MCB Clicker Questions Exam 2

Sarah has cloned a gene that codes for the protein EN. EN breaks down cellulose. She wants to collect a large concentration of this protein for research. Which vector should she choose for best results? -plasmid -shuttle vector -expression vector -bacteriophage

-expression vector

Researchers discover a new species of bacterium that has an unusual metabolism. However, it has biochemical and morphological similarities to other species. What is the most comprehensive and effective approach to determine how to classify these bacteria? A. The bacteria should be classified by using genomic analyses to construct phylogenies. B. The bacteria should be classified with other bacteria that have the most similar morphology. C. Because of their unusual metabolic pathways, the bacteria should be classified in a new group. D. The bacteria should be classified with the other bacteria that use the most similar biochemical pathways.

A. The bacteria should be classified by using genomic analyses to construct phylogenies.

Which is NOT true regarding temperate phages? A. They always kill their host once infection begins. B. A host with a temperate phage is called a lysogen. C. The genome of a temperate phage inserted into a host's chromosome is called a prophage. D. They can cause lysogenic conversion, giving new abilities to their host.

A. They always kill their host once infection begins.

The number of organisms in a broth culture was determined using the standard plate count method (SPC) and spectrophotometry (SPEC). Which of the results below would you expect to see from each method? A. SPC = 12 × 10^6 cfu/ml; SPEC = 11 × 10^7 cfu/ml B. SPC = 100 cfu/ml; SPEC = 10 cfu/ml C. SPC = 12 × 10^7 cfu/ml; SPEC = 11 × 10^3 cfu/ml D. SPC = 12 × 10^6 cfu/ml; SPEC = 12 × 10^6 cfu/m

A.) SPC = 12 × 10^6 cfu/ml; SPEC = 11 × 10^7 cfu/ml SPEC = counts for all cells SPC = counts for cells you can see

How is a mutation distinguished from the broader concept of "DNA damage" in microorganisms? A. DNA damage occurs from chemicals, and mutations are biological mistakes. B. Mutations are, by definition, heritable. C. Mutations are always lethal; DNA damage is lethal only sometimes. D. All of the above are true.

B. Mutations are, by definition, heritable.

A student has a pure culture of bacteria growing in a flask and wants to know how many living cells are in the culture at a given time. Which method should she employ to get an estimate? A. Microscopic counts B. Plate counts C. Turbidity measurements D. Any of these methods would work equally well in this case, assuming that standard curves are produced.

B. Plate counts It is not Microscopic counts b/c that includes dead cells It is not Turbidity measurements b/c it can forms large clumps or biofilms in liquid medium

A viral capsid is composed of individual units of ________ called ________. A. polysaccharides / viroids B. proteins / capsomeres C. glycolipids / viroids D. polysaccharides / capsomeres

B. proteins / capsomeres

From a plate count experiment in which you spread 0.1 ml onto each of two different agar plates from a 1:100,000 dilution of a culture, you count 125 colonies on one plate and 132 colonies on a duplicate plate. How many bacteria/ml were there in the original sample? A. 1.29 × 10^-8 B. 1.29 × 10^8 C. 1.29 × 10^7 D. 129

B.) 1.29 × 10^8 average colonies: (125 + 132)/2 =~129 dilution factor: 100,000 plating volume = .1 ml CFU (colony forming unit) = colonies x dilution factor/ plating volume CFU = (129 * 100,000)/.1 ml = 1.29 E 8 Thus, answer is B. 1.29 × 10^8

Which is NOT a difference between bacteriophages and animal viruses? A. Many animal viruses are enveloped. B. Many animal viruses replicate their genome within their host cell's nucleus. C. Animal viruses are classified by their genome. D. The entire virion of animal viruses enters the host cell.

C. Animal viruses are classified by their genome.

Horizontal gene transfer refers to the transfer of genes from one organism to another, as occurs during conjugation between bacteria. How does this differ from vertical gene transfer? A. In vertical gene transfer, genes are transferred by a vector such as a bacteriophage. B. In horizontal gene transfer, genes are transferred between two organisms of the same species. In vertical gene transfer, genes are transferred between two organisms of different species. C. In horizontal gene transfer, genes are transferred from one mature adult organism to another. In vertical gene transfer, genes are transferred from adults to offspring. D. Conjugation can involve horizontal or vertical gene transfer, depending on the physical orientation of the bacteria involved.

C. In horizontal gene transfer, genes are transferred from one mature adult organism to another. In vertical gene transfer, genes are transferred from adults to offspring.

The polymerase chain reaction, PCR, has revolutionized molecular genetics. Despite all of the advantages of PCR, it does have limitations. Which of the following is NOT a limitation of PCR? A. It is necessary to know something about the sequence of the DNA sample prior to amplifying a specific region. B. PCR is so sensitive that contamination can easily occur. C. It requires very pure and high-quality DNA samples. D. It is more error prone than most DNA replication.

C. It requires very pure and high-quality DNA samples.

During penetration of an Escherichia coli cell by the T4 bacteriophage, A. the envelope fuses with the cell membrane, allowing the phage nucleocapsid to enter the cell. B. integrase makes a pore in the cell wall, the tail sheath contracts, and the phage DNA is injected into the cell. C. T4 lysozyme makes a pore in the cell wall, the tail sheath contracts, and the phage DNA is injected into the cell. D. T4 lysozyme facilitates membrane fusion, allowing the phage to enter the cell.

C. T4 lysozyme makes a pore in the cell wall, the tail sheath contracts, and the phage DNA is injected into the cell.

Which of the following is NOT a way to genetically engineer vaccines? A. removing genes from the pathogen that encode virulence factors B. adding genes to a harmless virus that elicit an immune response to a pathogen C. adding the thymidine kinase gene from the vaccinia virus D. producing large amounts of immunogenic proteins by cloning

C. adding the thymidine kinase gene from the vaccinia virus

Which of the following require homologous recombination for incorporation of heritable new genes into the genome, meaning successful horizontal gene transfer? A. generalized transduction B. transformation C. generalized transduction and transformation D. specialized transduction

C. generalized transduction and transformation

If a researcher wanted to compare the enzymatic capacity to degrade compounds in a water column at various depths under a specific set of conditions, which would be the most useful approach? A. metagenomics B. metabolomics C. metaproteomics D. genomics

C. metaproteomics

Electrophoresis can be used to separate molecules by size, shape, and charge. When DNA samples are run in an electrophoresis gel, the different bands produced generally represent fragments of different sizes. Why is the size of the fragment the most critical factor in determining how far it migrates on a gel when DNA fragments are compared? A.The charge on DNA is so small that it has a minimal effect on movement in the gel. B.A special type of gel is used for DNA electrophoresis to minimize the effects of charge. C.DNA moves toward a positive charge due to the negative charge on its phosphate groups. The charge is consistent because all DNA nucleotides have a single phosphate group rather than having more diverse patterns of charges. Because the charge is relatively consistent, size is the most important factor determining how far fragments move. D.The shape of the DNA fragments has an even greater effect on movement than size or charge, so charge is relatively unimportant.

C.DNA moves toward a positive charge due to the negative charge on its phosphate groups. The charge is consistent because all DNA nucleotides have a single phosphate group rather than having more diverse patterns of charges. Because the charge is relatively consistent, size is the most important factor determining how far fragments move.

A microbial ecologist wants to study a bacterium that is adapted to growth in lake water containing very low nutrient concentrations. Assuming that a suitable growth medium is available for this organism, which type of culture would be best to use for growing this organism in the lab? A. This organism cannot be grown in the lab. B. On Petri plates containing a low-nutrient medium C. A batch culture using a low-nutrient medium D. A chemostat using a low-nutrient medium

D. A chemostat using a low-nutrient medium

Which of the following is NOT an obstacle for expressing cloned eukaryotic genes in Bacteria? A. Introns must be removed. B. Sequences may need editing due to codon usage. C. The host may not be able to perform post-translational modifications. D. All of the above are obstacles.

D. All of the above are obstacles.

Which of these organisms is likely to have the largest genome? A. an extremophile Archaean due to the demands of surviving in harsh environments B. an autotrophic bacterium C. a chloroplast D. a yeast cell

D. a yeast cell

Comparing the different generations of DNA sequencing, which would be most appropriate for a 10 Mbp piece of DNA that could not be fragmented? A. second generation B. first generation C. third generation D. fourth generation

D. fourth generation because it has the highest capability to process this amount of DNA efficiently

What might be a reason that a researcher would decide to use Northern blotting instead of Southern blotting? A. to determine whether gene amplification was used to increase transcription of a gene in a particular organism B. to determine the extent to which a gene is being translated in a particular tissue C. to compare the proteins present in different cells D. to determine the extent to which a gene is being transcribed in a particular tissue

D. to determine the extent to which a gene is being transcribed in a particular tissue

A cell culture in exponential growth contained 2.3×10^5 cells/ml at 1 pm, and at 3 pm the cell density was 1.6×10^8 cells/ml. How many generations did this amount of growth represent? A. 1.8 B. 2 C. 4.1 D. 9.2

D.) 9.2 n = [3.3(logN -logN_0)] n = 3.3[log(1.6E8) -log(2.3E5)] n=9.2

Which of the following is NOT true about conjugation in Archaea? A. Some strains have plasmids that mediate conjugation between cells, similar to Bacteria. B. Some Archaea form specialized structures for genetic exchange between cells, which does not involve a fertility plasmid. C. Thermococcus produces nanotubes that allow for bidirectional DNA transfer. D. Conjugative plasmids in Archaea encode most of the same tra genes found in Bacteria, thus the mechanism of conjugation is similar.

D.) Conjugative plasmids in Archaea encode most of the same tra genes found in Bacteria, thus the mechanism of conjugation is similar.

Which of the following is NOT included in the genome? A. coding regions of DNA B. Proteins C. genes that encode RNAs D. noncoding regions of DNA

Proteins

What structure can the viral genome take? ss-DNA ds-DNA ds-RNA All of the listed responses are correct.

all - ss-DNA, ds-DNA, ds-RNA

Considering T4 bacteriophage infection of a bacterial cell, which would be an example of the earliest phage proteins transcribed and translated? -capsid proteins -T4 lysozyme -portal proteins -enzymes for the synthesis and glucosylation of the unusual T4 base 5-hydroxymethylcytosine

enzymes for the synthesis and glucosylation of the unusual T4 base 5-hydroxymethylcytosine

When using a reporter gene to investigate expression of a target protein, the promoter of the ________ is ligated to the coding sequence of the ________. target gene / reporter gene reporter gene / target gene

target gene / reporter gene

If a restriction enzyme that recognizes GGCAT and cuts between the two guanine residues is mixed with DNA that has the sequence CCGATTATAATCCCGCGGCATATTAGGGCGG, how many pieces would the resulting product be?

two