MODULE 3
List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each.
-Origin of replication: ensures that the vector is replicated within the cells-Selectable markers: enable all cells containing the vector to be identified-Restriction sites: needed so a DNA fragment can be inserted
Describe the three basic components of a typical plasmid cloning vector and the reason/use for those plasmid vector components.
-contains polylinker, ampicillin-resistance gene, origin of replication-polylinker able to recognize several restriction enzymes, resistance gene allows for selective amplification, origin of replication so vector can replicate in host cell multiple restriction sites, an origin of replication site, and selectable markersRestriction sites: cut the plasmid and foreign DNA with the same enzyme and insert a gene.Origin of replication: new recombinant genes will be able to replicate and increase in #.Selectable markers: detect recombinant plasmids. Ex: lacZ gene produces B galactose but recombinant ones don't.
Which technique would NOT be used to find a gene for a functional protein in a sequenced region of a genome?
...a) See if a SNP database contains sequences in the region.
A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment.
1
A typical prokaryotic genome has 1000 base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few thousand genes. 1 million base pairs of DNA, containing a few hundred genes. 1 million base pairs of DNA, containing 1000 genes.
1 million base pairs of DNA, containing 1000 genes.
As a model system, what are three of the advantages of the mouse as a model system?
1) Close evolutionary relationship to humans2) Short generation time compared with that of most other mammals3) Well adapted to life in the lab (Require little space to raise and breed)4) Have large litters5) Large number of mutations have been isolated and studied already
List four applications of PCR technology. Do not describe what PCR *does* (well, you can if you want, but you won't get points for it). Instead, list activities or fields in which PCR is useful.
1) Identification of RE variants2) Screening for genetic disorders3) Diagnostic screening for infectious organisms4) Forensics5) Paleobiology6) Microsatellite analysis
Answer the following questions about standard PCR:1) What enzyme is required for PCR? State the specific name of the enzyme, not just the type of enzyme.2) Apart from the enzyme, what 3 DNA molecules are required (give the technical names by which they are called)? What must be true about the sequences of these molecules? Note that dNTPs are individual nucleotides, not DNA molecules.3) Name the three basic steps of PCR and describe the molecular processes that occur in each. How is each step induced?4) How does this system work to amplify DNA?
1. Taq polymerase2. deoxyadenine, deoxythymine, deoxycytosine, deoxyguanine-the sequence of these molecules must be complementary to one another so primers can bind to the DNA.(3 necessary DNA molecules: cDNA strand, 2 oligonucleotide flanking primers)3. Denaturation: the DNA strands separate. This step is induced by high heat (95˚C)Annealing/Hybridization: primers are allowed to anneal to their complement. This step is induced by a lower temperature than step 1 (35-62˚C)Primer extension: new DNA strands are synthesized using Taw polymerase. This step is induced by a temperature that matches the temperature Taq polymerase works at (68-72˚C).4. This system amplifies DNA by doubling the amount of DNA present after each cycle, making it an exponential growth. Thus, after a few rounds, DNA is copied millions of times.
Name and describe three different kinds of bacterial cloning vectors.
1.Plasmid cloning vector: It generally can load fragments of interest about 5-10kb long and it is derived from bacterial plasmids. It has polylinker regions, selection system, insert discrimination system and an origin of replication.2. Phage cloning vector: it can handle insert about 10-15kb; it is derived from bacterial virus (phage). To insert DNA fragments, the central third portion of the phage DNA, resulting in a left arm and a right arm and a centrol region. The fragments of interest then are inserted between the two arms, then ligated by DNA ligase. 3. Cosmid cloning vector: it can carry up to 50kb inserts; it is made of part phage and part plasmid, which makes it to an engineered vector 4. Bacterial Artificial chromosomes cloning vector
10% recombination is equal to how many map units? 1mu 10mu 100mu 1000mu
10mu
You are doing an experiment to characterize a 3000bp clone using two different restriction enzymes. Enzyme 1 (E1) produces 2 fragments in a single digest of 1400 and 1600bp. Enzyme 2 (E2) also produces 2 fragments of 1400 and 1600bp. When a double digest using both of these enzymes is done, it results in 2 fragments of 1400bp and 200bp. Based on this data, choose the correct restriction map from the choices given below.
2) 1400bp, 200bp, 1400bp
If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA?
3
Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion. 300, 700, 1000, 1200 400, 800, 1000 (2 of these) 400, 1200, 1600 700, 400, 1400, 2600 300, 700, 2200
300, 700, 1000, 1200
BamHI cuts the sequence 5′ G|GATCC 3′. Which of the following sequences would NOT be recognized by this enzyme?a) 5′ AGGATCCGTA 3′b) 5′ AGCGGATCC 3′c) 3′ CCTAGGATC 5′ d) 3′ TCCTTAAG 5′
3′ TCCTTAAG 5′
Rank from "roughest" to "fine detail" for the amount of resolution allowed by the following methods of mapping (1=roughest, 4=finest):
4 - Sequence map1- Linkage map2 - Cytogenetic map3 - Restriction map
A fragment of DNA is cloned into a plasmid with a sequencing primer binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. What was the sequence of the DNA strand that acted as the template in the sequencing reaction?
5' ACGATCG 3'5' GCTAGCA 3'5' CGATCGT 3'5' TGCTAGC 3'
What appears to be the range of number of protein-coding genes per genome in eukaryotes?
5000 to about 45,000
Before sequencing, the DNA fragment was cloned into a plasmid. On the strand that acted as the template in the sequencing reaction, what base of the cloned fragment was closest to the primer?GACT A
A
In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. What is a map unit, and why is it so different in these two different types of organisms?
A map unit is the distance on genetic maps based on percentage of recombination. This is the rate that the chromosome crosses over. The numbers are different because in general, multicellular eukaryotes have more DNA than simple, single-celled eukaryotes.
What is a vector?
A vector is a vehicle to carry recombinant DNA molecules into the host cells where independent replication can occur. Most common vectors are plasmids, bacteriophages, and cosmids.
What is the definition of a clone? a) An identical organism, or a cell that has been derived from a single ancestor b) A circular DNA molecule that is able to replicate by itself c) A new combination of DNA molecules that is not found naturally d) A non-identical organism produced by recombinant DNA technology
A) An identical organism, or a cell that has been derived from a single ancestor
a.chromosome spread b.protein c.plasmid d.centromere e.multiple hosts f.Taq polymerase g.DNA quantification h.protein/DNA interaction i.lacZ j.foreign DNA k.mRNA l.Agrobacterium tumefaciens
A). in situ hybridization B-expression vector C-cloning vector D-YAC E-shuttle vector F-PCR G-real-time PCR H- I-beta-galactosidase J-Transgene K-cdna library L-
You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment?
Accept anywhere from 28 to 30 cycles as a correct answer or the following equation
One of the dominant features of the immune system is the capacity to generate new cells that contain different combinations of antibodies. Because there are billions of such combinations it is impossible that each combination is coded by a separate gene. Explain in as much detail as you can how such diversity is accomplished in the case of the light chain of a typical antibody.
An antibody is a Y-shaped molecule that contains 4 chains (2 heavy and 2 light). There are two types of light chains and 5 types of heavy chains. Different combinations of chains create different types of antibody classes. Each mature B cells makes one type of light chain and one type of heavy chain. The light chain genes have many different regions
Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC series of plasmids?
An insert of DNA in the polylinker inactivates the lacZ component and allows identification of recombinant plasmids under proper genetic and environmental conditions.
What is a transgenic organism?
An organism that has been permanently altered by the addition of a DNA sequence to its genome. (GMO) An organism that stably carries a foreign gene within is genome
Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.
Antibodies are used for Northern blot analysis.c.VNTRs are highly conserved in human populations.
Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? DNA polymerase restriction enzymes specific for the target genes Both B and C DNA ligase
Both B and C restriction enzymes and dna ligase
What are three key differences between a genomic and a cDNA library?
CDNA lib. Represent only transcribed regions of the genomeAll genes equally represented in genomic library while cDNA library reflects the level of expression of a gene in a particular cell type or tissuecDNA library contained only sequences found in the mature mRNA- introns are removed -cDNA is enriched with fragments from actively transcribed genes-Introns do not interrupt the cloned sequences in cDNA-cDNA contains only sequences that are present in mature mRNA*cDNA = (complimentary DNA) DNA that is complimentary to a given RNA which serves as a template for the synthesis of DNA in the presence of reverse transcriptase.
CRISPR/Cas9
CRISPR-Cas: natural in bacteria and archaea; used to protect against phages, plasmids, and invading DNA elements -CRISPR RNAs (crRNAs) are encoded by DNA sequences called Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) -when foreign DNA enters cell, proteins cut up the DNA and insert bits of it into a CRISPR array to serve as memory of the invader -CRISPR array is transcribed into long precursor CRISPR RNA (pre-crRNA), which is cleaved into short crRNAs, which combine w/ proteins called CRISPR-associated (Cas) proteins to form effector complexes -Cas proteins have nuclease activity and can cut DNA; if memory foreign DNA is encountered in the future, the CRISPR-Cas complex cleaves it by crRNA and foreign DNA complementary binding Much more specific than restriction enzymes due to long nucleotide recognition sequence by RNA
A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________. chromosome sequence clone map contig
Contig
A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? An EST database of the human genome Microarray data of tissues in which the gene is expressed Data about the inheritance of SNP markers in families with the disease Information about bacterial orthologs of the gene Whole-genome-shotgun clones of the human genome
Data about the inheritance of SNP markers in families with the disease.*SNP = single nucleotide polymorphism ("snips"). Single nucleotide differs between members of a biological species or paired chromosomes.*EST = expressed sequence tags (aka Sequenced Tag Sites "STS") that are represented in mRNA. Used to identify gene transcripts. Play important role in gene discovery and sequence determination.
The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR? Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together. More than one of these answers is correct. Each cycle includes a "hot" saturation phase (95oC), which allows the primers to anneal to the target DNA. Each cycle includes a "hot" denaturation phase (95oC), which serves to sterilize the culture. Each cycle includes a "hot" denaturation phase (95oC), which activates the Taq polymerase.
Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together.
What is meant by the designation EcoRI?
EcoRI is an endonuclease from E coli. it is a restriction enzyme.
Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.
Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes orGenes are more densely spaced in prokaryotes verses eukaryotes orProkaryotic genomes typically encode fewer genes than eukaryotic genomes
There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? Eukaryotic: repetitive DNA Prokaryotic: repetitive DNA Eukaryotic: ESTs Prokaryotic: presence of plasmids Eukaryotic: circular DNA
Eukaryotic: repetitive DNA
Describe the standard PCR method (in sufficient detail) and how this process is able to produce clones in a "cell-free" system.
First, the DNA sequences of the desired target region must be known so that single stranded DNA primers flanking the DNA region of interest. Next, template target DNA is mixed with the single stranded primers, a novel heat tolerant polymerase (Taq polymerase), free nucleotides, and salts, in an in-vitro system. The temp. Is raised to 95 degrees to denature the double stranded DNA molecules. The solution is then cooled to 35-60 degrees to allow the single stranded primers to anneal to their targets. The temp is then raised to 68-72 degrees where the Taq polymerase functions, replicating the region, and the entire process is able to be done in an in-vitro system, resulting in up to million of copies (clones) from a single DNA template target
Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map?
Gene mapped based on recombination will appear to be very close together in centromeric regions due to low rates of recombination.Distances between the same genes on the physical map may be much greater when compared to their regions of the chromosomes
This is the study of "all genes in an organism in their entirety."
Genomics
The_________________ is an international effort to construct a physical map sequence of the 3.3 billion base pairs in the haploid human genome.
Human Genome Project
Figure A below shows a restriction map of a rare prokaryotic gene with its direction of transcription indicated by the arrow. Figure B shows the unique cloning region (i.e., multiple cloning site) contained within a plasmid-cloning vector. The blackened region in Figure A represents the amino acid coding sequence of a protein that can be used in humans as a vaccine. The stippled region in Figure B is a highly active, constitutive (unregulated) prokaryotic promoter region. Letters indicate the cleavage sites for different restriction enzymes. Known gene sequences are indicated by short thick lines. Explain how you would isolate and fuse the coding region (Figure A) behind the indicated promoter in the cloning vector (Figure B) to produce large amounts of the protein in bacterial cells. Assume that the cloning vector carries the gene for tetracycline (an antibiotic) resistance. Letters represent different restriction enzymes
I would use restriction enzyme (RE) C with either RE D or RE B to clone the gene in the expression vector so that the beginning of this gene is directly 3' of the strong promoter.
All of the following are characteristics of the genomics revolution EXCEPT_____________ Facilitated collaborative research networks Enabled reverse genetics approach to genetics research Ability to conduct discovery-based research Inability to understand single genes Large scale acquisition of DNA sequences
Inability to understand single genes
Mario Capecchi, Sir Martin Evans, and Oliver Smithies recently won a Nobel Prize for gene targeting (gene knockouts) in mice. Describe the steps involved in creating a knockout mouse.
Insert the knockout gene into embryonic stem cells. Grow transformed ES cells on medium. Select surviving ES cell colonies, test for presence of knockout gene, grow up culture of knockout cells. Insert ES cells into blastocyst. Mate chimera to black mice. Test agouti progeny for presence of knockout gene. Mate siblings to establish homozygous lines.
which of the below are not steps in the production of genome sequence maps: -All of these are steps you would use. -When sequences are obtained, assemble and organize the sequences in order. -Read the sequence of individual piece of the genome. -Isolate whole chromosomes. -Identify molecular markers on specific chromosomes.
Isolate whole chromosomes.
The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number? Every gene can be read in both directions, and each gene can have inversions and translocations.There are more exons than introns. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes. It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing. There are more introns than exons.
It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing
What is the purpose of the LacZ gene in a plasmid cloning vector?
It is used as a selectable marker. The gene contains a series of unique restriction sites where a fragment of DNA can be inserted and cloned.
You are handling a paternity lawsuit brought against five potential fathers by a woman. You isolated DNA from the mother, the child, and all the potential fathers. After using PCR to amplify specific polymorphic loci from each individual, you fractionate the amplified products on an agarose gel and stain with ethidium bromide to visualize the DNA fingerprints (shown below). Mo = mother; Ch = child; M1-M5 = potential fathers. Do these results confirm that any of the men are the child's biological father? Explain your answer.
M4 could be the father. We can exclude all other males because the child has at least one band that is not present in the mother or any of the potential father except for M4.
The smallest number of clones that represents the entirety of the genome are called what?
Minimum tiling path
Cloning reactions are done with DNA that has been cloned by restriction digestion and not by PCR. Using what you know about the way PCR works, why would you not want to use DNA from PCR to create DNA for cloning?
Normally in DNA replication, polymerase makes errors one out of every 1010 nucleotides inserted. Additionally, Taq polymerase used in PCR is less faithful because it does not have a proofreading subunit. Because PCR amplifies from previous sequences, if an error is made early on it will be proliferated in the sequence.
What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined.
Northern analyses are used for screening mRNA to determine expression characteristics of a gene. mRNA is extracted, isolated and then separated by electrophoresis. After electrophoresis, the sample is transfered to a nylon membrane and transfered via capillary action. Levels of gene expression can be determined using microarrays.Northern blotting is a procedure used to transfer RNA from a gel to a solid support.1) RNA isolation 2) Probe generation 3) Denaturing agarose gel electrophoresis 4) Transfer to solid support Step5) Hybridization with probe Step6) Washing Step7) DetectionLevels of gene expression are determined by running a sample RNA on same gel to provide accurate sizing ladder or by the use of microarrays
A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons.
OH, 2', 3'
In Drosophila melanogaster, cut wings (ct) is recessive to normal wings (ct+), sable body (s) is recessive to gray body (s+), and vermilion eyes (v) is recessive to red eyes (v+). All three recessive mutations are X-linked. A female fly with cut wings, sable body, and vermilion eyes is crossed to a male with normal wings, gray body, and red eyes. The F1 females produced by this cross were mated with cut, sable, vermilion males in a testcross. The following are the progeny resulting from the testcross. v ct s 510 v+ ct s 1 v+ ct+ s 14 v+ ct+ s+ 500 v+ ct s+ 73 v ct s+ 20 v ct+ s 81 v ct+ s+ 1 Total → 1200 a. Determine the order of these genes on the chromosome. b. Calculate the map distances between the genes. c. Determine the coefficient of coincidence and the interference among these genes.
Option B is the answer . v+ ct+ s 14 v ct s+ 20 the distance between the s -v gene is 14+20+1+1 /1200 *100 equal to 3.0 cM v ct+ s 81 v+ ct s+ 73 The distance between the v-ct gene is 81+73+1+1/1200*100 equal to 13.8cM
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by None of the above Knowing the isoelectric points of the piece in question. Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest Identifying the molecular weights of the fragments in question Measuring the sizes of the bands on the gel
Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest
Which technique would NOT be used to find a gene for a functional protein in a sequenced region of a genome?Scan the region for promoter sequences. Scan the region for intron splice sites. Scan the region for ORFs. See if a SNP database contains sequences in the region. See if an EST database contains sequences in the region.
See if a SNP database contains sequences in the region.
Compare the fields of structural, functional, and comparative genomics. What is the purpose of each?
Structural genomics- is concerned with organization and sequence of a genome,Functional genomics- characterizes what sequences or genes do Comparative genomics- compares similarities and differences in gene content, function, and organization among genomes of different organisms
You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful?
The RE must have complementary sticky ends so that they will anneal together The overhangs must be complementary for them to anneal and be sealed by DNA ligase.complementary tails. (?)
Explain why the genetic map distance between two genes on the same chromosome may be inconsistent with the physical map distance. E.g., for three loci A, B, and C, on the same chromosome, explain why the genetic distance might be A-[20 centimorgans]-B-[20 cM]-C, while the physical distance might be A-[200 kilobases]-B-[100 kb]-C.
The genetic map distance is measured by using the recombinant frequency. It shows the relative distance between different genes on a chromosome in the unit of centimorgan. The physical map distance is measured objectively and directly in the unit of nucleotide base.
Explain why the greatest diversity of human SNPs is found among African people.
The greatest diversity of human SNPs is found in African people because studies suggest that humans first evolved in Africa. Since Africans have been around the longest they have had the greatest amount of time to create SNPs. These populations are the oldest with the greatest amount of time to accumulate polymorphisms
In the polymerase chain reaction, what is the purpose of the initial high temperature? What is the purpose of cooling in the second Step?
The initial high temperature will denature the double stranded DNA. The cooling allows for the primers to anneal.
Of the DNA sequences below, which would probably be the harder to determine? 1-26CGATATATATATATATACGATGGCATCACGAGCTGCATTCGCA
The repetitive region in "A" would make it harder to determine with certainty, even though it is shorter than "B"
Compare the transcriptome of an organism with the proteome. What is described by each? Which one will generally have more macromolecules, and why?
The transcriptome contains more components because it is identifying all of the RNA molecules that are transcribed. The proteome contains all of the proteins encoded. Some of the proteins can be coded by the same RNA sequence so there are less components.
The transcriptome of a genome contains more components than the proteome. Explain why this is true.
The transcriptome contains more components because it is identifying all of the RNA molecules that are transcribed. The proteome contains all of the proteins encoded. Some of the proteins can be coded by the same RNA sequence so there are less components.
Assume that one conducted a typical cloning experiment using pUC18, transformed an appropriate host bacterial strain (one carrying the lacZ complementing region), and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant pUC18? Explain your answer. The white colonies would most likely contain the recombinant pUC18 because they are not blue. If they were blue, then that would mean that the lacZ gene is functioning normally, and the lacZ gene didn't pick up the foreign gene.
The white colonies would most likely contain the recombinant pUC18 because they are not blue. If they were blue, then that would mean that the lacZ gene is functioning normally, and the lacZ gene didn't pick up the foreign gene.
Why are telomeres and centromeres particularly difficult to sequence?
They consist of highly repetitive DNA, and so strand slippage issues can confuse the determination of a consensus sequence.
Which of the following statements about ddNTPs is true? DNA polymerase can add a new dNTP to a 3′ ddNTP. They have an oxygen at the 2′ carbon of the ribose sugar.They have a free 3′‑hydroxyl group on the ribose sugar.They have a hydrogen at the 3′ carbon of the ribose sugar.
They have a hydrogen at the 3' carbon of the ribose sugar
Explain why genetic and physical map distances may differ in relative distances between two genes on a chromosome.
They have available to them two broad categories of maps: genetic maps and physical maps. Both genetic and physical maps provide the likely order of items along a chromosome. However, a genetic map, like an interstate highway map, provides an indirect estimate of the distance between two items and is limited to ordering certain items. Once could say that genetic maps serve to guide a scientist toward a gene, just like an interstate map guides a driver from city to city. On the other hand, physical maps mark an estimate of the true distance, in measurements called base pairs, between items of interest
What is the function of dideoxynucleotides in Sanger DNA sequencing? They cut the sequenced DNA at specific sites. They act as primers for reverse transcriptase. They act as primers for DNA polymerase. They allow only the specific sequencing of the RNAs of a genome. They stop synthesis at a specific site, so the base at that site can be determined.
They stop synthesis at a specific site, so the base at that site can be determined.
The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. Screening of genomic libraries of several other organisms reveals that all of them contain only one genomic clone -- pigs seem to be the exception to the rule here. What evolutionary events might have led to the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? How is this representative of a general type of occurrence in molecular genetic evolution?
This gene was most likely present in a common ancestor, the presence of two copies could be from gene duplication and the increase in length could be due to elongation of repeats included in the sequence. Divergence of genes is a common occurrence in genomic evolution, so this is a likely explanation for the discrepancy.
What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?
To determine if the vector is present in host cell To determine if the vector is present in host cell. The antibiotic resistant gene provides a selectable marker for cells
Name 2 methods that have been used to produce mutations in a forward genetics approach.
UV light EMS Nitrosoguandandine transposons
We have looked at the cloning experiments involved in producing Snuppy. Describe the specific technique that was used and how the results demonstrated that Snuppy was in fact a clone of the donor Afghan hound.
Used microsatellite analysis of canine-specific microsatellites for 8 different canine markers between the donor-dog and Snuppy. Both reached the same peak for each loci, therefore, they must be clones. Microsatellite analysis was used to show that snupppy was a clone. Microsatellite loci are highly variable loci that contain a large number of DNA repeats (eg. 2, 3, or 4 nucleotides in length) at the population level. However, an individual can only have 2 of these alleles at any one microsatellite locus. By comparing the alleles that snuppy had at 8 different microsatellite loci with those allele that the donor afghan hound and the surrogate mother had, it was shown that snuppy had exactly all of the same alleles as the afghan hound, providing that snuppy was a clone of the donor afghan
The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans? Your Answer:
You could generate cDNA libraries and compare the transcribed regions of the genome
A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites?
a 8-kb fragments
What is bioinformatics? -a method that uses very large national and international databases to access and work with sequence information -a series of search programs that allow a student to identify who in the world is trying to sequence a given species -a software program available from NIH to design genes -a technique using 3D images of genes in order to predict how and when they will be expressed
a method that uses very large national and international databases to access and work with sequence information
PCR is None of the answer options necessary for efficient replication of cell's DNA in interphase a technique for amplifying DNA sequences in vitro one of the control elements of the cell cycle
a technique for amplifying DNA sequences in vitro
Plasmids are important in biotechnology because they are surfaces for respiratory processes in bacteria a vehicle for the insertion of foreign genes into bacteria recognition sites on recombinant DNA strands surfaces for protein synthesis in eukaryotic recombinants
a vehicle for the insertion of foreign genes into bacteria
How does shotgun cloning differ from the clone-by-clone method? a) No genetic or physical maps of the genome are needed to begin shotgun cloning. b) The location of the clone being sequenced is known relative to other clones within the genomic library in shotgun cloning. c) The entire genome is sequenced in the clone-by-clone method, but not in shotgun sequencing. d) Computer software assembles the clones in the clone-by-clone method.
a) No genetic or physical maps of the genome are needed to begin shotgun cloning
What properties must a molecule have to serve as a vector? a) It should contain a selectable marker. b) It should be able to replicate itself independently, contain a number of unique restriction sites that would enable the insertion of DNA fragments cut with the same enzyme, carry a selectable marker, and be easy to retrieve. c) It must be a bacterial plasmid. d) It should require insertion into the host genome to replicate, contain a number of restriction enzyme cleavage sites, and contain more than one cleavage position for a particular restriction enzyme.
b) It should be able to replicate itself independently, contain a number of unique restriction sites that would enable the insertion of DNA fragments cut with the same enzyme, carry a selectable marker, and be easy to retrieve.
A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that
bacteria cannot remove eukaryotic introns.
For a physical map of a chromosome, distances are measured in units of base pairs. contigs. RFLPs. centiMorgans. percent recombination.
base pairs
The "distance" between two linked gene pairs can be expressed as a percentage. Name the unit based on percent recombination that was created in honour of the scientist who pioneered the use of fruit flies for genetic research.
centimorgan?
Name the two strategic methods that scientists are using to sequence genomes.
clone-by-clone method and shotgun cloning
What is a cDNA molecule?
complimentary DNA molecule - genes that are transcribed - found only in mature RNA, so introns are removed. (A cDNA molecule is a DNA copy of an RNA molecule. Or complementary DNA.) Name the two
The Human Genome Project, which got under way in 1990, is an international effort to construct a physical map of the 3.3 billion base pairs in the human genome. collect plant seeds in order to reduce the impact of human activity on plant extinction. clone beneficial genes from humans for eventual use in gene therapy. collect samples of cells from all parts of the world in order to preserve human genetic diversity. clone deleterious genes from humans and study their mode of action
construct a physical map of the 3.3 billion base pairs in the human genome.
What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? All produce DNA chains as a product. All produce lipid as a product. All produce RNA as a product. All produce RNA as a product.
d) All produce DNA chains as a product.
Which of the following statements about manual Sanger sequencing is true? a) The template sequence is directly obtained b) The DNA sequence is read from the top of the gel to the bottom. c) Each of the four terminating ddNTPs is labeled with the same fluorescent dye. d) The DNA sequence obtained is complementary to the template strand.
d) The DNA sequence obtained is complementary to the template strand.
Is it possible for two different genes located on the same chromosome to assort independently? Explain your answer.
d. Yes, if the genes are far enough apart on the same chromosome, a crossover occurs between them in just about every meiotic event.
During gel electrophoresis, __ will migrate more rapidly than __.a. cloning vectorsb. ethidium bromidec. large DNA fragmentsd. DNA size markerse. small DNA fragments
e,c
One of the primary reasons for the necessity of generating a large number of clones in a eukaryotic genomic library is that each vector can take up only a relatively small fraction of the eukaryotic DNA. -each cosmid replicates nonautomously. -the host range of the vector is limited -lysogenic phage continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones. -each ligation product is sequence specific.
each vector can take up only a relatively small fraction of the eukaryotic DNA.
A BLAST search is done to: a) find the chromosomal location of a sequence. b) predict the 3D structure of a protein from its amino acid sequence. c) find similar gene or protein sequences. d) find restriction sites and SNPs in a sequence. e) determine the conditions under which a gene is expressed.
find similar gene or protein sequences.
This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.
genome project
List two especially useful characteristics of cloning vectors.
high copy number and antibiotic resistance gene(s)
Closely related genes based on sequence and function.
homolog
Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally cleaves RNA with restriction endonucleases hybridizes filter-bound RNA with a DNA probe. examines amino acid substitutions with radioactive probes. hybridizes filter-bound DNA with a DNA probe ligates DNA with DNA ligase.
hybridizes filter-bound DNA with a DNA probe
0.1% frequency of recombination is observed on unlinked chromosomes in genes located very close to one another on the same chromosome only in sex chromosomes in any two genes on different chromosomes
in genes located very close to one another on the same chromosome
Compared with prokaryotic chromosomes, eukaryotic chromosomes are large, mainly organized in polycistronic transcription units without introns. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns. small, mainly organized in polycistronic transcription units without introns. large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns.
large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.
Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.
less
Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression).
microarray
A _______________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene.
multigene
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites?
multiple cloning site
A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment.
one
Which of the following elements is not found in most eukaryotic genomes?a) Intronsb) Operonsc) low gene density d) repetitive sequences
operon
homologous genes of the same locus inherited from a common ancestor
ortholog
Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called _______________ .
orthologs
genes related by gene duplication in the genome
paralog
A map of the distribution of cloned genomic DNA from genomic clone libraries.
physical map
A map of the order, overlap, and orientation of physically isolated pieces of the genome.
physical map
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? consensus sequence polylinker complementation β-galactosidase palindrome
polylinker
A PCR technique that fills in small gaps by using the end of a cloned sequence as a primer to amplify into adjacent uncloned fragments.
primer walking
The set of all proteins encoded by the genome is called the _______ .
proteome
A gene construct that indicates when transcription occurs because the protein is easily identified (often GUS or GFP).
reporter gene
Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? reverse transcriptase isolation of stem cells from a lamb embryo and production of a zygotic equivalent DNAse gene cloning hydrogen sulfide
reverse transcriptase
Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? single stranded complementary tails blunt ends interference 5' cap poly-A sequences
single stranded complementary tails
Compared with eukaryotic chromosomes, bacterial chromosomes are large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in polycistronic transcription units without introns. large, triple-helix, Z-DNA, organized in monocistronic units with introns. small, with high gene density.
small, with high gene density.
conservation of the same groups of genes in the chromosomes of 2 or more species
synteny
What is the specific application of reverse transcriptase in the preparation of cDNA?
synthesis of DNA to form an RNA-DNA duplex
What is a concise definition of proteomics?the process of defining the complete set of proteins encoded by a genome the harvesting of proteins from a cell to determine their economic valuethe manipulation of amino acid sequences in proteins to alter their functionchanging the terminal sequences of proteins to alter their functionthe rational design of drugs based on protein structure
the process of defining the complete set of proteins encoded by a genome
When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that the primary structures may differ, but the secondary structures are identical. the two proteins have identical tertiary structures. the two proteins have identical functions. the two proteins share a common ancestry. the two proteins have no common origin.
the two proteins share a common ancestry
What is the enzymatic function of restriction enzymes? to repair breaks in sugar-phosphate backbones to cleave nucleic acids at specific sites to add new nucleotides to the growing strand of DNA to join nucleotides during transcription.
to cleave nucleic acids at specific sites
What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?
to remove viral/pathogenic DNA.
What term is used to refer to the process in which DNA can be introduced into host bacterial cells?
transformation
The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. epistasis analysis, enhance visual examination, eliminate temperature extremes, enhance complementation analysis, enhance chemical removal, activate
visual examination, eliminate