Module 3 Test Bank
Name the 2 strategic methods that scientists are using to sequence genomes.
1) Clone-by-clone method 2) Shotgun cloning
You determine that you only have 3 copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (10⁹) copies of the fragment?
3 x 2ⁿ = > 1 billion --> n = 28-30 cycles
What is meant by the designation EcoRI?
EcoRI is an endonuclease from E. coli; it is a restriction enzyme.
What is the purpose of the LacZ gene in a plasmid cloning vector?
It is a selectable marker used to distinguish those colonies with an inactivational insert using blue/white selection
A gene construct that indicates when transcription occurs because the protein is easily identified (often GUS or GFP).
Reporter gene
What term is used to refer to the process in which DNA can be introduced into host bacterial cells?
Transformation
For a physical map of a chromosome, distances are measured in units of: a) base pairs b) contigs c) percent recombination d) centiMorgans e) RFLPs
a) base pairs
The set of all proteins encoded by the genome is called the ________. a) pharmacogenome b) proteome c) glycol d) genome e) metabolome f) transcriptome
b) proteome
If a restriction enzyme cutes a circular DNA into 3 fragments, how many restriction sites are there in the DNA? a) 5 b) 2 c) 3 d) 4 e) 6
c) 3
A typical prokaryotic genome has: a) 1000 bp of DNA, containing few thousand genes. b) 1 million bp of DNA, containing a few hundred genes c) 1000 bp of DNA, containing few hundred genes d) 1 million bp of DNA, contains 1000 genes
d) 1 million bp of DNA, contains 1000 genes
A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a ______. a) clone b) chromsome c) sequence d) contig e) map
d) contig
All of the following are characteristics of the genomics revolution EXCEPT: a) Enabled reverse genetics approach to genetics research b) Facilitated collaborative research networks c) Ability to conduct discovery-based research d) Large scale acquisition of DNA sequences e) Inability to understand single genes
e) Inability to understand single genes
YAC a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
h) centromere
PCR a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
i) Taq polymerase
Describe the standard PCR method (in sufficient detail) and how this process is able to produce clones in a "cell-free" system.
1) DNA sequences of the desired targeted region must be known to select ssDNA primers that can flank the region of interest. 2) Template target DNA is mixed with ssDNA complementary primers, Taq pol, free nt, and salts in an in-vitro system. 3) Temperature is raised to 95ºC to denature the dsDNA molecules. 4) Temperature is cooled to 35-65ºC so that the ssDNA primers can anneal to their targets. 5) Temperature is raised to 68-72ºC for Taq pol function/replication. 6) The process repeats, with the newly synthesized DNA acting as a template for the next round, thereby resulting in millions of copies (clones) from a single DNA template target within a test tube (i.e., "cell-free system).
Rank from "roughest" (1) --> "fine detail" (4) the amount of resolution allowed by the following methods of mapping: • Cytogenic map • Sequence map • Linkage map • Restriction map
1) Linkage map 2) Cytogenic map 3) Restriction map 4) Sequence map
What appears to be the range of number of protein-coding genes per genome in eukaryotes?
5000 to about 45,000
What is a cDNA molecule?
A molecule of DNA complementary to an RNA molecule; genes that are transcribed; found only in mature RNA, with introns removed
In the context of recombinant DNA technology, what is meant by the term vector?
A vector is a vehicle to carry recombinant DNA molecules into the host cells where independent replication can occur. Most common vectors are plasmids, bacteriophages, and cosmids.
Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC region of plasmids?
An insert of DNA in the polylinker inactivates the lacZ component, allowing identification of recombinant plasmids under proper genetic and environmental conditions.
The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nt. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequences and found to be 1900 and 2100 nt long from start codon to stop codon. How would you explain the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe?
Either there was a duplication of this gene in pig, in which the duplication of the gene led to divergence, or humans lost one copy of the gene
The lungfish P. aethiopicus has a genome 38x larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans?
Generate cDNA libraries and compare the transcribed regions of the genome
This is the study of "genes in their entirety."
Genomics
Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to a glass that can be fluorescently labeled to identify levels of expression).
Microarray
The smallest number of clones that represents the entirety of the genome are called what?
Minimum tiling path
Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called _________.
Orthologs
What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?
To determine if the vector is present in the host cell.
What is the definition of a clone? a) An identical organism, or cell that has been derived from a single ancestor. b) A circular DNA molecule that is able to replicate by itself. c) A new combination of DNA molecules that is not found naturally. d) A non-identical organism produced by recombinant DNA technology.
a) An identical organism, or cell that has been derived from a single ancestor.
There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? a) Eukaryotic: repetitive DNA b) Eukaryotic: circular DNA c) Prokaryotic: presence of plasmids d) ESTs e) Prokaryotic: repetitive DNA
a) Eukaryotic: repetitive DNA
Which technique would NOT be used to find a gene for a functional protein in a sequence region of a genome? a) See if a SNP database contains sequences in the region. b) Scan the region for intron splice sites. c) Scan the regions for ORFs. d) Scan the region for promoter sequences. e) See if an EST database contains sequences in the region.
a) See if a SNP database contains sequences in the region.
What is the function of dideoxynucleotides in Sanger DNA sequences? a) They stop synthesis at a specific site, so the base at that site can be determined. b) They cut the sequence DNA at specific sites. c) They allow only the specific sequencing of the RNAs of a genome. d) They act as primers for reverse transcriptase. e) They act as primers for DNA polymerase.
a) They stop synthesis at a specific site, so the base at that site can be determined.
Beta-galactosidase a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
a) lacZ
What is the enzymatic function of restriction enzymes? a) to cleave nucleic acids at specific sites b) to add new nt to the growing strand of DNA c) to join nt during transcription d) to repair breaks in sugar phosphate backbones
a) to cleave nucleic acids at specific sites
Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATATACGAT b) GGCATCACGAGCTGCATTCGCA
a); the repetitive "TATA" region would make it harder to determine with certainty, despite the sequence being shorter than b)
You are doing an experiment to characterize a 3000 bp clone using two different restriction enzymes. Enzyme 1 (E1) produces 2 fragments in single digest of 1400 and 1600 bp. Enzyme 2 (E2) also produces 2 fragments of 1400 and 1600 bp. When a double digest using both of these enzymes is done, it results in 2 fragments of 1400 bp and 200 bp. Based on these data, choose the correct restriction map from the choices given below. a) 1400 bp/E1 and E2/1600 bp b) 1400 bp/E1/200 bp/E2/1400 bp c) 1000 bp/E1/200 bp/E2/1400 bp d) 1400 bp/E1/1400 bp/E2/200 bp
b) 1400 bp/E1/200 bp/E2/1400 bp
A fragment of DNA is cloned into a plasmid with a sequencing primer binding site. After dideoxy sequencing, the gel pattern shown in this diagram is obtained. What was the sequence of the DNA that acted as the template in the sequencing reaction? http://img.photobucket.com/albums/v243/shibx0r/r2-1.png a) 5' ACGATCG 3' b) 5' GCTAGCA 3' c) 5' CGATCGT 3' d) 5' TGCTAGC 3'
b) 5' GCTAGCA 3'
Before sequencing, the DNA fragment was cloned into a plasmid. On the strand that acted as template in the sequencing reaction, what base of the cloned fragment was closest to the primer? http://img.photobucket.com/albums/v243/shibx0r/r2-1.png a) G b) A c) C d) T
b) A
What is bioinformatics? a) A technique using 3D images of genes in order to predict how and when they will be expressed. b) A method that uses very large national and international databases to access and work with sequence information. c) A series of search programs that allow a student to identify who in the world is trying to sequence a given species. d) A software available from NIH to design genes.
b) A method that uses very large national and international databases to access and work with sequence information.
Which of the following is/are NOT steps in the production of genome sequence maps: a) Identify molecular markers on specific chromosomes. b) Isolate whole chromosomes. c) When sequences are obtained, assemble and organized the sequences in order. d) All of these are steps you would use. e) Read the sequence of individual piece of the genome.
b) Isolate whole chromosomes.
What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? a) All produce a lipid as a produce. b) All produce RNA as a produce. c) All produce DNA chains as a product. d) All produce RNA as a product.
c) All produce DNA chains as a product.
RT-PCR a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
c) DNA quantification
PCR is: a) one of the control elements of the cell cycle. b) necessary for the efficient replication of cell's DNA in interphase. c) a technique for amplifying DNA sequences in vitro. d) None of the above.
c) a technique for amplifying DNA sequences in vitro.
A BLAST search is done to: a) find the chromosomal location of a sequence. b) predict the 3D structure of a protein from its amino acid sequence. c) find similar gene or protein sequences. d) find restriction sites and SNPs in a sequence. e) determine the conditions under which a gene is expressed.
c) find similar gene or protein sequences.
Which of the following are two especially useful characteristics of cloning vectors? a) ability to integrate into the host chromosome and then cause a lytic cycle b) non-autonomous replication and transposition c) high copy number and antibiotic resistance gene(s) d) reverse transcriptase and ligase activities e) virulence and lysogenicity
c) high copy number and antibiotic resistance gene(s)
BamHI cuts the sequence 5' G-GATCC 3'. Which of the following sequences would NOT be recognized by this enzyme? a) 5′ AGGATCCGTA 3′ b) 5′ AGCGGATCC 3′ c) 3′ CCTAGGATC 5′ d) 3′ TCCTTAAG 5′
d) 3' TCCTTAAG 5'
Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? a) DNA pol b) restriction enzymes specific for the target genes c) DNA ligase d) Both B and C
d) Both B and C
Plasmids are important in biotechnology because they are: a) recognition sites on recombinant DNA strands. b) surfaces for respiratory processes in bacteria. c) surfaces for protein synthesis in eukaryotic recombinants. d) a vehicle for the insertion of foreign genes into bacteria.
d) a vehicle for the insertion of foreign genes into bacteria.
One of the primary reasons for the necessity of generating a large number of clones in a eukaryotic genomic library is that: a) each ligation product is sequence specific. b) the host range of the vector is limited. c) each cosmid replicates non-automously. d) each vector can take up only a relatively small fraction of the eukaryotic DNA. e) lysogenic phages continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones.
d) each vector can take up only a relatively small fraction of the eukaryotic DNA.
Restriction endonuclease are especially useful if they generate "sticky" ends. What makes an end sticky? a) blunt ends b) poly-A sequences c) 5' cap d) ss-complementary tails e) interference
d) ss-complementary tails
A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites? a) A 10-kb, an 8-kb, and 2-kb fragment b) A 10-kb and a 2-kb fragment c) A 12-kb fragment d) An 8-kb and 2-kb fragment e) An 8-kb fragment
e) An 8-kb fragment
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? a) palindrome b) B-galactosidase c) consensus sequence d) complementation e) polylinker (multiple cloning site)
e) polylinker (multiple cloning site)
Expression vector a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
e) protein, or plasmid
Describe the basic components for a typical plasmid cloning vector system and the reason/use for those plasmid vector components.
• Multiple restriction sites - cut the plasmid and foreign DNA with the same enzyme and insert a gene • Origin of replication - new recombinant genes will be able to replicate and increase in number • Selectable markers - detect recombinant plasmids (e.g., lacZ gene produces B galactose, but recombinant ones do not)
Match the following terms with their definition: Paralog, ortholog, synteny, homolog 1) Closely related genes based on sequence and function. 2) Homologous genes of the same locus inherited from a common ancestor. 3) Genes related by gene duplication in the genome. 4) Conservation of the same groups of genes in the chromosomes of 2 or more species.
1) Homolog 2) Ortholog 3) Paralog 4) Synteny
What 4 methods are used to produce mutations in a forward genetics approach?
1) UV light 2) EMS 3) Nitrosoguanidine 4) Transposons
What are 3 key differences between a genomic vs. cDNA library?
1) cDNA library represents only the transcribed regions of the genome, whereas a genomic library contains both coded and conceded regions of the genome 2) All genes are equally represented in a genomic library whereas a cDNA library reflects the level of expression of a gene in a particular cell type or tissue 3) cDNA library only contains sequences found in mature mRNA (i.e., no introns)
What is a transgenic organism?
An organism that stably carries a foreign gene within its genome
List at least 3 different kinds of bacterial cloning vectors.
Any 3 of the following: • Plasmid • Phage • Cosmid • Bacterial artificial chromosome (BAC)
Describe 3 different kinds of bacterial cloning vectors.
Any 3 of the following: • Plasmid - circular, dsDNA molecules that exist in bacteria and the nuclei of some eukaryotic cells (e.g., yeast); can replicate independently of the host cell, about 500x; have large number of restriction sites; size ranges from a few to nearly 100 kb • Phage (bacteriophage) - virus that can infect bacteria with high transformation efficiency (about 1000x more efficient than plasmids); can hold 10-15 kb • Cosmid - part lambda and part phage, making it an engineered vector and allowing the target DNA to be inserted into the phage head; high transformation efficiency; can carry up to 50kb • Bacterial artificial chromosome (BAC) - can hold 300 kb; artificially made • Yeast artificial chromosome (YAC) - vector capable of carrying a large DNA fragment of up to 2MB, but with low transformation efficiency
List 4 uses of PCR.
Any 4 of the following: • Cell-free cloning • Identification of restriction enzyme variants • Screening for genetic disorders • Diagnostic screening for infectious organisms • Forensics • Paleobiology
Explain why genetic and physical map distances may differ in relative distances between two genes on a chromosome.
For a genetic map, genetic distance is based on recombination frequency, giving the relative distance between different genes on a chromosome in the unit of centiMorgans--in other words, it is an estimate. For a physical map, the true distance is found and measured directly using nt bp.
The _____________________ is an international effort to construct a physical map sequence of the 3.3 billion bp in the haploid human genome.
Human Genome Project
This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.
Human Genome Project
Explain why the greatest diversity of human SNPs is found among African people.
Humans are thought to have first evolved in Africa. Therefore, these populations are the oldest and have had the greatest amount of time to accumulate polymorphisms.
The transcription of a genome contains more components of a proteome. Explain why this is true.
In a transcriptome, all the RNA molecules are transcribed from a genome, whereas in a proteome all the proteins are encoded by the genome from the transcriptome. It takes 3 RNA molecules to code for one protein; therefore, there are more RNA molecules within a transcriptome than there are proteins within a proteome.
A _________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene.
Multigene
A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are ___ site(s) for this enzyme in this fragment.
One
A map of the distribution of cloned genomic DNA from genomic clone libraries.
Physical map
A map of the order, overlap and orientation of physically isolated pieces of the genome.
Physical map
A PCR technique the fills in small gaps by using the end of a cloned sequence as a primer to amplify adjacent unclogged fragments.
Primer walking
What is the specific application of reverse transcriptase in the preparation of cDNA?
Synthesis of DNA from an RNA template to form an RNA-DNA duplex
You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4-base single-stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful?
The RE must have complementary sticky ends so that they will anneal together.
In PCR, what is the purpose of the initial high temperature? What is the purpose of cooling in the second step?
The initial high temperature denatures the dsDNA template, whereas the cooling allows the primers to anneal to their target sequences
Assume that one conducted a typical cloning experiment using pUC18 transformed an appropriate host bacterial strain (one carrying the lacZ complementing region), and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant pUC18? Explain your answer.
The white colonies would most likely contain the recombinant pUC18 because they are not blue. If they were blue, then the lacZ if functioning normally and the lacZ gene didn't pick up the foreign gene.
Why are telomeres and centromeres particularly difficult to sequence?
They consist of highly repetitive DNA sequences, thereby causing strand slippage issues that can confuse the determination of a consensus sequence
Figure A below shows a restriction map of a rare prokaryotic gene with its direction of transcription indicated by the arrow. Figure B shows the unique cloning region (i.e., multiple cloning site) contained within a plasmid-cloning vector. The blackened region in Figure A represents the amino acid coding sequence of a protein that can be used in humans as a vaccine. The stippled region in Figure B is a highly active, constitutive (unregulated) prokaryotic promoter region. Letters indicate the cleavage sites for different restriction enzymes. Known gene sequences are indicated by short thick lines. Explain how you would isolate and fuse the coding region (Figure A) behind the indicated promoter in the cloning vector (Figure B) to produce large amounts of the protein in bacterial cells. Assume that the cloning vector carries the gene for tetracycline (an antibiotic) resistance. Letters represent different restriction enzymes.
Use the restriction enzyme (RE) C with either RE D or RE B to clone the gene in the expression vector so that the beginning of the gene is directly 3' of the strong promoter
What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?
When isolated from bacteria, restriction endonuclease restrict or prevent viral infection by degrading the invading nucleic acid of the virus (i.e., they remove viral/pathogenic DNA).
The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves __________, whereas a selection experiment creates conditions that __________ irrelevant organisms. a) visual examination, eliminate b) temperature extremes, enhance c) epistasis analysis, enhance d) complementation analysis, enhance e) chemical removal, activate
a) visual examination, eliminate
Transgene a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
b) foreign DNA
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by: a) identifying the molecular weights of the fragments in question. b) measuring the sizes of the bands on the gel. c) removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest. d) knowing the isoelectric points of the piece in question. e) None of the above
c) removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest.
A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? a) An EST database of the human genome b) Microarray data of tissues in which the gene is expressed c) Information about bacterial orthologs of the gene d) Data about the inheritance of SNP markers in families with the disease e) Whole-genome-shotgun clones of the human genome
d) Data about the inheritance of SNP markers in families with this disease
A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that one expressed in bacteria, is that: a) bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA. b) bacterial RNA pol cannot make RNA complementary to mammalian DNA. c) prokaryotes use a different genetic code from that of eukaryotes. d) bacteria cannot remove eukaryotic introns.
d) bacteria cannot remove eukaryotic introns.
Match the term with the best letter choice: In situ hybridization a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
d) chromosome spread
Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? a) DNAse b) gene cloning c) isolation of stem cells from a lamb embryo and production of a zygotic equivalent d) hydrogen sulfide e) reverse transcriptase
e) reverse trasncriptase
During gel electrophoresis, ___ will migrate more rapidly than ___. a) cloning vectors b) ethidium bromide c) large DNA fragments d) DNA size markers e) small DNA fragments
e) small DNA fragments; c) large DNA fragments
cDNA library a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
f) mRNA
Cloning vector a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
g) plasmid
Shuttle vector a) lacZ b) foreign DNA c) DNA quantification d) chromosome spread e) protein, or plasmid f) mRNA g) plasmid h) centromere i) Taq polymerase j) plasmid, or multiple hosts
j) plasmid, or multiple hosts
Typically, bacterial DNA contains ____ (more or less?) repetitive DNA than eukaryotic DNA.
less
The haploid human genome contains about 3E9 nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter cleave?
• 4-base cutter: (1/4)⁴ = 1/256 bp --> gets cut: (3E9)/256 = 11,718,750 cuts • 6-base cutter: (1/4)⁶ = 1/5000 bp --> gets cut: (3E9)/5000 = 6,000,000 cuts • 8-base cutter: (1/4)⁸ = 1/10,000 bp --> gets cut (3E9)/10,000 = 30,000 cuts
Crossing over is often reduced around centromeric regions of the chromosome. If you were trying to construct a genetic map of two linked marker loci in this region, what results might you obtain and why? How would the genetic map correspond to the physical map?
• A genetic map based on recombination will show the genes to be very close together in centromeric regions due to low rates of recombination. • If these two loci were not in the centromere, distances between the same genes on the physical map may be much greater when compared to their regions on the chromosome
In the genetic map of the human genome, one map unit is approx. 850,000 bp. For the genome of the eukaryotic yeast S. cerevisiae 1 map unit = 3000 bp. What is a map unit, and why is it so different in these two different types of organisms?
• A map unit is the amount of measured recombination between two linked points in a genome. • Because one map unit is many more bp than that in yeast, the amount of homologous recombination per DNA length must be lower in humans than in yeast. • 1% recombination in pigs occurs over 3,000 bp in yeast, whereas 1% of recombination in humans occurs over 850,000 bp --> less recombination per unit length in humans than in yeast
From the following list, the fragments needed to make the longest possible contig, with the least amount of overlap, are: (Cloned fragment; Markers present) • A; M4, M5 • B; M1, M2, M3 • C; M6, M7, M8 • D; M3, M4, M5, M6 • E; M3, M4, M5 • F; M8, M9, M10
• B; M1, M2, M3 • C; M6, M7, M8 • D; M3, M4, M5, M6 • F; M8, M9, M10
Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.
• Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes • Genes are more densely spaced in prokaryotes vs. eukaryotes • Prokaryotic genomes typically encode fewer genes than eukaryotic genomes
What are the some of the advantages of the mouse as a model system?
• Inexpensive, easy to grow, short generation time, readily mutagenized and crossed • Mice have similar body plans and stages of development as humans • Similar genome size and number of chromosomes as humans • Many genes have homologs in humans
You are handling a paternity lawsuit brought against five potential fathers by a woman. You isolated DNA from the mother, the child, and all the potential fathers. After using PCR to amplify specific polymorphic loci from each individual, you fractionate the amplified products on an agarose gel and stain with ethidium bromide to visualize the DNA fingerprints (shown below). Mo = mother; Ch = child; M1-M5 = potential fathers. Do these results confirm that any of the men are the child's biological father? Explain your answer.
• M4 could be the father, and all other males can be excluded. • The alleles present in the child are a combination of alleles from both mother and father; those alleles found in the child that are not found in the mother must be from the father. Marker bands 1, 3, 4, 5, and 9 present in the child are missing from the mother all potential fathers except for M4, who has all five bands listed --> M4 = father
Cloning reactions are done with DNA that has been cloned by restriction digestion and not by PCR. Using what you know about the way PCR works, why would you not want to use DNA from PCR to create DNA for cloning?
• Normally in DNA replication, DNA pol makes errors 1 out every 1010 nt inserted. Further, Taq pol used in PCR is less faithful because it does not have a proofreading subunit. • Because PCR amplifies previous sequences, if an error is made early on will be proliferated in the sequence.
Compare the transcriptome of an organisms with the proteome. What is described by each?
• Some genes encode non-coding RNAs that are not translated into proteins • Transcriptome has all RNA transcripts, coding and non-coding --> transcriptome tends to to be larger than proteome • Proteome only contains the proteins that result from coding RNA transcripts
Compare the fields of structural, functional, and comparative genomics. What is the purpose of each?
• Structural genomics - studies the organization and sequence of a genome; uses 3D structures of all the proteins within a genome • Functional genomics - characterizes the function of sequences or genes within a genome; looks at interactions among DNA, proteins, and transcription factors • Comparative genomics - compares similarities and differences in gene content, function, and organization among genomes of different organisms
A pedigree and Southern blot results in humans are shown below. Filled-in figures represent individuals expressing a dominant trait (hypothetical) for blue tongue. What can you say about the potential linkage relationship between the allele responsible for the trait? Shaded regions within the homologs represent sequences that hybridize to the probe used for the Southern analysis. Arrows indicate cleavage sites used for the Southern analysis.
• The 1 kB RFLP (homologue B) is linked to the dominant blue tongue trait. • This is important because determining the which chromosome carries the mutant allele is often the first step in the process of isolating the gene, mapping it, and what not. • Because the 1 kB RFLP is linked to the mutant allele, it can be considered as a reliable marker for the disease and used for diagnostic testing.