micro test 3 question pt 2

If a restriction enzyme that recognizes GGCAT and cuts between the two guanine residues is mixed with DNA that has the sequence CCGATTATAATCCCGCGGCATATTAGGGCGG, how many pieces would the resulting product be? -three -four -two -one

two

What is the function of the primers in PCR? They provide energy for the DNA polymerization reactions. -They polymerize free nucleotides to form the new DNA strands. -They are the monomer building blocks from which the DNA strand is synthesized. -They provide a 3' end for the DNA polymerase.

-They provide a 3' end for the DNA polymerase.

What provides the energy for DNA polymerization in a PCR reaction? -DNA polymerase -Template DNA -Primers -Deoxyribonucleoside triphosphates

-Deoxyribonucleoside triphosphates

The rhizosphere is __________. -the soil immediately surrounding the root of a plant -the surface of the roots of a plant -all of the microorganisms living in soil -the top inch of soil that contains a large number of microorganisms

-the soil immediately surrounding the root of a plant

In a body of freshwater, the transition between the warmer upper layers and the colder lower layers of water is called the __________. -planktonic -thermocline -epilimnion- hypolimnion

-thermocline

What might be a reason that a researcher would decide to use Northern blotting instead of Southern blotting? -to determine the extent to which a gene is being transcribed in a particular tissue -to compare the proteins present in different cells -to determine the extent to which a gene is being translated in a particular tissue -to determine whether gene amplification was used to increase transcription of a gene in a particular organism

-to determine the extent to which a gene is being transcribed in a particular tissue

Metagenomics is a more sensitive analysis of community diversity than rRNA-based analyses because __________. -the extraction of the DNA from the environmental samples is more efficient -genes do not have to be amplified by PCR before being sequenced -more clone libraries can be assembled -rRNA genes are not found in all of the organisms present in the environment

genes do not have to be amplified by PCR before being sequenced

Bacterial abundance (102 to 108) and generation times (days to centuries) vary by many orders of magnitude in the deep subsurface mainly due to __________. -temperatures -variations in water availability -oxygen levels -nutrient limitations

-nutrient limitations

Plasmids are commonly used as cloning vectors because __________. -they can contain genes for antibiotic resistance used for plasmid selection -they can replicate independently of the chromosome -they are easily inserted into cells by transformation -All of the listed responses are correct.

-All of the listed responses are correct.

Why is DNA polymerase from Thermus aquaticus ideal for PCR? -It can withstand the high temperatures associated with PCR. -It does not require primers. -It does not require energy to polymerize DNA. -It can synthesize DNA 5' to 3' and 3' to 5'.

-It can withstand the high temperatures associated with PCR.

Initiation of biofilm formation in many organisms is at least in part regulated by c-di-GMP, which alters gene expression and enzyme activity leading to all of the following EXCEPT __________. -initiation of flagella formation -initiation of extracellular polysaccharide production -production of intercellular signaling molecules -formation of cell surface attachment proteins

-initiation of flagella formation

Bacteria will benefit as part of a biofilm because __________. -it allows them to be phagocytosed easier -it allows all compounds in the environment to diffuse to the organism's location much faster -it allows them to live separated from other bacteria -it allows them to remain in a favorable niche

-it allows them to remain in a favorable niche

Microarrays that have been designed to screen samples for specific groups of bacteria are called __________. -phytochips -microchips -phylochips -biochips

-phylochips

Enrichment cultures are often effective for isolating bacteria from complex communities in natural samples because they __________. -do not select for or against any bacteria; they help every organism to grow -select for certain bacteria -select both for and against certain bacteria -select against certain bacteria

-select both for and against certain bacteria

Microbial diversity in an ecosystem can be expressed as the number of different species present, which is termed __________. -species abundance -species richness -microbial population -microbial community

-species richness

Why is a special polymerase, such as Taq polymerase, required for PCR? -Taq polymerase adds bases more rapidly than other polymerases, allowing very rapid amplification. -Taq polymerase can add complementary bases in an extremely accurate way, resulting in a very low error rate. -Taq polymerase is produced by an extremophile prokaryote and is able to work at relatively high temperatures. -Taq polymerase can add DNA or RNA, allowing amplification of DNA or RNA.

-Taq polymerase is produced by an extremophile prokaryote and is able to work at relatively high temperatures.

Restriction endonucleases are found in nature. They are extremely useful for genetic engineering. Why do organisms produce them? -Organisms produce them as a way of allowing new genetic material to be inserted. -They are part of the viral life cycle and help in the assembly of new viruses. -Because they cut only at specific sequences in DNA, they are useful in cutting harmful DNA (such as viral DNA) without harming the organism that produces them (which can protect those sequences in its own DNA). -They are involved in DNA replication in prokaryotes.

-Because they cut only at specific sequences in DNA, they are useful in cutting harmful DNA (such as viral DNA) without harming the organism that produces them (which can protect those sequences in its own DNA).

When Beijerinck enriched for nitrogen fixers, he inoculated soil into two types of liquid media: one containing mineral salts and mannitol but no nitrogen source (flask A), and one containing mineral salts, mannitol, and an ammonium salt (flask B). After incubation in the presence of air, what types of organisms did he expect to find in each flask? -Flask A would contain ammonium utilizers, and flask B would contain nitrogen fixers that could grow without the presence of ammonium. -Flask A would contain nitrogen fixers that could not tolerate the presence of ammonium; flask B would contain ammonium utilizers. -Flask A would contain ammonium utilizers and flask B would contain nitrogen fixers that could not tolerate the presence of ammonium. -Flask A would contain nitrogen fixers that could grow both without ammonium; flask B would not contain nitrogen fixers but would contain organisms that could use ammonium.

-Flask A would contain nitrogen fixers that could grow both without ammonium; flask B would not contain nitrogen fixers but would contain organisms that could use ammonium.

Fluorescent in situ hybridization (FISH) can be used to determine __________. -whether a specific piece of mRNA is being produced -how many Salmonella typhimurium cells are present in a sample of unpasteurized apple juice -the phylogenetic diversity of an environmental sample -all of the listed conditions

-all of the listed conditions

To be successful, an enrichment culture for an environmental isolate must take into account __________. -osmotic conditions -nutrients -pH -all of the listed variables

-all of the listed variables

All of the following are true of biofilms EXCEPT that __________. -biofilms form on virtually all submerged surfaces in nature -biofilm formation and dispersal are regulated processes -biofilms are composed of only one species at a time -biofilms protect organisms from antibiotics

-biofilms are composed of only one species at a time

You would like to determine the rate of production of carbon dioxide in a specific microbial habitat. How could you do this without growing the microorganisms in the lab? -by using radiolabeled DNA -by using radiolabeled methane -by using a microsensor -by using radioisotope-labeled carbon dioxide

-by using a microsensor

By isolating total community RNA, using reverse transcriptase to make cDNA copies of it, and then sequencing the cDNA, ecologists can __________. -determine the community genome translation at the moment of sampling -determine the community metabolic activity at the moment of sampling -determine the community genome expression at the moment of sampling -determine the community genomic potential at the moment of sampling

-determine the community genome expression at the moment of sampling

Phylogenetic analysis of microbial communities in nature using various PCR techniques has revealed that only a minority of phylotypes have been cultured from the environment and the most common phylotypes have not been grown in in the laboratory. This is due in part to __________. -lack of sufficient sampling of the community -poor technique -the uncultured organisms' being rare in the community -enrichment bias

-enrichment bias

When a known single-stranded DNA probe is mixed with unknown nucleic acid sequences to look for similarity, it is called __________. -replica plating -hybridization -a blot -recombination

-hybridization

The phylogenetic diversity analysis of complex microbial communities often targets small subunit (SSU) ribosomal RNA genes. This is because rRNA is found in all organisms and __________. is easier to extract from samples -is highly conserved over evolutionary time -is made by cells only at certain times -has more genes than mRNA

-is highly conserved over evolutionary time

Select the option that lists the steps necessary for PCR analysis of a microbial community in the correct order. -PCR of target genes; microbial sample collection; DNA extraction; sorting by electrophoresis; analysis -microbial sample collection; DNA extraction; PCR of target genes; sorting by electrophoresis; analysis -microbial sample collection; sorting by electrophoresis; analysis; DNA extraction; PCR of target genes -microbial sample collection; PCR of target genes; DNA extraction; sorting by electrophoresis; analysis

-microbial sample collection; DNA extraction; PCR of target genes; sorting by electrophoresis; analysis

The best choice for estimating the viable cell number of a water sample would be the __________. -streak plating method -agar dilution tube method -most probable number technique -spectrophotometric method

-most probable number technique