

The target tissue would produce a faster physiological response if the receptor is found on the cell membrane rather than if the receptor was found in the cytoplasm. If the receptor is found on membrane the hormone will bind and then second receptors, such as cAMP and Ca2+ will be used. An example of this immediate response mechanism would be peptide hormones. On the other hand if the receptor is in the cytoplasm, the hormone would travel through the membrane and then bind the the R group. This would then cause the nucleus to activate gene expression. An example of this delayed response mechanism would be steroid hormones.

If a mutation in the voltage-gated sodium channel caused the inactivation gate to close more slowly than normal: The action potential would be much faster, The voltage at the top of the overshoot would be more positive, The nerve cell would use more ATP, More potassium would be required to leave the cell during repolarization, The voltage-gated sodium channel would take longer to reset to its starting position, The area around the mutant channel would be depolarized longer than normal, The duration of the absolute refractory period would increase, The mutant channel would not be able to reopen again , You should be able to detect increased potassium ions in the extracellular fluid around the nerve cell after repolarization.

The voltage at the top of the overshoot would be more positive, The nerve cell would use more ATP, More potassium would be required to leave the cell during repolarization, The voltage-gated sodium channel would take longer to reset to its starting position, The area around the mutant channel would be depolarized longer than normal, The duration of the absolute refractory period would increase, You should be able to detect increased potassium ions in the extracellular fluid around the nerve cell after repolarization

If you were asked to design a drug to stimulate hair loss in sheep (to harvest wool), what would you want this compound do to the hair growth cycle? Consider our discussion of hair growth when you formulate your answer. 1) What would you like this drug to do with regard to the hair growth cycle? 2) Would this action be permanent or temporary? Your answer may be brief, but you must provide a clear explanation to justify your answer.

This drug would have to speed up the hair cycle. In order to collect the club hairs, (wool) the drug would have to induce Catagen after the hair underwent Anagen to grow the hair fiber to the desired length. During Catagen, cells at the base of the club hair undergo apoptosis, or cell death. This makes the wool fall out. By administering this drug at the time the wool is ready or within a timeframe, Catagen would proceed. This management practice can be used at the time of harvest and would be temporary, as the hair cycle restarts at the Telogen phase of the hair cycle to regrow wool.

Where would you expect to find facilitated diffusion of calcium occurring during the process of skeletal muscle contraction? Through voltage-gated calcium channels in the alpha motor neuron Through ligand-gated acetylcholine receptors in the sarcolemma Through RyR channels in the SR (not my mom) Through the sarcoplasm after calcium efflux from the SR (not my mom) Through SERCA pumps

Through voltage-gated calcium channels in the alpha motor neuron Through RyR channels in the SR (not my mom)

Identify elements of protein-coding genes

Translated by Exons, only make up about 2% of the genome Long DNA codes for proteins or RNA molecules with specialized functions Protein codon regions have long open reading frames transcription factors - turn genes on our off by binding to nearby DNA - activators => promoters and enhancers turn on gene, positive regulation - repressors => turn off gene expression, negative regulation RNA polymerase - binds promoter to start transcription, reads from '3->5' and creates from 5'->3' For proteins, 5' end has NH2 and 3' end has COOH (ie. NH2-Met-......-AA-COOH)

A normal skeletal muscle cell should always reach threshold potential in response to acetylcholine released from its associated alpha motor nerve.

True

You are studying a sample of cancer cells and blood from a patient. The cells have no mutations in any of their signaling molecule proteins but the cells' signaling transduction properties are not normal, causing them to be cancerous. True or False: The cells taken from the patient could have more growth factor receptors than normal

True. Growth and hormones cause cancer.

You are studying a sample of cancer cells and blood from a patient. The cells have no mutations in any of their signaling molecule proteins but the cells' signaling transduction properties are not normal, causing them to be cancerous. True or False: The concentration of a signaling molecule in the patient could be higher than usual

True. More signaling molecules means that more receptors can activate and cause cell growth.

The effect that brings the initial segment closest to threshold. _______________ the time between signals sent from the same presynaptic terminal increases the strength of the graded potential. This is an example of ________________ summation. Substances that cause facilitation of a neuron Assume in a laboratory you were able to isolate a neuron and remove the Acetylcholine receptors from the postsynaptic membrane. The substance _________________ would no longer cause facilitation of this neuron.

Two EPSPs in proximity to each other Reducing; temporal cause the neuron to fire that may not under the same circumstances in the absence of the facilitator nicotine

Interpret 16S rRNA gene sequencing data

Use 16S rRNA sequencing data to find: 1. Genetic relatedness, sequence similarity, measure variation between samples. Compare the sequences to a database of known bacterial sequences (beta) => or can use it to take data from different parts of the body and look at phyla, abundance of particular phyla of microbes in certain body habitats 2. Find microbe's ID, OTU, Determine bacterial species and quantity of each species (Alpha) - can use 16S rRNA to find specific taxa of microbes - Abundance of microbial genes (shows metabolic pathways) does not use 16S rRNA sequencing, because need to use the whole genome to find all microbial pathway, all of these enzymes not coded for in 16S rRNA, but in the rest of the genome

If an animal was known to be poisoned by curare you could potentially treat the physiological condition by: Using atropine, an ACh antagonist Using pilocarpine, an ACh agonist Increasing the activity of ACh-ase Using lidocaine to stop the transmission of the AP Using electrical stimulation of the alpha motor nerve to increase its rate of firing

Using pilocarpine, an ACh agonist Using electrical stimulation of the alpha motor nerve to increase its rate of firing

Initial Conditions: Cerebrospinal fluid: outside (Cout) Brain: C1 = 300 mM V1 = 1,200 cm C out = 280 mM Equilibrium conditions: Cerebrospinal fluid outside (Cout) Brain: C2 = 280mM V2 = ??? Cout = 280 mM C1V1 = C2V2 Calculate V2

V2 = 1286 cm3

describe B cells.

WBC that originates in bone marrow, has antibodies on surface

what are phagocytes? what are the 3 main types of phagocytes?

WBC's that engulf and destroy pathogens macrophages, dendritic cells, neutrophils

Describe how genomics can be used in cancer research

We can see if cancers are associated with common mutations. This can lead to discovering the possibility of correlations between those mutations and the development of cancer => can allow us to understand which genes effect cancer Look for signature increases to identify what causes mutation => environment (carcinogens), pathways that go wrong (oncogenes, tumor suppressor, ect.), or mutation by genetics (BRCA gene) => these signatures allow us to look at were in genome they may accumulate

A nerve cell is functioning normally but then suddenly runs out of ATP. Without ATP this nerve cell: Would eventually have an increase in the amount of sodium ions inside Could not depolarize Would have no overshoot Could not stop sodium from entering the cell during depolarization Could not increase intracellular calcium to release neurotransmitter Would lose the ability to remove calcium from the terminal end of the cell, thus eventually causing more neurotransmitter to be released

Would eventually have an increase in the amount of sodium ions inside Would lose the ability to remove calcium from the terminal end of the cell, thus eventually causing more neurotransmitter to be released

Select an appropriate model organism to address a given research question

Yeast => unicellular organisms, good if want to see one cell mechanism, but not cell to cell contact mice => usually have conserved/closely related biological processes to humans

Based on the discussion section of week 9 as well as the class's learning objectives, what skills should you be able to do with the genome browser?

You should be able to: - identify coding regions for genes - identify introns, exons, and transcription direction - determine whether the reference genome is the template or nontemplate strand - predict changes to protein structure/function based on mutations - determine number of exons of gene as well as number of amino acids in the translated protein - evaluate functionality of genes based on biochemical and evolutionary tracks

Antigen

a foreign cell that causes the production of antibodies

Depolarization

a positive change in the membrane potential of the cell, the potential difference between the two recording electrodes is reduced. When the axon membrane has been depolarized to a threshold level, by stimulating electrodes—some of the gated Na+ channels open and the membrane becomes more permeable to Na+. This permits Na+ to enter the axon by diffusion, which further depolarizes the membrane (makes the inside less negative, or more positive). The gates for the Na+ channels of the axon membrane are voltage regulated, and so this additional depolarization opens more Na+ channels and makes the membrane even more permeable to Na+. As a result, more Na+ can enter the cell and induce a depolarization that opens even more voltage-regulated Na+ gates. A positive feedback loop is thus created, causing the rate of Na+ entry and depolarization to accelerate in an explosive fashion.

T cell receptor (TCR)

a protein receptor, always membrane-bound on T cell surface, that recognizes & binds to the antigen - different than B cell antibodies since they do NOT recognize the antigen itself -> instead recognizes an antigen in association w/ the Major Histocompatibility Complex (MHC) - always membrane bound, vs. antibodies which can be free floating

Beta diversity

a qualitative measure of how similar or different microbiome communities are across DIFFERENT samples [Beta= Between diff samples] - can be represented using Principle Coordinate Analysis (PCoA)

Alpha diversity

a quantitative measure of different microbes present in a SINGLE sample - how many different microbes found within a sample - measured using OTUs (operational taxonomic units)

Duplication

a region of a chromosome that is present twice instead of once (less harmful) when a gene is duplicated one of the copies is free to change without causing harm to the organism because the other copy has the normal function of the gene

Promoter

a regulatory region where RNA polymerase & associated proteins bind to the DNA duplex

Signal transduction results in

a response by the cell

excitatory postsynaptic potential (EPSP)

a slight depolarization (increase in charge) of a postsynaptic cell, bringing the membrane potential of that cell closer to the threshold for an action potential

Enhancer

a specific DNA sequence necessary for transcription

DNA/gene editing

a type of genetic engineering in which DNA is inserted, deleted, or replaced within the genome of a living organism or cell using engineered enzymes

Consider this scenario: An individual is found to possess a mutation in a gene that leads to a defect in the cilia produced by the receptor hair cells in the scala media (cilia on all other cells throughout the body are not impacted by this mutation). a) How would the perceptions of balance, body position, and equilibrium be impacted? Be sure to provide a clear rationale for your answer. b) How would the perception of sound (i.e, hearing) be impacted? Be sure to provide a clear rationale for your answer.

a) The scala media is not involved in the senses of body position, balance, and equilibrium. The scala media is found in the cochlear portion of the ear, the portion of the ear responsible for the sense of hearing. b.) The perception of sound would be decreased. Without an adequate amount of cilia, due to the defect of production, the hair cells would not move as much. When hair cells are exited by the vibration of sound wave to a certain extent a nerve impulse is sent to the auditory nerve. Without enough cilia it would be difficult to create a nerve impulse.

Consider this scenario: A neuron has a resting potential of -70mM. At this point, the neuron is treated with a chemical that inhibits voltage gated potassium ion channels such that these channels are unable to close after being opened. Address the 4 following questions: a) (5 points) Could this neuron experience a graded potential? Explain why or why not. b) (5 points) If this neuron were brought to a threshold membrane potential, would the membrane depolarize? Explain why or why not. c) (5 points) If this neuron were forced to depolarize, would the membrane repolarize? Would its repolarization (if it occurred) look different than a neuron which was not treated with the chemical that altered the voltage gated potassium ion channels as described above? Explain why or why not.

a) Yes, opening of voltage gated potassium channels is not involved in a graded potential. It is controlled by leak channels. b) Yes, because voltage gated potassium channels are not involved in depolarization. Voltage gated sodium channels are involved in depolarization. c) Yes, depolarization would differ between these two cells...both cells would experience a repolarization event, however, the cell treated with the drug that prevented CLOSURE of the voltage gated potassium channels would have a membrane potential that far exceeds -70 mv ( or even exceeded the hyper polarized state of -90 mV, as these gates remain open, allowing more and more potassium ions to flow out of the cytoplasm).

Imagine you are examining the interaction between a pre-synaptic cell and post-synaptic cell that use acetylcholine is used as a neurotransmitter. Answer the following questions: a) (1 point) Which of these cell releases acetylcholine? b) (2 points) If voltage gated calcium channels in the pre-synaptic cell were inhibited (i.e., their function blocked in some way), what would be the impact (if any) on the post-synaptic cell? Provide a clear rationale to support your answer. c) (6 points) Would there be any difference in cell function, acetylcholine release, or cell response between a pre-synaptic and post-synaptic cell exposed to an acetylcholinesterase inhibitor, and the response between a pre-synaptic and post-synaptic cell in which no acetylcholinesterase inhibitor was administered? Provide a clear and concise rationale to justify your answer.

a.)Pre-synaptic cell releases acetylcholine. b) There would be no impact because acetylcholine is inside of the intracellular vesicles, and the vesicles fuse with the presynaptic cell membrane to release acetylcholine only upon the release of calcium. c) Acetylcholinesterase are found in the synapse and break down acetylcholine. In this instance, we have not inhibited acetylcholine release but if there was a lack of a acetylcholinesterase inhibitor this would mean acetylcholine would continue to bind to receptors on the post-synaptic cell. Causing the cell to continuously signal action potentials to occur.

A neuron that has just propagated an action potential is quickly stimulated again, but no response occurs. This neuron must have been in the __________when the second stimulus arrived.

absolute refractory period

A recently depolarized area of a cell membrane cannot generate an action potential because of the

absolute refractory period

Absolute refractory period causes

action potential propagation to occur in one direction.

importance of adapters

adding the same nucleotide sequence to the end of every fragment means the same primers can be used to sequence all of the genome fragments

Hologenome

all genetic material of a holobiont - "my genes + microbial genes"

alpha vs beta diversity

alpha= quantitative measure of different microbes present in a sample beta= qualitative measure of how related microbes are *know different graphs

Knockout

characterizes the inactivation of specific genes in order to study their function - uses NHEJ

scaffold region of sgRNA

allows Cas9 & sgRNA to bind together

inhibitory postsynaptic potential (IPSP)

an inhibitory hyperpolarization (decrease in charge) of the postsynaptic membrane of a synapse caused by the liberation of a neurotransmitter by the terminal button

Holobiont

an organism & ALL of its symbiotic microorganisms (microbes)

opsonization

antibodies "tag" pathogens so phagocytes know to come consume the pathogen

what are the 3 ways to define functionality?

biochemical, evolutionary, and genetic approach

what is the difference between HR (homology-directed repair) and NHEJ?

both are used for repair in double-stranded breaks in DNA! HR: homologous recombination, more reliable because the chromo's are homologs! NHEJ: directly connecting the broken ends, more error/mutations

At the synaptic knob, voltage-gated ______________ channels open, thereby stimulating the synaptic vesicles to release their neurotransmitters by exocytosis. If acetylcholinesterase became mutated and nonfunctional, what would be the immediate result? If a drug was developed that interfered with the proper functioning of the microtubules found within the axons of neurons, how would you expect this to impact axonal transport processes? The enzyme choline acetyltransferase catalyzes the reaction between acetyl-CoA and choline resulting in the formation of the neurotransmitter acetylcholine. This enzyme is produced within the cell body of neurons, but the synthesis of acetylcholine occurs within the axon terminals. Which statement best describes the axonal transport mechanism associated with this process? Suppose that a new virus is discovered that specifically infects motor neurons. Assume that this virus enters neurons in conjunction with choline molecules. Once inside the cell, the virus enters the nucleus and replicates. Which direction describes the axonal transport route taken by this virus?

calcium Acetylcholine would build up in the synaptic cleft. Both anterograde and retrograde transport processes would cease. Choline acetyltransferase is transported in the anterograde direction. Retrograde transport

elderly microbiome

can change with disease microbes otherwise stable

chromosomal mutations

can delete or duplicate regions of a chromosome which has many genes leading to a change in gene copy number and products

non polar sig molecules

can pass through cell membrane by selves/via diffusion

polar sig molecules

can't pass through cell membrane by selves

A resting membrane potential of -70 mV indicates that the

charges inside of the plasma membrane are negative compared to the charges outside.

An action potential

causes the inside of the neuron cell membrane to become positively charged in reference to the outside.

R groups

chemically diverse w/ different properties such as hydrophobic, hydrophilic, etc - attached to amino acids & strongly influences how a polypeptide folds & hence its 3D structure

non-homologous end joining (NHEJ)

could combine 2 pieces of DNA that were not originally supposed to be together --> insertion, deletion, frameshift mutations, wild type Could induce an error originally not expected

An action potential generates local currents that tend to _____ the membrane immediately adjacent to the action potential.

depolarize

Beta Diversity

differences in microbiota between people, body regions, biological samples how different is your microbiota from mine? micro biomes that share sequence similarities (likeness) are clustered together

genetic approach

difficult because least amount of data available evaluates phenotypic consequences of genomic variations ex. GFP reporter gene shows us whether a particular part of DNA can influence how much of a gene Is transcribed how much fluorescence should show change in expression of genes (phenotype)

double stranded break

double stranded breaks in DNA that are incorrectly repaired or errors in DNA replication can lead to chromosomal mutations

how is the microbiome formed?

during birth: vaginal birth- mimics vaginal microbes c-section- mimics skin microbes

human microbiome

entire habitat of microbes, collective genomes and their environment

holobiont

entire host and its microbe symbionts

Bacterial Sequence Database Analysis

extract DNA from poop samples sequence the DNA compare the DNA sequences to a database known as the bacterial sequences determine bacterial species and quantity of each species more sequences = more bacterial species shows only alpha diversity because shows how many species of microbes are in each group but doesn't show similarity between the 2

in which direction does the primer read DNA?

from 3' to 5'

in which direction is DNA sequenced? which end do we want the primer to bind on?

from 5' to 3' want primer to bind on 3' end of template

what are tumor suppressor genes?

genes that slow down and regulate cell division mutations cause them to be inactive

16S rRNA sequencing

genotypic test to determine genus & species of bacteria -> measure microbial diversity - sequences DNA that encodes for RNA (NOT RNA!!) - tells us info about identity of bacteria, not genes

Factors influencing gut microbiome

gut micro biome created early in life - considered to be complete at about 3 years 1. prenatal exposure 2. route of delivery (vaginal or c section) 3. infant diet 4. environmental exposure 5. antibiotic use 6. genetics developing micro biome has more competitive exclusion species while the adult micro biome finds sybiosis/stability (like succession)

describe how herceptin treatment works.

herceptin is an immune cell that provides HER2 antibodies that prevent HER2 dimerization

what is a treatment for HER cancer?

herceptin treatment, tamoxifen treatment

changes in the number of sequencing reads

higher bar= more sequencing reads in cancer than in healthy cells lower= less

Progesterone

hormone produced by the corpus luteum in the ovary and the placenta of pregnant women, triggering the uterine lining to thicken and prevents muscle contractions that would eject a cell (cramps)

HMO

human milk oligosaccharides "short sugars" 3rd most abundant no host cells can digest this only bacteria (microbes) can essentially we are feeding the microbiota bifidobacteria contain enzymes to digest enzymes -- glycosidases (some extracellular, some intracellular)

Action potentials occur Demyelinating diseases cause a(n) ______________ in the conduction velocity of action potentials. If demyelination occurs, why don't action potentials occur at regions of the axon that were previously myelinated?

in the unmyelinated regions of an axon decrease lack the appropriate concentration of voltage-gated sodium channels.

If Sarin gas was used on an animal you'd expect _______ ATP to be used by ______ and by ______ . The resulting muscle contraction would be similar to ________.

increased myosin SERCA Tetany

happens at the SA node

initiation of the mammalian heart contraction

innate vs adaptive

innate= non specific defense response adaptive= pathogen specific defense response

Homology Directed Repair (HDR/HR)

introduce in a donor template to fix double stranded bread using inserted template which will get incorporated into the genome - used for more specific purposes: smaller mutations, incorporating specific gene

T3 and T4 require

iodine for their formation (individuals without enough iodine from their diets produce too little thyroid hormone/can also lead to a goiter)

The muscarinic ACh receptors are formed from only a single subunit and do not contain ____________ like the ____________ ACh receptors. Rather, binding of ACh to the muscarinic receptor activates a complex of proteins in the cell membrane known as ____________ , because their activity is influenced by GDP and GTP, guanosine nucleotides. There are three G-protein subunits: alpha, beta and gamma. Binding of ACh causes the ____________ subunit to dissociate from the other two, which form the ____________ complex. Either the alpha subunit or the ____________ complex then diffuses through the membrane until it binds to an ion channel and causes it to open or close.

ion channels nicotinic G-proteins, alpha beta, gamma beta,gamma

loss/gain of function of tumor suppressor genes

loss of function: could lead to cancer because no longer suppressing cell growth gain of function: no cancer because it would regulate cell growth

loss/gain of proto-oncogenes

loss of function: no cancer because class would not grow and divide uncontrollably gain of function: could lead to cancer because cells would grow and divide even more

mutation rate

measured as mutations/bp/cell divisions

biochemical approach

measures evidence for molecular activity ex. acetylation tells us if a gene is expressed different levels because not everything is going to be translated (**can be transcribed but not translated**) ex. sequences of pieces of DNA that bind a protein (eg. transcription factors) because wouldn't bind if no functionality

Biochemical approach

measures evidence for molecular activity - ExL H327 Acetylation, Chip sequencing - shown on genome browser

Principle Coordinate Analysis (PCoA)

measures the variability across many different samples -> measures Beta diversity

what are reporter assays used for?

measuring genetic functionality test whether a DNA sequence influences if a gene is transcribed (uses GFP)

Cadherins

mediate cell-cell attachments through homophilic interactions

Microbiota

microorganisms, including bacteria, viruses, archaea, fungi, and protozoa, that inhabit a particular environment - "identity of microbes"

what is biochemical functionality?

molecular activity (transcription factors, histone acetylation)

Depolarization occurs because

more Na+ diffuse into the cell than K+ diffuse out of it.

Depolarization of a cell membrane occurs because _____________.

more sodium ions diffuse into the cell than potassium ions diffuse out of it

dynein

motor protein that carries cargo away from the p membrane TOWARD the MINUS ends of microtubules

Fluid nature of plasma membrane allows receptor kinases to...

move together and dimerize.

saltatory propagation

movement of an action potential along a myelinated axon, "jumping" from node to node

Association neuron= interneurons (associated neurons)=

multipolar cells in the CNS Neurons in CNS that do not extend into the PNS.

sgRNA

must be complementary binds to target sequence

Large scale mutations

mutations that occur on a chromosomal level - includes: deletions, duplications, inversions, translocations, insertions

Small scale mutations

mutations that occur on a more nucleotide level - includes: missense, silent, nonsense, and frameshift mutations

CRISPR-Cas9 origin

natural system used by bacteria to protect themselves from infection by a virus Palindromic= sequence of letters that read the same left to right --> when DNA is transcribed into RNA which forms hairpin turns Repeats are identical but spaced apart by spacer DNA (history of old infections) which is not identical Cas genes associated with CRISPR which will make cas proteins (helicases - unwinding, and nucleases - cleave) When bacterium detects the presence of virus DNA it produces 2 types of short RNA One sequence matches that of the invading virus (guide RNA) These 2 RNAs form a complex with a protein called Cas9-- a nuclease enzyme that can cut DNA When matching sequence known as guide RNA finds its target within the viral genome the Cas9 cuts the target DNA disabling the virus

Structures present exclusively within the myelin sheath of the PNS?

neurilemma and sheath of Schwann

An adult male has difficulty moving his hand after a head injury that resulted in damage to neurons in his brain. The damage is likely permanent because __________.

neurons in the CNS lack Schwann cells, which play a major role in axon regeneration

can Cas9 cut if only part of the target DNA sequence is there?

no! sgRNA must be able to hybridize fully

Cancer development

normal cell -> benign cancer -> malignant cancer -> metastatic cancer

what are proto-onco genes?

normal genes that become cancerous when activated by a mutation

what kind of nucleotides are added into the sample after DNA fragments have been amplified?

normal nucleotides and dideoxynucleotides (termination) 4 different dideoxynucleotides that are flourescent (A,G,C,T)

benign

not harmful encapsulated keep growing in encapsulated area --> can still cause damage

what does the term CRISPR refer to?

originally from the DNA sequence found within the genome of bacteria

biochemical evidence peaks read

peaks mean number of reads bound to protein transcription factors, mediator proteins, RNA polymerase -- all upstream of transcribed region

how do phagocytes recognize pathogens?

phagocytes have toll-like-receptors that recognize and bind to pathogens

what is genetic functionality?

phenotype (caused by genome variations)

kinases

phosphorylate proteins (adds a phosphate group to another molecule)

Genome annotation

process by which researchers identify the various types of sequences present in genomes - process of identifying the locations of genes of other functional elements in a genome

Sequence assembly

process in which short nucleotide sequences are arranged in the correct order to generate the complete sequence

calcium levels are too high

production of PTH is inhibited and calcitonin is released to shift bone metabolism toward net bone formation (building bone that stores calcium)

noncovalent interactions

property of dynamic instability implies that the individual protein subunits of microtubules are held together by

what is innate immunity?

protection against all kinds of infection, nonspecific

Colonization resistance

protection against growth of exogenous microbes (pathogens)

Non-Homologous end joining (NHEJ)

proteins put DNA back together but introduce error prone frameshift mutations (INDELs), leading to a nonfunctioning protein - used to knockout a large portion of DNA, large scale mutations

what is the complement system?

proteins that circulate the blood and activate specific WBC's to fight off infection complement system itself is innate immunity

Effector (homeostasis)

provides the means for the control center's response to the stimulus (i.e. increased sweating on a hot summer day)

evolutionary approach

quantifies selective constraint as proxy for functionality ex. sequence conservation over vertebrates

Evolutionary approach

quantifies selective constraints as a proxy for functionality - Ex: comparing conservation tracks of a genome - shown on genome browser

describe the secondary response.

re-exposure to same antigen = faster and stronger response memory B cells differentiate into plasma cells

Graded potentials are produced within the _______________________ segment of a neuron. Graded potentials result from the opening of ________________. An inhibitory postsynaptic potential results from the opening of____________________.

receptive ligand-gated channels potassium and/or chloride channels

HER family genes

receptor kinases (RTKs) that when they bind to their signal, stimulate cell growth & cell division - overexpressed in cancers

what type of pathway is involved with HER proteins?

receptor tyrosine kinase pathway

microbiota

refers to the organisms themselves ( includes bacteria, viruses, archaea, fungi, and protozoa)

Phosphatase

removes a phosphate group from a molecule, if inhibited, the response of a cell would be longer than it normally would.

Secondary immune response

response to re-exposure to an antigen - quicker, stronger, and longer response than primary immune response - memory B cells differentiate into plasma cells that release antibodies

what is the PAM sequence?

sequence on target DNA that the sgRNA binds to, 5' -NGG- 3' sgRNA cuts 3 bp in (toward 5' end)

Degeneration of dopaminergic neurons of the nigrostriatal dopamine system may cause __________.

severe motor problems

what is sgRNA complementary to in CRISPR technique?

sgRNA is designed to be complementary to the target DNA

CRISPR

sgRNA which has the sequence of where we want to cut

Calcitonin

shifts bone metabolism toward net bone formation (building bone that stores calcium)

Circle plots

show changes in cancer genomes vs. the reference genome - outer black ring = normal cell banding pattern - rearrangements => translocations (interchromosomal) or inversions (intrachromosomal) - color of innermost rings => info on deletions or duplications (red=duplication, blue = deletions, white= normal)

16S Data Visualization - Cluster Analysis

shows variation between biological samples each sphere represents the microbiota of a biologic samples distance represents dissimilarities in sequence between microbial samples Beta Diversity

step 2

some sugars are non-digestable only microbes can digest grains, legumes, etc. bacteriodes have different glycosides (importers, enzymes) very fine specificity bacteria enrich based on food preferences when you lose microbes over time you can't gain them back (you don't recover the full microbiome)

sgRNA

single guide RNA that complementary base pairs to target DNA - must be completely complementary for Cas9 to bind & cut target DNA - Cas 9 cuts 3 bp upstread (towards 5' end) of PAM sequence ***sgRNA hybridizes to strand opposite to the strand containing PAM sequence -> sgRNA = exact same nucleotide sequence as strand containing PAM

C-Value paradox

size of genome is unrelated to the complexity of the organism

what make up the first line of defense of the immune system?

skin and mucous membranes

PTH

slows/halts bone formation

2 types of mutations

small scale & large scale mutations

homeostasis in adult microbiome

some microbes are interdependent on each other microbial alliances start forming huge interaction between immune cells and bacteria (in the intestine)

what is adaptive immunity?

specific response to certain pathogens, can "remember" past infections (B cells and T cells) *only in vertebrates

how and when is the microbiome formed

sterile inside womb acquire microbes through birthing process through the birth canal profiles look like moms microbiome acquire microbes overtime (2 yrs diversity looks like adult)

Opening reading frame (ORF)

stretch of DNA or RNA consisting of codons for amino acids uninterrupted by a stop codon (potentially protein coding region) ORF is where we find the start codon and this is where the protein begins being translated

Successive EPSPs from a presynaptic terminal to a postsynaptic neuron is called ________.

temporal summation

Sympathetic nervous system

the division of the autonomic nervous system that arouses the body, mobilizing its energy in stressful situations

parasympathetic nervous system

the division of the autonomic nervous system that calms the body, conserving its energy

somatic nervous system

the division of the peripheral nervous system that controls the body's skeletal muscles

Microbiome

the entire habitat of microbes, their genomes & their surrounding environment

Autonomic nervous system

the part of the peripheral nervous system that controls the glands and the muscles of the internal organs (such as the heart). Its sympathetic division arouses; its parasympathetic division calms.

Inversion

the reversal of the normal order of a block of genes region between two breaks in a chromosome is flipped in orientation before the breaks are repaired

what is the importance of adapters?

to bind to all DNA fragment ends so that the same primer can be used to synthesize all fragments

what is the goal of the immune system?

to protect the body from pathogens (disease causing)

phosphorylation

transfer of a phosphate group from ATP to a substrate

CRISPR-Cas9 Genetic Editing

we can use this to cut any part of DNA by changing the guide RNA to match the target Once in nucleus, the resulting complex will lock onto a short sequence known as the PAM Cas9 will unzip the DNA and match it to its target RNA; If match is complete Cas9 will cut the DNA Cell tries to repair the cut but the repair process is error prone leading to mutations that can disable the gene --> allows researchers to understand its function (ex. frame shift, deletion, insertion, silent, knock out or wild type)

what make up the 2nd line of defense in the immune system?

white blood cells! some are innate, some adaptive