Microbio Exam 3 HOMEWORK Questions

Recall: What is the function of the coagulase enzyme made by Staphylococcus aureus bacteria? Coagulase breaks down red blood cells Coagulase causes blood clots to form in the human host Coagulase prevents blood clots from forming in the human host Coagulase causes severe blistering of the skin Coagulase breaks down the connections between skin cells

Coagulase causes blood clots to form in the human host Coagulase results in blood clots that surround S. aureus and provides protection from the host immune system. Review the other virulence factors of S. aureus to make sure you can match structure:function!

You have an mRNA molecule with the following sequence: 5' GCAUGAUUUAUGAAAAGUGAGGGC 3' Use the genetic code from the question above to determine the length of the polypeptide that would result from the translation of this molecule. Hint: don't forget that you have to look for the start codon and ANY stop codon! 8 amino acids 6 amino acids 4 amino acids 5 amino acids Translation would not start because this sequence contains a stop codon

5 amino acids Translation begins at the first start codon, AUG. The start codon also results in the addition of the amino acid Met. Translation terminates when a stop codon is reached; in this case, UAG. Stop codons DO NOT encode amino acids.

Which of the following is an example of vector transmission? Select all that are true. Becoming ill after putting a contaminated pen in your mouth A disease acquired through sexual contact A bite from a mosquito that carries West Nile virus Eating lettuce contaminated with Salmonella bacteria A squirrel gets the plague after a bite from an infected flea

A bite from a mosquito that carries West Nile virus A squirrel gets the plague after a bite from an infected flea Recall that a vector is a LIVING, non-human organism that transmits a pathogen to the host. When mosquitos bite their human host or a flea bits a squirrel, they transfer pathogens. Note that a host can be a non-human animal.

Which of the following examples are opportunistic infections? (select all that apply) A patient stepped on a rusty nail and is now exhibiting symptoms of Tetanus A long term resident in a nursing home has had severe gastrointestinal distress after taking antibiotics for a different infection, culture indicates Clostridium difficile has taken over as the primary bacteria in the gut During a picnic several people become ill with diarrhea, fever, and vomiting. Tests show that they consumed Norovirus, which likely contaminated some food. A woman develops a Candida yeast infection in her genital tract after using a "pH balancing soap" that promised to keep women fresh as daisies.

A long term resident in a nursing home has had severe gastrointestinal distress after taking antibiotics for a different infection, culture indicates Clostridium difficile has taken over as the primary bacteria in the gut A woman develops a Candida yeast infection in her genital tract after using a "pH balancing soap" that promised to keep women fresh as daisies.

If you get sick from eating a rare burger contaminated with a pathogenic E. coli strain, which portal of entry did the microbe use? A mucus membrane Parenteral entry Entry through a vector Droplet transmission

A mucus membrane Portal of entry refers to how the microbes gets into the host..In this case, you ate it, so the entry was into the mucous membranes of your GI system. A burger is not alive ( this is not vector transmission). Make sure you are not mixing up portals of entry with the transmission routes (how the pathogen gets to the host)

Which of the following scenarios do you think would result in the highest Incidence of Disease? A new virus spreads via droplet an STI which spreads through sexual contact a pathogen that spreads via contaminated water a microbe that spreads through a tick bite

A new virus spreads via droplet Droplet transmission allows a microbe or virus to spread without actually touching a surface or another person. It just requires that people share the same air. This allows it to spread much easier than something that requires sexual contact. Contaminated water is something that we must also come into direct contact with and drink, which makes it harder to spread. Tick bites can often be avoided. Vector transmissions are often non-communicable (it cannot spread from person to person, only from vector to person)

Transcription of a gene is initiated when a polymerase binds to which site? An origin A promoter A start codon The two ribosomal subunits A DNA polymerase

A promoter Recall that transcription begins when RNA polymerase assembles at a gene's promoter. A promoter is a DNA sequence where transcription begins. An origin is where DNA replication begins, and a start codon is where translation begins. Note that DNA polymerase and RNA polymerase are NOT the same enzyme.

How does a microbe attach to the outside of a human cell? Endoenzymes in the microbe bind to exoenzymes on the host cell Proteins on the microbe bind to the capsule of the human cell. An adhesin on a microbe usually binds to the phospholipids of a human cell A protein or sugar on the outer surface of a microbe specifically interacts with a membrane protein of the human cell.

A protein or sugar on the outer surface of a microbe specifically interacts with a membrane protein of the human cell. Take a look at our drawing of adherence (the process by which microbes attach to a host cell. Proteins or sugars on the microbes (known as adhesins) recognize specific receptor proteins found on human cells. These proteins are normally part of or attached to the plasma membrane. Phospholipids are the lipid part of the plasma membrane, which are NOT usually part of the recognition process. The human receptors have a unique 3D shape that enables the specific interaction of a microbial molecule with a human protein. Capsules are found on microbes, not the human cell, and can be another way that microbes attach to a human cells. Remember that adhesins can be located on any of the outer structures of microbes (flagella, capsule, fimbria, etc)

Which of the following bacterial species produce hemolysins? Only S. aureus Only S. pyogenes Both S. aureus and S. pyogenes Neither S. aureus nor S. pyogenes

Both S. aureus and S. pyogenes Make sure you've reviewed the slides on S. pyogenes. The detection of hemolysins via blood agar is an important way doctors distinguish S. pyogenes from other Strep species. S. aureus also produces hemolysins.

Lab application: If you performed a conjugation experiment using a culture that contained only F- bacteria (one without a fertility factor), what would you observe? All of the F- bacteria would become F+ bacteria A small number of bacteria would perform conjugation without a fertility factor Genetic transfer would move the F- plasmid between cells Cells would transfer entire chromosomes to other cells Conjugation would not occur

Conjugation would not occur Conjugation requires a 'fertile' cell, which refers to one that contains a plasmid with the genes necessary for conjugation. Recall that F- refers to cells that DO NOT have a fertility plasmid. If a fertility plasmid is not present in any cells in the culture, no conjugation will take place.

Which of the following are true of endotoxins? Select ALL that are correct. Endotoxins are made by Gram negative cells Endotoxins are easily destroyed with heat Endotoxins cause a general inflammatory response High concentrations of endotoxins must be present to be lethal to people

Endotoxins are made by Gram negative cells Endotoxins cause a general inflammatory response High concentrations of endotoxins must be present to be lethal to people Compare exotoxins vs endotoxins. Exotoxins are acutely toxic, while high doses of endotoxins must be present to cause severe problems. Endotoxins are far less specific than endotoxins in what they target.they cause general inflammation. And endotoxins are much harder to destroy with heat than exotoxins (since they are lipids instead of proteins)

You have recently identified a new toxin produced by a bacterium. It is composed of protein, has high toxicity, and is heat affected. You also discover that it targets liver cells. Based on these characteristics, how would you classify this toxin? endotoxin exotoxin This is an LPS-based toxin This is an adhesin toxin

Exotoxin This toxin meets all the definitions of an exotoxin! Recall that adhesins are the molecules microbe use to stick to hosts, they are not toxins!

The bacteria that causes strep throat, Streptococcus pyogenes, produces a molecule called streptolysin that creates a pore in the membrane of our human cells. Based on this mechanism, you would describe streptolysin as a: (select all that are correct) Exotoxin Endotoxin Virulence factor Adhesin

Exotoxin Virulence Factor Streptolysin is clearly directly toxic to our cells. It kills through a specific mechanism (pore-forming) which indicates this is an exotoxin, not an endotoxin (a lipid that causes inflammation, not cell death directly!). Toxins are ONE type of virulence factor (factors that determine the extent and severity of disease)

How can you tell if you are looking at a DNA or RNA strand? (Select All Correct) If the strand has Uracil instead of Thymine and is Double Stranded it is DNA If the strand has Thymine instead of Uracil and is Double Stranded it is DNA If a ribosome is attached to it is an RNA strand If the strand has Uracil and is single stranded it is RNA

If the strand has Thymine instead of Uracil and is Double Stranded it is DNA If a ribosome is attached to it is an RNA strand If the strand has Uracil and is single stranded it is RNA Remember that RNA is a single strand of nucleotides, whereas DNA is double stranded. Uracil replaces Thymine in RNA strands. Ribosomes only bind to mRNA.

Helicobacter pylori is a microorganism that is known to cause anemia by stealing iron from a host. What kind of damage is this? Exotoxin Damage Direct Damage Indirect Damage Endotoxin damage

Indirect Damage

A patient gets sick after they received an injection with a syringe that was not properly sterilized. This scenario is an example of: Vector transmission Direct contact transmission Droplet transmission Indirect contact transmission

Indirect contact transmission The syringe is a FOMITE ( a non-living object that carries a pathogen to a new host)

How does an infection differ from a disease? Infection is when the host experiences mild symptoms, while a disease is when the host experiences serious symptoms Infections are caused by bacteria, while diseases can be caused by many different microorganisms Infection refers to the growth of a microbe within/on a host, while disease refers to the negative effects on the host Infections can be treated with antibiotics, while diseases cannot be treated with antibiotics

Infection refers to the growth of a microbe within/on a host, while disease refers to the negative effects on the host Recall that disease means any abnormal functioning of the body. When it comes to infectious diseases, this refers to the signs/symptoms that characterize a person's illness. Infection refers to the growth of the microbe itself. Some infections cause disease, while others do not. Some infectious diseases are treatable with antibiotics; others are not (e.g. polio). Infections can be caused by a variety of microbes, including bacteria, viruses, and eukaryotic pathogens. Diseases are caused by microbes and by other causes (e.g., cancer, heart disease, etc).

Which of the following statements is NOT TRUE of opportunistic pathogens? Opportunistic pathogens are dangerous for people with compromised immune systems, such as people with HIV. Opportunistic pathogens cannot cause severe diseases Opportunistic pathogens can live on our bodies and NOT cause disease. Opportunistic pathogens are dangerous for patients with severe burns and injuries.

Opportunistic pathogens cannot cause severe diseases

Some parts of our bodies support the growth of many microbes! Which part of our body is normally free of microbes? Our large intestine Our skin Our mouths Our muscles

Our muscles

During an oral surgery, the surgeon nicked the patient's gum with a sharp instrument. This allowed Streptococcus, a bacterium normally present in the mouth, to gain access to the blood and cause a heart infection. The portal of entry relevant to this situation is: Parenteral A mucous membrane The gastrointestinal tract The microbial adhesin

Parenteral

A gene's transcription requires the enzyme __________ binding to the __________ and adding __________:

RNA polymerase, promotor, nucleotides

Review: Describe the characteristics of the bacteria Staphylococcus epidermidis (hint: review lecture 1 of the semester if necessary) Rod shaped bacteria that form long chains Rod shaped bacteria that perform binary fission along random planes of division Spherical (coccus) bacteria found in long chains Spherical (coccus) bacteria that perform binary fission along random planes of division

Spherical (coccus) bacteria that perform binary fission along random planes of division The coccus suffix tells us these are round bacteria. The "staph" prefix tells us that these bacteria form grape-like clusters. Recall from the first week of the semester that this arrangement is the result of binary fission occurring on random planes. Division along one plane creates a chain, while division in random planes produces the random clusters observed with Staph bacteria.

Apply: A headache is an example of a ___________ of disease. symptom sign syndrome virulence

Symptom a headache is a subjective experience; therefore, this is an example of a symptom. A sign has to be able to be objectively measured (such as blood pressure), and a single symptom does not describe a syndrome (the combination of signs/symptoms that define a disease)

Currently, what is the major concern of doctors trying to prevent and treat MRSA infections? That human beta lactamase enzymes will no longer destroy MRSA That treatment with antibiotics will cause induced mutations That certain strains of S. aureus will become resistant to all available antibiotics That MRSA will gain the ability to live on our skin

That certain strains of S. aureus will become resistant to all available antibiotics The concern with MRSA is... what if we run out of options for effective antibiotics? Explanations for wrong answers: MRSA can already grow on our skin! It thrives in that environment. Treatment with antibiotics does NOT induce mutations, it just selects for the survival of mutant cells that are already resistant to the drug. The vast majority of S. aureus are resistant to penicillin, so this is not a new health concern and doctors have been using alternative drugs for many years. Recall that beta lactamase enzymes are bacterial enzymes (not human) that break down penicillin.

Certain Staphylococcus aureus strains produce a variety of dangerous exotoxins. Based on what you've learned about exotoxins, which of the following statements is true of these toxins? The exotoxins remain in the cell wall of S. aureus until cell death occurs. The exotoxins are lipids that activate the host immune system. The exotoxins are found primarily within the outer membrane of S. aureus. The exotoxins are proteins produced from the transcription and translation of certain S. aureus genes.

The exotoxins are proteins produced from the transcription and translation of certain S. aureus genes. Recall that exotoxins are proteins. Proteins are made from the transcription and translation of microbial genes. These exotoxins are then secreted from the microbial cell and can wreak havoc on the human host. Most of the wrong answer choices describe ENDOTOXINS which are different in structure (they are lipids) and function (they are embedded in the outer membrane of gram negative microbes)

Which of the following is NOT true of a capsule found on S. aureus? Hint: you've learned about capsules early this semester. Look back at your notes! A capsule is one type of glycocalyx found in prokaryotes The capsule prevents host immune cells from destroying these bacteria. The capsule contains sugars The capsule is made up of peptidoglycan

The capsule is made up of peptidoglycan Recall that peptidoglycan makes up the bacteria cell wall. The capsule is the sugary, often sticky outer surface that helps microbes attach to surface and prevents phagocytosis.

Imagine that a spontaneous mutation changes ONE nucleotide found within a microbial gene. Transcription of this mutated gene results in the following RNA molecule: The mutant protein will be shorter than normal, since a stop codon was introduced by the mutation The mutant protein will be the same length as the normal protein, but contain a different amino acid sequence The mutant protein will be longer than the normal protein and contain a different amino acid sequence The mutant and normal proteins will be identical, because the mutation will not affect the amino acids linked together during translation.

The mutant protein will be shorter than normal, since a stop codon was introduced by the mutation (Find the start codon in both molecules (AUG) and then read the next codon (the next 3 nucleotides) to figure out which amino acid will be inserted next. Continue for both molecules until you find the difference. Notice that the mutant sequence contains the sequence UGA after only 3 amino acids have been inserted. This means the mutation resulted in a stop codon that came earlier than the stop codon in the normal mRNA. The first stop codon the ribosome encounters terminates translation.)

The bacterium responsible for causing the plague (Yersinia pestis) infects ground squirrels and gophers. The bacterium is occasionally transferred to humans who have direct contact with infected animals. Based on this information, you can conclude that: Droplet transmission spreads the disease to human hosts Fomites on the wild animals are transferred to human hosts Transmission by a vehicle has occurred The plague is an example of a zoonosis

The plague is an example of a zoonosis Since the disease is transferred to people through animals, this is an example of a zoonosis. We cannot conclude this is droplet transmission, since droplet transmission involves the spread of pathogens between organisms that are close to each other (such as sneezing/coughing). This scenario did not describe a fomite, which is an inanimate object on which pathogens are transferred. This scenario did not describe a vehicle (such as water or air) that transferred the pathogen. The transmission described was direct contact, which is simply two organisms that touch each other!

During your laboratory bacterial transformation experiment, what was the outcome of a successful transformation? DNA was transferred through a conjugation bridge to a recipient cell The plasmid DNA was expressed, producing an exo-enzyme that neutralized the antibiotic the green fluorescent protein was secreted and killed the antibiotic naked RNA in the environment was taken up by the cell and made proteins the naturally resistant cell secreted a plasmid to neutralize the antibiotic.

The plasmid DNA was expressed, producing an exo-enzyme that neutralized the antibiotic The Transformation experiment is an example of horizontal gene transfer in which a plasmid outside of the cells was taken up by the e. coli. That plasmid had a gene that coded for an enzyme that neutralizes ampicillin. That enzyme that was synthesized, was then exported to the surrounding media where it degraded the ampicillin antibiotic. Note that a conjugation pilus refers to conjugation, not transformation. Conjugation is a different mechanism of horizontal gene transfer. the green fluorescent protein was a separate gene on the plasmid that, when expressed, turned the e. coli green. It was a visual indicator that transformation was successful. Naked DNA was taken up from the environment by a competent e. coli

Which of the following is NOT a step of prokaryotic DNA replication? The start codon is used to begin DNA synthesis Complementary bases bind to the parent strand of DNA Each new double helix contains one old DNA strand and one newly synthesized strand of DNA Replication is performed in both directions from the replication origin sequence DNA polymerase links together nucleotides to form a new DNA strand

The start codon is used to begin DNA synthesis The start codon is where translation begins, NOT DNA replication. The origin is where DNA replication begins.

How does the expression of the beta-lactamase gene give microbes resistance to pencillin? This gene encodes an enzyme that allows microbes to build a cell wall through a different pathway This gene encodes an enzyme that breaks a bond within a penicillin molecule The product of this gene converts penicillin into a less dangerous methicillin antibiotic This gene prevents host immune cells from ingesting S. aureus

This gene encodes an enzyme that breaks a bond within a penicillin molecule See the slides for a picture of the chemical reaction catalyzed by this enzyme. The enzyme breaks a bond in the ring found within pencillin, which inactivates the drug.

How does competitive exclusion provide protection from disease? Your normal microbiota prevent pathogens from growing Endosymbiosis prevents two species from living in close association Bacteria from different species cannot perform horizontal gene transfer. Our immune systems destroy all pathogenic bacteria

Your normal microbiota prevent pathogens from growing Two species competing for the same limiting resources cannot coexist at constant population values. When one species has even the slightest advantage over another, the one with the advantage will dominate in the long term ;This principle is very important to our health, since the presence of our normal microbial populations can prevent the growth of pathogenic specie

Which of the following is NOT a method of horizontal gene transfer? conjugation transformation binary fission transduction

binary fission Binary fission is the method of VERTICAL gene transfer in prokaryotes

Recall: Apply your knowledge of structures in prokaryotes and eukaryotes. How can transcription and translation occur at the same time, on the same strand of mRNA in Prokaryotes, but not eukaryotes? eukaryotes have a nucleus and ribosomes must be transported inside of it, whereas prokaryotes already have ribosomes inside theirs. in prokaryotes ribosomes exist within the nucleus, whereas in eukaryotes ribosomes only exist outside of the nucleus. eukaryotes have a membrane bound nucleus that compartmentalizes transcription, whereas prokaryotes do not and ribosomes can assemble as soon as the mRNA strand is long enough. in prokaryotes transcription and translation both occur from the DNA, where as in eukaryotes they have a membrane that separates them.

eukaryotes have a membrane bound nucleus that compartmentalizes transcription, whereas prokaryotes do not and ribosomes can assemble as soon as the mRNA strand is long enough. (Recall that one of the biggest differences between prokaryotes and eukaryotes is the presence of membrane bound organelles in eukaryotes. This means that in order for translation to occur in eukaryotes, the mRNA strand from transcription must be transported out of the nucleus to the cytoplasm (specifically the rough endoplasmic reticulum) where ribosomal subunits can bind the start codon and initiate transcription. In prokaryotes it is much easier because they do not have a membrane bound nucleus, just a nucleoid (or nuclear area) and any ribosomal subunits that are in proximity to actively transcribed mRNA can bind and begin the translation process.)

The ribosome is composed of protein and ________ which catalyze the formation of __________

rRNA; peptide bonds

A microbe that is part of your normal microbiota can cause an opportunistic infection, which option below is a way that this occurs? the microbe becomes a permanent resident of the body the microbe begins to metabolize substances on the skin the microbe gains access to a different part of the body than normal the microbe inhibits the growth of all other microbial species the microbe releases a large number of endospores

the microbe gains access to a different part of the body than normal Our microbiota are our normal residents, and many of them will be on our bodies for our entire lives. This is normal, and typically a good thing. Normal microbiota can become opportunistic pathogens when something changes, such as if the host's immune system is impaired or if the microbes change their location (such as if E. coli normally in the gut gets in your urinary tract).

Imagine that cows graze in a field that contains a well, and the farmer's family becomes ill with a gastrointestinal pathogen after drinking the well water. What type of pathogen transmission is this? vector transmission vehicle transmission direct contact transmission indirect contact transmission

vehicle transmission The contaminated water was the VEHICLE that carried the pathogen into the farmer's body.