MolGen Final

¡Supera tus tareas y exámenes ahora con Quizwiz!

If 15% of the nitrogenous bases in a sample of DNA from a particular organism is thymine, what percentage should be cytosine? 15% 30% 70% 35% 40%

35%

You have discovered an isolated population of mice where 4% of the mice have black-colored fur, which is known to be a recessive trait (bb). What percentage of the mouse population is expected to be heterozygous at this gene locus?

32% (.8x2x.2)

DNA replication is semi-conservative in that DNA rep can only follow the rep fork on the leading strand The 2 strands of the original helix are conserved, but they become part of separate progeny DNA The 2 strands of the original helix are not conserved, but the base sequence in the DNA is preserved The base sequence of a DNA molecule is conserved, with very high fidelity, in DNA rep

B. The 2 strands of the original helix are conserved, but they become part of separate progeny DNA

Under the system of genetic control of the tryptophan operon,

B. When there is no tryptophan in the medium, transcription of the trp operon occurs at high levels

bi-directional replication

DNA replication proceeds in both directions away from the origin of replication

It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions?

DNA sequencing

What inheritance pattern is suggested by the following observations of a particular pedigree? Extensive pedigree analysis on a characteristic shows all the following: • if a woman with an affected father has children with an unaffected man, half of the sons and none of the daughters are affected. • affected females always have an affected father and an affected maternal grandfather. • the trait is never passed from father to son.

X-linked recessive

In E. coli, which terms accurately reflect the nature of replication of the chromosome?

bidirectional and fixed point of initiation

The lac repressor protein controls expression of the lac operon via ________________

binding to the lac operator site to repress expression

An insulator is also known as a(n) __________________ .

boundary element

_______ is a measure of the degree to which the phenotypic variation of a given trait is due to genetic factors.

broad-sense heritability

0.1% frequency of recombination is observed

in genes located very close to one another on the same chromosome

How might in situ hybridization aid in determining the tissue-specific and/or temporal-specific pattern of gene expression? Describe the process of in situ hybridization in your answer.

in situ hybridization uses a labeled complementary RNA strand to localize a specific mRNA sequence in a tissue. This method is widely used to describe the spatial and temporal expression patterns of developmentally regulated genes.

High-throughput technologies such as DNA and protein expression _________ are often used to provide a global picture of gene expression.

microarrays

Loss-of-function mutations that eliminate the function of a gene product are also known as _____ mutations or gene knockouts.

null

For an individual with the XXY chromosomal composition, the expected number of Barr bodies in interphase cells is

one

ssRNA

Retrovirus

How do segment polarity genes relate to pair-rule genes?

Segment polarity genes determine directionality and how a cell will differentiate. Pair rule genes determine the symmetry of segment polarity genes.

What is the mechanism that ensures Mendel's First Law of segregation?

Segregation of homologous chromosomes

In some cases, genes undergo amplification (local, multiple duplications) when additional gene products are in high demand. Would you consider gene amplification as a form of genetic regulation in eukaryotes?

Since gene amplification involves an increase in the number (copies) of genes, which, in turn, provides the potential for increasing the amount of a gene product because more copies of a given gene are present, one would probably consider gene amplification as a form of genetic regulation. Amplification of ribosomal genes during oogenesis in Xenopus and chorion genes in Drosophila are examples.

Albinism is a recessive condition resulting from the inability to produce the dark pigmentation in skin and hair. A man and a woman with normal skin pigmentation have two children. The man has one albino parent and the woman has parents with normal pigmentation but an albino brother. What is the probability that at least one of the children is albino? What is the probability that both children are albino?

Since one of the man's parents is albino, he must be a carrier (Aa) of the recessive allele. [ Probability = 1 ] The woman has an albino brother which means both of her parents are carriers; however, the woman who is not albino could have either AA or Aa as the genotype, aa is excluded because she is not albino. [ Probability = ⅓ or ⅔ ] . Case 1- The mother is Aa. The chance of having one affected child = ¼. The chance of having a non-affected child =¾. (¼)(¾)(2) = 6/16 (Must multiple by two because it could happen in either order). Must add the probability of having two albino = ¼ x ¼ = 1/16 + 6/16 = 7/16. (⅔)(7/16) =29.2% of one affected child. Both albino = (¼)(¼)(⅔) =4.2% Case 2- The woman is AA and the man is Aa. One albino child = 0

Under certain conditions, the rate of mutation of a particular gene may be determined in humans. What properties of the mutation would favor the most direct determination of mutation rate in humans?

Single locus Dominant Fully expressed 100% penetrant

Under certain conditions, the rate of mutation of a particular gene may be determined in humans. What properties of the mutation would favor the most direct determination of mutation rate in humans? single locus recessive dominant fully expressed 100% penetrant

Single locus Dominant Fully expressed 100% penetrant

Compared with eukaryotic chromosomes, bacterial chromosomes are

Small, with high gene density

How is the tension created by unwinding of DNA relieved?

Supercoiling relaxed by DNA gyrase enzyme (a DNA topoisomerase)

Eukaryotes have two of these per chromatid; prokaryotes have none.

Telomeres

What DNA sequence occurs at the end of the Tetrahymena chromosome? Give both the sequence and the name of the structure. How does this sequence affect the conclusion of chromosome replication?

Telomeres terminate in a 5'-TTGGGG-3' sequence, and telomerase is capable of adding repeats to the ends, thus allowing the completion of replication without leaving a gap and shortening the chromosome following each replication.

This term describes the sequence of nucleotides that direct the formation of a new nucleic acid strand.

Template strand

Human blood types are an example of codominance because:

The A and B alleles both express equally in individuals with both alleles

In the classic experiment conducted by Hershey and Chase, why was the pellet radioactive in the centrifuge tube that contained bacteria with viruses, which had been grown on medium containing 32P?

The bacteria were in the pellet, and many contained the radioactive viral DNA.

A color-blind, chromatin-positive male child (one Barr body) has a maternal grandfather who was color-blind. The boy's mother and father are phenotypically normal. Construct and support a rationale whereby the chromosomal and genetic attributes of the chromatin-positive male are fully explained.

The boy has Kleinfelters syndrome. He received 2 X chromosomes and one Y chromosome. Since he is color-blind, we can assume he received 2 X chromosomes from his mother. One of the X chromosomes was inactivated and turned into a Barr body. One of his mothers gametes experienced nondisjunction, resulting in 2 X chromosomes. One of the X chromosomes contained the color-blind gene his mother inherited from her father (the maternal grandfather). The other, "normal", X chromosome was turned into a Barr body.

In the G0 stage of the cell cycle, which of the following is true?

The cell exits the cell cycle

How do the daughter cells at the end of mitosis and cytokinesis compare with their parent cell when it was in G1 of the cell cycle?

The daughter cells have the same number of chromosomes and the same amount of DNA

The height of a type of bean plants is determined by five unlinked genes called A, B, C, D, and E. Each gene has two alleles: additive (uppercase letter) and nonadditive (lowercase letter). The shortest plants are 130 cm. The tallest plants are 220 cm. Estimate how many centimeters each allele contributes to the height difference of 90 cm.

The difference between the two heights is 90 cm. There are 10 alleles total (two each for five different genes). If each additive allele contributes equally to increasing height from a baseline of 130 cm, the contribution of each is 9 cm.

Explain how it is that genetic variation is maintained in the population. Why is it that dominant alleles do not eventually take over?

The distribution of genotypes reaches equilibrium after a generation due to meiotic segregation in randomly mating populations. Random mating must occur for the dominant and recessive allele frequencies to remain the same.

Intron frequency varies considerably among eukaryotes. Provide a general comparison of intron frequencies in yeast and humans. What about intron size?

The entire yeast genome has only about 240 introns, whereas some single genes in humans contain over 100 introns. In general, smaller genomes have smaller intron size in addition to lower intron number.

In the case of complete dominance in a population in equilibrium, we cannot tell which individuals are homozygous dominants and which are heterozygous. However, we can estimate the frequency of homozygous dominant and heterozygous genotypes if we know what?

The frequency of homozygous recessives

Explain why the genetic map distance between two genes on the same chromosome may be inconsistent with the physical map distance. E.g., for three loci A, B, and C, on the same chromosome, explain why the genetic distance might be A-[20 centimorgans]-B-[20 cM]-C, while the physical distance might be A-[200 kilobases]-B-[100 kb]-C.

The genetic map distance is measured by using the recombinant frequency. It shows the relative distance between different genes on a chromosome in the unit of centimorgan. The physical map distance is measured objectively and directly in the unit of nucleotide base.

The difference between the homeogametic sex and heterogametic sex is that ________

The heterogametic sex determines the gender of the offspring

The introns have been spliced out during mRNA processing

Briefly describe the structure and abundance of the lac repressor protein.

The lac repressor is a DNA-restricting protein that when lactose is readily accessible, and the DNA restricting capacity is lost, and the loss of DNA authority is needed for transcriptional initiation of the operon

Explain why mutations in the lacI gene are trans in their effects, but mutations in the lacO gene are cis in their effects.

The lacI gene encodes the lac repressor protein, which can diffuse within the cell and attach to any operator. It can therefore affect the expression of genes on the same or different molecules of DNA. The lacO gene encodes the operator. It affects the binding of DNA polymerase (OR the lacI repressor) to the DNA, and therefore affects only the expression of genes on the same molecule of DNA.

Nutritional mutants in Neurospora can be "cured" by treating the medium with substance in the defected metabolic pathway. What determines whether the mutant strain (auxotroph) is "cured" by a particular substance?

The mutant strain will be "cured" if the substance added occurs after the metabolic block in the biochemical pathway. This allows the mutant to effectively bypass the required gene product that is defective or mutant in the strain.

What experimental results would indicate that the mutation lacIs is dominant to lacI+?

The observation that lacIs is a trans-acting superrepressor and represses the operator on both sides of the DNA sequence, while lacI+ still has variable regulation (for example: transcription is off when lactose is not present, but transcriptionis on when lactose is present.)

What is semi conservative replication?

The original two strands of the double helix serve as a template for new strands of DNA. When replication is complete, two double stranded DNA molecules will be present. Each will consist of one original template and one newly synthesized strand that is complementary to the template

What two factors contribute significantly to the wide ranges of genome size among eukaryotes?

The presence of introns and repetitive sequences

Transformation

The process whereby one organism is genetically altered by exposure to DNA from another organism

What would Hershey and Chase have concluded if the phage ghosts contained 32P label but were absent from the infected E. coli? A. the protein was the genetic material in phage B. that DNA was the genetic material in phage C. that somehow the radioactivity prevented DNA from getting into E. coli D. that protein and DNA together made up the genetic material

The protein was the genetic material in phage

In the polymerase chain reaction, what is the purpose of the initial high temperature? What is the purpose of cooling in the second step?

The purpose is to denature the target (template) DNA, annealing the primer to the target.

The base content of a sample of DNA is as follows: A = 31%, G = 31%, T = 19%, and C = 19%. What conclusion can be drawn from this information?

The sample of DNA is single-stranded.

Describe how the Sigma subunit of E.coli RNA polymerase participates in transcription.

The sigma subunit may give specificity to the RNA polymerase and play a role in regulatory function. It may be involved in the recognition of initiation sites and promoters

In the formation of nucleosomes, one histone class H1, is not directly involved, yet it does associate with DNA to form higher level chromosomal structure. Where does this histone (H1) associate?

The space between protein and DNA strand

Which of the following statements best describes the relationship between fitness and selection coefficient (s)?

The stronger the selection against a given genotype, the lower the fitness associated with that genotype.

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?

The tRNA that was in the A site moves into the P site.

When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that The two proteins share a common ancestry The two proteins have identical functions The two proteins have no common origin The two proteins have identical tertiary structure The primary structures may differ, but the secondary structures are identical

The two proteins share a common ancestry

DNA replication is semi-conservative in that

The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

The expected ratio of phenotypes among the progeny of a test cross is 1:1:1:1. Out of 200 total resulting progeny, 48 occur in one of the four phenotypic classes. Given this information, which of the following must also be true?

The value of observed - expected for this cell = -2

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?

The work showed that (phage) DNA, and not protein, entered the cell in their experiments and that only DNA was passed on to progeny phages. Also OK: showed that DNA, and not protein, is the genetic material in phage.

Which of the following species is considered a genetic model organism? The plant, Linaria vulgaris The deer mouse, Peromyscus maniculatus The worm, Caenorhabditis elegans The frog, Hyla chrysoscelis The chimpanzee, Pan troglodytes

The worm, Caenorhabditis elegans

Describe the organization of the α-globin gene cluster in humans. Roughly how large is this cluster? How many genes are present? Briefly describe these genes.

The α-group spans more than 30 kb and contains three genes: zeta and two copies of the alpha gene. In addition, two nonfunctional pseudogenes are in the group. Most of the DNA in this region consists of intergenic spacer DNA.

Two highly inbred tobacco plants are crossed. One has dark green leaves. The other has yellow leaves. The F1 have light green leaves. Five hundred progeny from F1 × F1 crosses are analyzed. Their leaves show continuous variation in color, but none has dark green or yellow leaves. What do these data suggest about the number of genes determining this trait?

There are more than 4 genes that determine this trait.

Which of the following is NOT a feature of Darwin's theory of natural selection?

There is no heritable variation among individuals. AND Individuals with poor fitness never produce offspring.

What must be true for a population to be in Hardy-Weinberg equilibrium?

There must be random mating in the population; there must be an infinite population size; and there must be no evolution occurring (no natural selection, no genetic drift, no migration and no mutation).

Prokaryotic chromosomes do not have telomeres because:

They are circular

Why are telomeres and centromeres particularly difficult to sequence?

They consist of highly repetitive DNA, and so strand slippage issues can confuse the determination of a consensus sequence.

In extreme cases, genetic drift may lead to the chance fixation of one allele. What happens to other alleles of that gene?

They go away unless mutation occurs

What is the function of dideoxynucleotides in Sanger DNA sequencing?

They stop synthesis at a specific site, so the base at that site can be determined.

An hh Bombay individual is transfused with type O blood. What will the effect be and why

This blood will coagulate and cause a problem due to antibodies in the bombay individual to type O blood because the Bombay individuals lack the H substance, which in effect is type O

An hh Bombay individual is transfused with type O blood. What will the effect be and why?

This blood will coagulate and cause a problem due to antibodies in the bombay individual to type O blood because the Bombay individuals lack the H substance, which in effect is type O

What is the purpose of the antibiotic resistant gene in a plasmid cloning vector?

This is used to identify the host cells containing the vector when plated on the antibiotic plate

What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?

To determine if the vector is present in host cell

These are factors that need not be adjacent to the genes they control. An example would be the lac operon's repressor protein.

Trans-acting

exon shuffling 5'-cap regulation ploy(A)tail addition

Transcriptional regulation

One type of mutationinvolves the replacement of a pyrimidine with a purine. What general term is associated with this mutationalphenomena?

Transversion

Assume that you are working with a mutant, nutritionally deficient strain of Escherichia coli and that you isolate "revertants," which are nutritional-normal. Describe, at the molecular level, two possible causes for the "reversion to wild type."

Two general classes of events could be involved: true reversion or suppression. True reversion would involve a precise correction of the original mutation. Suppression could be intragenic or intergenic. In intragenic suppression, a change in some other part of the mutant gene product serves to "compensate" for the original mutation. In intergenic suppression, a mutation in some other gene, such as a transfer RNA, serves to "compensate" for the original mutation.

Describe the phenomenon of photoreactivation repair.

UV-induced DNA damage, specifically pyrimidine dimers, can be partially reversed if cells are briefly exposed to light in the blue range of the visible spectrum

A(n) _______________ can function at variable distances and in either orientation. However, it differs from an enhancer in that it cannot function downstream of the transcription starting point.

Upstream Activator Sequence (UAS)

provirus

Viral DNA that inserts into a host genome.

Provide a simple definition of inbreeding.

When two individuals closely related in a pedigree mate

Origin of replication (ori):

Where replication of DNA begins.

Regarding the tryptophan operon, trpR- maps a considerable distance from the structural genes. The mutation either inhibits the interaction with tryptophan or inhibits repressor formation entirely. In the presence of tryptophan in the medium, would you expect the tryptophan operon to be transcriptionally active in this mutant? Explain.

With either of the two scenarios mentioned in the problem, the absence of repressor function in a repressible system means that there would be no repression of the operon. The operon would be transcriptionally active.

What inheritance pattern is suggested by the following observations of a particular pedigree? Males and females are affected equally Affected fathers may have affected daughters but never affected sons Half the children of affected mothers are affected

X-linked dominant

What inheritance is suggested by each description? Extensive pedigree analysis on a characteristic shows all of the following: • males and females are affected equally. • affected fathers may have affected daughters, but never affected sons. • half the children of affected mothers are affected.

X-linked dominant inheritance

Is it possible that the characteristic in the pedigree below could be X-linked dominant? If so, what are the genotypes of each individual (use alleles B and b)? If not, explain why not, giving specific genotypes.

X-linked recessive is possible if I-1 is XaY; I-2 is XAXa; II-1 is XAY; and II-2 is XaXa

Extensive pedigree analysis on a characteristic shows all of the following: -only males are affected -affected fathers always pass the trait to sons What does this pedigree indicate?

Y-linked inheritance

Targeted gene knockouts involve the deletion or disruption of a given gene. What method might be effectively used to knock out a gene in yeast? What method might be used in mice? Why would the method used in yeast be ineffective in mice?

Yeast: New segments are attached to the ends of DNA; homologous recombination occurs and the resulting colonies lack the target gene to gain some insight on the function of that gene Mice: The homologous recombination part is identical to that of yeast, however embryonic stem cells are used after to further achieve a mutated mouse by allowing those mutated cells to grow and eventually reproduce offspring expressing the mutated phenotype in hopes to understand its effect The yeast method might be ineffective in mice because we do not want just one mutated cell, we want a whole mutant mouse, as only with the complete organism can we make a full assessment of the effect of the gene inactivation on the phenotype.

The 5' cap on an mRNA is important for all the processes listed below except for the ___ of an mRNA molecule. a. transcription b. intron removal c. stability d. initiation of translation

One speaks of UAS (upstream activating sequences) as being DNase hypersensitive. We would interpret this to mean that A. each UAS has more histone binding sites than non-UAS sites. B. each UAS is likely to be single-stranded. C. a UAS is constitutively open. D. more than one strand of DNA exists in each UAS. E. any given UAS is composed of a double-stranded site with a bound repressor.

a UAS is constitutively open.

What is a mutation?

a change in the DNA sequence

Red-green color blindness is X-linked recessive. A woman with normal color vision has a father who is color blind. The woman has a child with a man with normal color vision. Which phenotype is NOT expected? a. A color-blind female b. A color-blind male c. A noncolor- blind female d. A noncolor-blind male

a color blind female

Give a brief definition of the term genetic equilibrium

a condition for a population in which the frequency of a given gene remains constant from generation to generation

QTL mapping requires all of the following except:

a controlled cross. offspring genetic markers a genetic map >an estimate of homozygosity in the population

What is the relationship between the narrow-sense heritability index (h2) and the impact of selection?

a high H2 value indicates that a trait will be highly selected for

Replicon:

a length of DNA replicated at one replication fork.

Apurinic sites (AP sites) involve a spontaneous loss of ________ in an intact double-helix DNA molecule.

a purine

a) In a healthy female, how many secondary oocytes would be expected to form from 100 primary oocytes? b) How many first polar bodies would be expected from 100 primary oocytes?

a) 100, b) 100

The genetic frequencies of two separate populations are: AA Aa aa Population 1 .36 .48 .16 Population 2 .55 .10 .35 a) What are the genotypic frequencies of the two populations? b) What are the allele frequencies? c) Are the populations in Hardy-Weinberg equilibrium?

a) Expected for population 1: f(AA) = 0.36; f(Aa) = 0.48; f(aa) = 0.16 Expected for population 2: same b) Pop 1: f(A) = 0.6 = p f(a) = 1−p =0.4 = q Pop 2 : f (A) = 0.6 f(a) = 0.4 c) Population 1 is in Hardy-Weinberg equilibrium but population 2 is not.

Meselson and Stahl determined that DNA replication in E.coli is semiconservative. What additive did they initially supply to the medium in order to distinguish "new" from "old" DNA? 15N 14N 32P 33P S

a. 15N

A new kind of tulip is produced that develops only purple or pink flowers. Assume that flower color is controlled by a single-gene locus, and that the purple allele (C) is dominant to the pink allele (c). A random sample of 1000 tulips from a large cultivated field yields 847 purple flowers, and 153 pink flowers. a. Determine the frequency of the purple and pink alleles in this field population. b. Estimate the proportion of all purple flowering plants that are heterozygotes and homozygotes.

a. Assuming the population is in H-W equilibrium, let p = the dominant purple allele (C), and q = the recessive allele (c). Applying the H-W equation, the frequency of the pink allele = q^2 = 153/1000 = 0.153; and q = (0.153)^1/2 = 0.39. Because p + q = 1, p = 1 - q = 0.61. b. If the population is in H-W equilibrium, p^2 + 2pq + q^2 = 1. For the heterozygotes, 2pq = 2(0.61)(0.39) = 0.476. Therefore, 47.6%, or (0.476)(1000) = 476 of all the purple flowered plants in this population are expected to be heterozygotes (Cc), and consequently, (p^2)(1000) = (0.61)^2 (1000) = 371 plants are expected to be homozygous dominants (CC)

Genetic frequencies of two separate populations are: Pop 1: AA(.36); Aa(.48); aa(.16) Pop 2: AA(.55); Aa(.10); aa(.35) a) What are the genotypic frequencies of the two populations? b) What are the allele frequencies? c) Are the populations in Hardy-Weinberg equilibrium?

a. expected genotypic frequencies are those values given in questions b. Pop 1: A(.6); a(.4) Pop2: A(.74); a(.59)?? c. Pop one is in equilibrium but two is not (allele frequencies don't add up to 1)

List two especially useful characteristics of cloning vectors. a. high copy number and antibiotic resistance gene(s) b. virulence and lysogenicity c. ability to integrate into the host chromosome and then cause a lytic cycle d. nonautonomous replication and transposition e. reverse transcriptase and ligase activities

a. high copy number and antibiotic resistance gene(s)

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally a. hybridizes filter-bound DNA with a DNA probe. b. hybridizes filter-bound RNA with a DNA probe. c. examines amino acid substitutions with radioactive probes. d. cleaves RNA with restriction endonucleases. e. ligates DNA with DNA ligase.

a. hybridizes filter-bound DNA with a DNA probe.

What is a concise definition of proteomics? a. the process of defining the complete set of proteins encoded by a genome b. the harvesting of proteins from a cell to determine their economic value c. the manipulation of amino acid sequences in proteins to alter their function d. changing the terminal sequences of proteins to alter their function e. the rational design of drugs based on protein structure

a. the process of defining the complete set of proteins encoded by a genome

How are pseudogenes formed?

accumulation of multiple mutations within a gene whose product is not required for the survival of the organism

Assuming one mutational event in a gene, on average, which of the following mutagens would be expected to cause the most damage to a protein synthesized by such a mutagenized gene?

acridine orange

DNA methylation may be a significant mode of genetic regulation in eukaryotes. Methylation refers to

addition of methyl groups to the cytosine of CG doublets

Which is a characteristic of DNA sequences at the telomeres? a) They consist of cytosine and adenine nucleotides b) all choices are correct c) One strand protrudes beyond the other, creating some single-stranded DNA at the end. d) The consist of repeated sequences

all choices are correct

Assume that a man who carries an X-linked gene has children. Assuming normal meiosis and random combination of gametes, the man would pass this gene to

all of his daughters.

Which is not true of amino acids? a) tRNA brings them to the ribosome for protein synthesis b) all of the above are true c) They are the building blocks of proteins d) There are 20 of them required in the body

all of the above are true

Genes come in different versions called:

alleles

In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction.

aminoacyl tRNA, A, P, ribosome

An allele is

an alternate form of a gene.

What is meant by the term reverse genetics?

an approach to discover the function of a gene by analyzing the phenotypic effects of specific engineered gene sequences.

What is a transgenic organism?

an organism that has foreign DNA permanently inserted into its genome

What is the name of the process of selecting a specific group of organisms from an initially heterogeneous population for future breeding purposes?

artificial selection

Match each term with the best letter choice: expression vector a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

b. protein

This structure forms when an extra X chromosome is methylated and largely inactivated. It is most commonly found in females.

barr body

The anticodon on the tRNA molecule:

binds to the mRNA in a complementary fashion.

How do centromeres help control the cell cycle?

by inhibiting anaphase until spindle fibers are attached to chromosomes

DNA polymerase

catalyzes the addition of nucleotides to a growing DNA chain

Match each term with the best letter choice: YAC a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

centromere

In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter?

charged tRNA, RNA triplet, and ribosome

Electrophoretic separation of HbA from HbS is based on a difference in their ________.

charges

Electrophoretic separation of HbA from HbS is based on a difference in their______

charges

Within cells, DNA and genes are organized into structures called _____.

chromosomes

What is the chromosomal configuration of the phiX174 virus?

circular ssDNA

In E. coli, the genetic material is composed of

circular, double-stranded DNA

A promoter that affects only genes that are on the same piece of DNA is ____________-acting.

cis

Assume that a cross is made between AaBb and aabb plants and that the offspring occur in the following numbers: 106 AaBb, 48 Aabb, 52 aaBb, 94 aabb. These results are consistent with a cis or trans arrangement of genes in the AaBb parent?

cis

This term describes genetic elements that affect other elements only when they are located adjacent to them. For example, the operator has this effect on its structural genes.

cis-acting

β subunit

clamp that prevents core enzyme from falling off during polymerization

Name the two strategic methods that scientists are using to sequence genomes.

clone-by-clone method and shotgun cloning

Assume that a cross is made between AaBb and aabb plants and that all the offspring are either AaBb or aabb. These results are consistent with the following circumstance:

complete linkage

Which of the following polymorphisms is the most efficient for use in population genetics studies?

complete sequence variation

Hardy-Weinberg equilibrium

condition that occurs when the frequency of alleles in a particular gene pool remain constant over time

The isolation of cell-cycle mutations in yeast was greatly facilitated by the use of _______________ mutations, which allow investigators to study the effects of mutations that would be lethal if expressed constantly.

conditional mutations

A condition in which a gene or group of genes is expressed all the time.

constitutive

Regarding the lactose utilization system in E. coli, a _________ mutant is one in which the three enzymes are produced regardless of the presence or absence of lactose.

constitutive

Mutations in the lacI and lacO genes in the lactose system often lead to full production of the three structural genes related to the lac operon even with no lactose available to the organism. Such mutations would be called ________.

constitutive mutations

Regarding regulation of the tryptophan operon, what type of regulatory molecule might one appropriately call the amino acid tryptophan?

corepressor

Which of the following statistical terms is a not measure of central tendency?

correlation

Considering the electromagnetic spectrum, identify likely mutagens from the following list: radio waves, microwaves, infrared, ultraviolet, X rays, gamma rays, cosmic rays.

cosmic rays x-rays ultraviolet gamma rays

Considering the electromagnetic spectrum, identify likely mutagens from the following list: radio waves, microwaves, infrared, ultraviolet, X rays, gamma rays, cosmic rays. cosmic rays radio waves ultraviolet microwaves infrared X-rays gamma rays

cosmic rays x-rays ultraviolet gamma rays

Transcriptional repression by methylation of DNA is most common in sequences called____________ islands.

cpG

Nirenberg and Matthaei

cracked the genetic code, determined what codons (nitrogen bases) code for what amino acids

Restriction endonucleases...

cut DNA at specific sequences.

What is the initiator triplet in both prokaryotes and eukaryotes? What amino acid is recruited by this triplet?

d. AUG, methionine

Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? a. DNA polymerase b. restriction enzymes specific for the target genes c. DNA ligase d. Both B and C

d. Both B and C

Under what conditions does one expect a 9:3:3:1 phenotypic ratio among the offspring of a cross? What must be true about the parents? What must be true about the genes in question?

dihybrid cross (F2) with independently assorting, completely dominant genes

What is the common influence of ultraviolet light on DNA? Note that simply stating "mutation" is not an acceptable answer.

dimer formation

Describe the relationship between introns (size and number) and organismic complexity in eukaryotes.

direct relationship

In a population of birds in Africa, it was observed that birds with small or large beaks could efficiently crack and eat small or large seeds, respectively. Birds with intermediate beaks had trouble with both types of seeds. What type of selection would be expected to occur in this population if small and large seeds were the only types of food available to these birds?

disruptive

Transcription factors are proteins with at least two functional _________.

domains

To use RNAi (RNA interference) as a research tool, investigators introduce short synthetic __________ RNA into cells.

double-stranded, small interfering

Experiments carried out in a variety of organism indicate that the determined state is not necessarily fixed. What experiments support this indication?

drosophila experiment with the eyeless gene; xenopus experiment

In a germ-line cell from a human male that is dividing, when do the X and Y chromosomes segregate?

during meiosis I, anaphase

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids? 300 100 600 1200 900

e. 900

What is the name given to the three bases in a messenger RNA that bind to the anticodon of tRNA to specify an amino acid placement in a protein? Protein Anti-anticodon Cistron Rho codon

e. codon

semi-conservative replication

each DNA strand could serve as a template for its own replication

Considering the location of genes in the interphase nucleus, certain chromosomal territories appear to exist. Specifically,

each chromosome appears to occupy a discrete domain.

dispersive replication

each strand combination of new and old DNA

A procedure that is often used to separate molecules by using their molecular charges is called ________.

electrophoresis

A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will

encode unformylated methionine.

A eukaryotic DNA sequence that affects transcription at distant promoters is called a(n) ________________.

enhancer

______________ can cause the same genotype to produce a range of potential phenotypes

environmental effects

Dicer

enzyme that cleaves double-stranded RNA molecules into short interfering RNAs (siRNAs)

DNA Polymerase II

enzyme that proofreads the daughter strand of replicated DNA and corrects any base pairing errors

A condition in which one gene pair masks the expression of a nonallelic gene pair is called ________.

epistasis

Mice homozygous for mutations in one gene exhibit polydactyly (i.e. extra toes) while in another gene (limb deformity), homozygous mutants lack all parts of the limb below the wrist. A mutant that is doubly homozygous for extra toes and limb deformity mutations will NOT exhibit polydactyly because it is missing the distal limbs, where the toes are located. This type of genetic relationship is called

epitasis

Parts of chromosomes that are not methylated for inactivation, but rather are less dense-staining and are likely active in transcription in the cell.

euchromatin

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes

excision of introns

If one compares the base sequences of related genes from different species, one is likely to find that corresponding ________ are usually conserved, but the sequences of ________ are much less well conserved.

exons; introns

Recent discoveries on causes of fragile-X syndrome, myotonic dystrophy, and Huntington disease indicate what type of genetic alteration?

expanding trinucleotide repeats*

Match each term with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens PCR

f. Taq polymerase

Regarding the nature of the ABO blood groups, dysfunction in what process leads to the O blood type?

failure to modify the H substance due to lack of glycosyltransferase activity Explanation:

A BLAST search is done to

find similar gene or protein sequences.

What term is given to the probability that a particular phenotype will survive and leave offspring?

fitness

Group I Introns

found in rRNA genes, guanosine as a co-factor

When X rays penetrate cells, electrons are ejected from atoms of molecules. Stable molecules can be transformed into what types of hazardous materials?

free radicals

Mutations that eliminate a contiguous region in the Drosophila embryo's segmentation pattern are called

gap genes

Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that

genetic material must be composed of many different units to account for variability seen in nature

Total phenotypic variance can be decomposed into all but one of these components:

genetic variance genetic-environment interaction variance environmental variance >heritability

This is the study of "genes in their entirety."

genomics

Of the two cell lines that can contain a mutation in an organism, the __________ is most consequential to subsequent generations.

germ-line

Regarding the lactose utilization system in E. coli, a ___________ inducer is a molecule that is chemically analogous to lactose, induces the operon, but is not a substrate for the enzymes of the lac operon.

gratuitous

What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary?

hairpin

What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary? Double helix Z-DNA Hairpin B-DNA

hairpin

In 1928, Frederick Griffith established that _______.

heat-killed bacteria harbor the constituent(s) necessary to convey genetic properties to living bacteria

What protein is responsible for the initial step in unwinding the DNA helix during replication of the bacterial chromosome?

helicase

What unwinds the double helix?

helicase

List two especially useful characteristics of cloning vectors.

high copy number and antibiotic-resistance gene

The ____________________ consists of modifications to histone proteins that affect the expression of DNA sequences.

histone code

What is meant by the term heterogeneous nuclear RNA (hnRNA)?

hnRNA is an assortment of RNA molecules, many of which will be processed into mRNA in the cell nucleus. The hnRNA associates with proteins to form heterogeneous nuclear ribonucleoprotein (hnRNP).

A __________ is a DNA stretch of 180 bp that specifies a 60 amino acid homeodomain.

homeobox

Mutations in the selector genes sometimes form structures in the wrong segment, transforming the antenna of a fly into a leg, for example.What term is given to such mutations?

homeotic mutation

Two independently assorting loci, P/p and C/c are drawn on the chromosomes. The P and p alleles are said to be on

homologous pairs of chromosomes

Population genetics is concerned with:

how genes confer relative reproductive success on the individuals. AND whether allele frequencies are changing over time. (b) and (c) above.

Which of the following is a concern of population genetics?

how many people have color blindness in Utah?

Heteroduplex:

hybridization between mature mRNA& denatured genomic DNA

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally

hybridizes filter-bound DNA with a DNA probe

Considering the structure of double-stranded DNA, what kinds of bonds hold one complementary strand to the other?

hydrogen

The relationship between codon and anticodon can be characterized as involving ________ between complementary bases (usually) in typical ________ fashion.

hydrogen bonds, antiparallel

What chemical group is found at the 3' end of a DNA molecule?

hydroxyl group

Match each term with the best letter choice: ß-galactosidase a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

i. lacz

Individuals with the same genetic background and a high degree of homozygosity are said to be isogenic. Of what value are isogenic strains in genetic studies?

in an isogenic strain, all individuals are genetically identical. With this, geneticists can work on genetically identical individuals

The spliceosome is a large enzyme that catalyzes removal of specific

introns in pre-mRNAs.

In what way can 5'-azacytosine influence transcription?

it causes undermethylation which influences transcription since methylation cannot occur

An allosteric molecule is one in which ________.

it changes shape when binding to something

If mating occurs solely between relatives, eventually what will happen to the population?

it will become completely homozygous

DNA

join 2-Deoxyribose to purine or pyrimidine in specific manner; result is deoxyribonucleosides

RNA

join ribose to purine or pyrimidine in specific manner; result is ribonucleosides

Match each term with the best letter choice: cDNA library a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

k. mRNA

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces high amounts of ß-galactosidase. What is a possible genotype of the cells? a) lacI- lacP+ lacO+ lacZ- lacY+ lacA+ b) lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ c) lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ d) lacI+ lacP+ lacO+ lacZ- lacY+ lacA+

lacI+ lacP+ lacOc lacZ+ lacY+ lacA+

A mutant E. coli strain, grown under conditions that normally induce the lac operon, does not produce ß-galactosidase. What is a possible genotype of the cells?

lacI+ lacP- lacO+ lacZ+ lacY+ lacA+

The lac repressor binds to:

lactose and DNA

The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells.

less, temporarily

Name two mammalian traits with relatively high heritability (h2) values.

litter size in mice, conception rate in cattle

All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one?

mRNA

Assuming a normal number of autosomes, what would be the sex of the following: XXY mouse? XXY Drosophila?

male and female

Two- and three-factor testcrosses can both be used to _____________ and _____________. a. screen recessive mutants b. map gene loci c. determine parental origin d. determine genotype e. identify double-crossover events

map gene loci and determine genotypes

List two statistical terms commonly used in the analysis of quantitative traits.

mean and variance

The cellular organelles with inheritance independent of the nucleus are the _____________ and the ____________ .

mitohondria and chloroplast

The DNA of a eukaryotic chromosome is:

one long double helix

evolution occurs:

only via natural selection, genetic drift, migration, or mutation.

Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called ______.

orthologs

Which of the following is NOT an example of nonrandom mating?

panmixis

A measurable or observable trait or characteristic is called a(an)

phenotype

Side groups of amino acids are typically grouped under which of the following?

polar, nonpolar

A catabolite-activating protein (CAP) exerts _____________control over the lac operon.

positive

Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli? -a) repressible system -b) inducible system -c) constitutive -d) negative control -e) positive control

positive control

Drosophila melanogaster, the fruit fly, has a 2n chromosome number of 8. Assume that you are microscopically examining the mitotic and meiotic cells of this organism. You note that in the female two chromosomal pairs are metacentric and that two pairs are acrocentric. What stage is represented in the drawing above? (Genes "P" and "C" are not relevant to this question).

primary oocyte (metaphase)

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can then take over for replication

primase

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

promoter

What is the general position of the consensus sequence called the GC box? What is its sequence? A. promoter; GGGCGG B. attenuator; GGGCGG C. promoter; CAAT D. terminator; CAAT E. terminator; GGGCGG

promoter; GGGCGG

The process of error correction of mismatched bases carried out by DNA polymerases is called

proofreading

Telomerase contains

protein and RNA

Uridine contains _______ as sugar.

ribose

The discovery of RNA self-splicing by T. Cech and others in Tetrahymena revealed that RNA can demonstrate autonomous catalytic properties. RNAs that undergo such splicing are often called

ribozymes

Hairpins are formed in DNA as a result of

sequences on the same strand that are inverted and complementary

Homologous chromosomes are those that can be matched by virtue of their similar structure and function within a nucleus. What chromosomes making up the human genome do not follow the same characteristics of homology?

sex chromosomes

Telomeric DNA consists of

short tandem repeat sequences 5-'TTAGGG-3' in humans from 50-1000s of repeats in different species

The ________ the wavelength of a radiation source, the greater its likelihood of causing damage.

shorter

Regions of chromosomes that are inactivated through methylation are termed this.

silent chromatin

Under what condition(s) might one have an amino acid substitution in a protein that does not result in an altered phenotype?

silent mutation

Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky?

single stranded complementary tails

Is genetic drift is primarily associated with relatively large or small breeding populations?

small

During gel electrophoresis, __ will migrate more rapidly than __. a. cloning vectors b. ethidium bromide c. large DNA fragments d. DNA size markers e. small DNA fragments

small DNA fragments large DNA fragments

A major difference between Mendelian and quantitative traits is in _______________

small differences between average phenotypes compared to differences between individuals within genotypes

In the lactose operon, the product of structural gene lacZ is capable of

splitting the β-linkage of lactose.

Mutations that arise in nature, from no particular artificial agent, are called

spontaneous mutations

If 64% of the people in a population are blue-eyed and the population is in Hardy-Weinberg equilibrium, what is the percentage of heterozygotes in the population?

sqrt 0.64 = 0.8 1-0.8 = 0.2 2(0.8)(0.2) = 0.32

Telomeres________________the end of chromosomes

stabilize

Reverse transcriptase is an enzyme found in association with retroviral activity. It has the property of

synthesis of DNA from an RNA template.

Of the following three types of nucleic acids-DNA, mRNA, tRNA--which is most likely to contain modified bases?

tRNA

Of the following three types of nucleic acids-DNA, mRNA, tRNA-which is most likely to contain modified bases?

tRNA

What are the three classes of "functional" RNAs (not including mRNA)? Briefly describe the role of each class of functional RNA.

tRNA -- brings the correct amino acid to the mRNA during translation. rRNA -- major component of ribosomes. snRNA -- helps process RNA transcripts (especially, helps remove introns).

To translate a mRNA you require two other RNAs. These are

tRNA and rRNA

"Charging" RNA

tRNA synthetases add amino acid to tRNAs

A chromosome with a centromere at the very end is called

telocentric

Structures located at the ends of eukaryotic chromosomes are called

telomeres

RNA polymerase II binds to the _____ strand of DNA and uses it to guide transcription. In contrast, the strand not used to guide transcription is called the _____.

template, coding

Some restriction enzymes cleave DNA in such a manner as to produce blunt ends. Most often ligation of blunt end fragments is enhanced by the use of the enzyme terminal deoxynucleotidyl transferase. Why?

terminal deoxynucleotidyl transferase extends single-stranded ends by the addition of nucleotide tails. If complementary tails are added, the fragments can hybridize and the recombinant molecules can be ligated.

The packaging of DNA into a confined space is what level of DNA structure?

tertiary

What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence?

that RNA was the genetic material

The discontinuous aspect of replication of DNA in vivo is caused by

the 5' to 3' polarity restriction.

siRNAs and miRNAs are produced by

the cutting and processing of double-stranded RNA by Dicer enzymes.

Huntington disease is caused by a single dominant gene and results in progressive mental and neurological damage. The disease is usually symptomatic when a person is between 30 and 50 years old and the patient usually dies within 15 years of diagnosis. Approximately 1 in 25,000 Caucasians have this disease. Huntington disease has not been associated with any other disease, now or in the past. Why might natural selection not have eliminated such a deleterious gene from the population

the disease does not manifest until after reproductive age so sexual selective pressure against it is negligible if at all present.

the frequency of the homozygous recessives

The difference between the homogametic sex and heterogametic sex is that __________________

the heterogametic sex determines the gender of the offspring

The antiparallel nature of DNA refers to

the opposite direction of the two strands of nucleotides.

It is possible for a repressor to negatively regulate the expression of an operon because

the repressor binding site overlaps the promoter site of the operon allowing it to physically block the binding of RNA polymerase.

By their experimentation using the Neurospora fungus, Beadle and Tatum were able to propose the far-reaching hypothesis that:

the role of a specific gene is to produce a specific enzyme

When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that

the two proteins share a common ancestry.

Assume that one conducted a typical cloning experiment using pUC18, transformed an appropriate host bacterial strain (one carrying the lacZ complementing region), and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant pUC18? Explain your answer.

the white colonies because of insertional inactivation of the lacZ component

how do you know if individual is heterozygous on gel?

there are two bands

This Greek letter describes the shape of a bacterial chromosome mid-way through replication

theta

This Greek letter describes the shape of a bacterial chromosome mid-way through replication.

theta

Embryonic stem cells are the subject of a great deal of research. What characteristic of embryonic stems cells accounts for this scientific interest?

they are potential totipotent

Embryonic stem cells are the subject of a great deal of research. What characteristic of embryonic stem cells accounts for this scientific interest?

they are potentially totipotent

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA?

three

The role of tRNA is:

to act as transporters bringing amino acids to the site of protein synthesis.

What is the enzymatic function of restriction enzymes?

to cleave nucleic acids at specific sites

mRNA

transcribed by RNA polymerase II

In eukaryotes, tRNAs are Transcribed in the nucleus and function in the nucleus Transcribed in the nucleus, but function in the cytoplasm Transcribed in the cytoplasm, and function in the cytoplasm Transcribed in both the nucleus and the cytoplasm, and function in the cytoplasm

transcribed in the nucleus, but function in the cytoplasm

In prokaryotes, translation of an mRNA is coupled to

transcription

Under a system of positive control, __________ does not occur unless a regulator molecule directly stimulates RNA production.

transcription

What is the function of eukaryotic RNA polymerase I?

transcription of rRNA genes

Regarding eukaryotic and prokaryotic genetic regulation, what process seems to be the most similar between the two?

transcriptional regulation

When referring to attenuation in regulation of the tryptophan operon, it would be safe to say that when there are high levels of tryptophan available to the organism,

transcriptional termination is likely.

What term is used to refer to the process in which DNA can be introduced into host bacterial cells?

transformation

One type of mutation involves the replacement of a purine with a purine. What general term is associated with this mutational phenomena?

transition

What evidence indicates that steroid hormones exert their influence at the level of DNA?

translocation of the hormone-receptor complex from the cytoplasm to the nucleus, increase in the rate of transcription

Two formal terms used to describe categories of mutational nucleotide substitutions in DNA are called

transversions and transitions

Sidney Brenner argued that the code was nonoverlapping because he considered that coding restrictions would occur if it were overlapping. A second major argument against an overlapping code involved the effect of a single nucleotide change. In an overlapping code ________ adjacent amino acids would be affected by a point mutation, while in a nonoverlapping code ________ amino acid(s) would be affected. Separate the two answers with a comma in the box below.

two, one

The nitrogenous base that is found in RNA but not in DNA is

uracil

The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms.

visual examination, eliminate

gradient centrifugation

way to separate nucleic acids by size and density

Replication fork:

where DNA strands are unwound.

Ultraviolet light causes pyrimidine dimers to form in DNA. Some individuals are genetically incapable of repairing some dimers at "normal" rates. Such individuals are likely to suffer from

xeroderma pigmentosum

What human condition is caused by the inability to repair UV-induced DNA lesions?

xeroderma pigmentosum

What is the approximate genome size in the mouse, and how many chromosomes are present?

~23,000, 20 chromosomes

The secondary structure of a protein includes the following elements:

α-helix and β-pleated sheet.

The table below lists several genotypes associated with the lac operon in E. coli. For each, indicate with a "+" or a "-" whether β-galactosidase would be expected to be produced. (Note: you are analyzing whether or not you see functional β-galactosidase enzyme or not). Please label your answer No Lactose #1-4 and With Lactose #1-4. β-galactosidase production No Lactose With Lactose 1. I+O+Z+ /F' I-O+Z+ 2. I-O+Z+ /F' I-O+Z+ 3. I-OCZ+ /F' I-O+Z- 4. ISOCZ+ /F' I+O+Z+

β-galactosidase production No Lactose With Lactose 1. I+O+Z+ /F' I-O+Z+ - + 2. I-O+Z+ /F' I-O+Z+ + + 3. I-OCZ+ /F' I-O+Z- + +

How is replication proofread to insure accuracy?

•All polymerases possess 3'-->5'exonuclease activity •Detects and excise mismatches

How is DNA unwound so that replication can happen?

•Binding of DnaA allows subsequent binding of DnaB and DnaC, further opens the helix

After gap is filled, how are the ends of the gaps joined?

•Done by DNA ligase •Catalyzes phosphodiester bond to seal the gap

Exonuclease Proofreading

•Done by ε subunit of holoenzyme of DNA pol III•Mutations of ε result in substantially increased error rate

Overall Replication Model

•Helicase/primase at replication fork •ssbp stabilize open helix •Gyrase removes tension •Beta clamp binds DNA •Simultaneous leading and lagging strand synthesis •RNA primers removed, gaps filled, Okasaki fragments joined

DNA polymerases work 5'-->3', how is the other strand replicated?

•Lagging strand synthesis done in segments •RNA primers added to lagging strand •DNA polymerization begins from these fragments

Chargaff's Rules:

(A + G) = (C + T)

origin recognition complex

(ORC) large protein complex that is bound to the DNA at origins of replication in eukaryotic chromosomes throughout the cell cycle

Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypes would you expect in male and female offspring resulting from the following crosses? (Assume A and B are dominant to a and b, respectively.) aabb female X AB/Y male all female offspring? all male offspring?

(a) AB = 40; ab = 40; Ab = 10; aB = 10 (sexes have the same phenotypes) (b) Ab = 40; aB = 40; AB = 10; ab = 10 (sexes have the same phenotypes) (c) all males = ab; all females = AB

The following pedigree is for a family with an autosomal recessive genetic disease. (i) Identify the possible genotypes of all individuals in the pedigree. Note that some individuals cannot be definitively determined - for each of these individuals, list the phenotypes they might have. (ii) From the above pedigree, if individuals labeled 2 and 3 are both carriers, what is the probability that they will produce an affected offspring?

(i) Going from left to right in the pedigree: Generation 1: Aa, Aa (produced an affected offspring so they must be carriers of the recessive mutation) Generation 2: Aa, aa, AA/Aa, aa, Aa Generation 3: Aa, aa, Aa, Aa, aa (ii) If 2 and 3 are carriers, then they have genotypes of Aa respectively. They have a 1/4 chance of producing an affected offspring.

Describe what is meant by a gratuitous inducer. Give an example.

-Chemical analogs which behave like natural inducers but do not act as substrates for the enzymes produced. -Example: IPTG is a sulfur analog of lactose.

The Hardy-Weinberg law (equation) is a mathematical model in which allele frequencies in populations remain constant from generation to generation. Given all the conditions that must be met for the Hardy-Weinberg equation to be valid, why is this equation useful for studying population genetics?

-It can identify evolutionary forces that can cause changed in allele frequencies in the real world -It provides a simplistic view of reality, serving as starting point and basis for comparison for further examination of real populations

Explain how inbreeding can have a positive effect on population fitness.

-Populations may become homozygous for beneficial alleles following selection just as they could become homozygous for negative alleles.

-The difference between the two heights is 90 cm. -There are 10 alleles total (two each for five different genes). -If each additive allele contributes equally to increasing height from a baseline of 130 cm, -the contribution of each is 9 cm.

List the three basic components required for bacterial cloning vector and briefly describe the purpose of each

-origin in replication for propagation in the host -selectable marker like Amp resistance -polylinker or unique restriction enzyme sites to facilitate cloning

In a population of cattle, the following color distribution was noted: 36% red (RR), 48% roan (Rr), and 16% (rr). Is this population in a Hardy-Weinberg equilibrium?

-yes, .36 + .48 + .16 = 1 also sqrt .36 + sqrt .16 = 1 -yes, b/c in equilibrium

Assuming that p = 0.3 for a population, what would be the expected frequency of heterozygotes for the involved allelic pair?

0.42 p=0.3=a q=1-p q=1-0.3=0.7=A 2pq = Aa 2(0.3)(0.7) = 0.42

A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment.

A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are__ site(s) for this enzyme in this fragment.

How many Barr bodies would you expect to see in an XXY individual?

The code is nonoverlapping, meaning that, assuming "standard translation" a given base participates in the specification of _____ amino acid(s).

are__ site(s) for this enzyme in this fragment.

Name six different levels at which gene expression might be controlled.

1. Alteration or modification of the gene structure at the DNA level 2. Transcriptional regulation 3. Regulation at the level of mRNA processing 4. Regulation of mRNA stability 5. Regulation of translation 6. Regulation by pos -translational modification of the synthesized protein

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequence? 1. CAAT, TATA 2. GGTTC, TTAT 3. TTTTAAAA, GGGGCCCC 4. any trinucleotide repeat 5. satellite DNAs

1. CAAT, TATA

Steps of Eukaryotic DNA Recombination

1. Endonuclease nicking 2. Strand displacement 3. Ligation 4. Branch Migration 5. Duplex separation 6. 180 Rotation 7. Endonuclease nicking 8. Ligation

The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number? 1. It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing. 2. There are more introns than exons. 3. There are more axons than introns. 4. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes. 5. Every gene can be read in both directions, and each gene can have inversions and translocations.

1. It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing.

What term would be applied to a regulatory condition that occurs when protein greatly reduces transcription when associated with a particular section of DNA? 1. Negative control 2. Positive control 3. Inhibition 4. Activation 5. Stimulation

1. Negative control

Insulators can block the effects of enhancers only when 1. They lie between an enhancer and a promoter 2. They lie upstream of a promoter 3. They lie adjacent to a promoter 4. They lie within the structural genes 5. They lie within a consensus sequence

1. They lie between an enhancer and a promoter

Which of these is a level of regulation in eukaryotes? 1. Transport 2. Processing 3. Post-translational 4. Operon 5. Transcriptional

1. Transport 2. Processing 3. Post-translational 5. Transcriptional

What must be true for a population to be in Hardy-Weinberg equilibrium?

1. no mutations 2. no migrations into the population 3. no selection pressure 4. random mating 5. large enough (infinitely large) population size

The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacteriophages made use of the following labeled components. 1. phosphorous and sulfur. 2. nitrogen and oxygen 3. tritium. 4. hydrogen. 5. None of these answers are correct.

1. phosphorous and sulfur.

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be genotypically AaBbCcDd ?

1/16

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be genotypically AaBbCcDd?

1/16

What is the probability of flipping a penny and a nickel and obtaining one head and one tail?

1/2

In general, mutation rates in humans occur in the range of ________ (frequency) per gamete per generation.

10^-5 to 10^-6

10% recombination is equal to how many map units?

10mu

Phenotypically wild F1 female Drosophila, whose mothers had light eyes (lt) and fathers had straw (stw) bristles produced the following offspring when crossed to homozygous light-straw males: Phenotype | Number Light, straw 22 Wildtype 18 Light 990 Straw 970 Total: 2000 What is the map distance between the light and straw loci

Mitosis ends with ____, while meiosis ends with ___.

2 diploid cells, 4 haploid cells

Ability to roll the tongue is caused by a dominant allele. A woman is a "roller", but one of her parents is not. What is the woman's genotype? 1. homozygous dominant 2. heterozygous 3. homozygous recessive 4. cannot be determined from this information

2. heterozygous

The relationship between a gene and a messenger RNA is that 1. genes are made from mRNAs. 2. mRNAs are made from genes. 3. mRNAs make proteins, which then code for genes. 4. all genes are made from mRNA. 5. messenger RNA is directly responsible for making Okazaki fragments.

2. mRNAs are made from genes.

An organism has a G content of 30%. What is the percentage for A

20%

An organism has a G content of 30%. What is the percentage of A?

20%

Assuming that an amino acid sequence is 250 amino acids long, how many different molecules, each with a unique sequence, could be formed?

20^250

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. What is the total number of chromosomes in a polar body cell from a rat?

Both RNA and DNA absorb UV light most strongly at

260nm

Assume that in the F2 of a series of crosses, 1/64 of the offspring resemble one of the parents (P). How many gene pairs are involved in producing these results?

Assume that you are studying a trait determined by a number of polygenes. If there are seven phenotypic categories, how many genes are probably involved?

Flower diameter in sunflowers is a quantitative trait. A plant with 6-cm flowers, from a highly inbred strain, is crossed to a plant with 30-cm flowers, also from a highly inbred strain. The F1 have 18-cm flowers. F1 × F1 crosses yield F2 plants with flowers ranging from 6 to 30 cm in diameter, in approximately 4-cm intervals (6, 10, 14, 18, 22, 26, 30). The number of different genes influencing flower diameter in this plant is

Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5' UCG 3', considering wobble-base pairing rules.

3' ACG 5' (exact)

An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it? 5' ATC 3' 3' ATC 5' 5' AUG 3' 3' AUG 5'

3' AUG 5'

When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing.

3' base

Assume that the molar percentage of thymine in a double-stranded DNA is 20. What are the percentages of the three other bases (G, C, A)? G = ____ %

30, 30, 20

Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.

300, 700, 1000, 1200

Assume that a dihybrid F2 ratio, resulting from epistasis, was 15:1. If a double heterozygote was crossed with the fully recessive type, what phenotypic ratio is expected among the offspring?

3:1

In the mouse, gene A allows pigmentation to be deposited in the individual coat hairs while its allele a prevents such deposition of pigment, resulting in an albino. Gene B gives agouti (wild-type fur) while its allele b gives black fur. The cross between a doubly heterozygous agouti mouse mated with a doubly homozygous recessive white mouse is: AaBb x aabb What would be the expected phenotypic ratio in the progeny?

4 agouti: 8 albino: 4 black

The haploid human genome contains about 3 × 109 nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter cleave?

4 base cutter = (1/4)^4 = 1/256bp gets cut (3x10^9)/256 = 11,718,750 cuts 6 base cutter = (1/4)^6 = 2.44e-4 ~ 1/5000bp gets cut (3e9/5000) = 600,000 cuts 8 base cutter = (1/4)^8 = 1e-5 ~1/100,000 gets cut (3e9/100000) = 30,000 cuts

Name two mutagens that would be classified as base analogs. 1. Acridine orange and proflavin 2. Ethylmethane sulfonate and ethylmethylketone peroxide 3. Ultraviolet light and cosmic radiation 4. 5-bromouracil and 2-aminopurine 5. Hydroxyurea and peroxidase

4. 5-bromouracil and 2-aminopurine

Individuals with Klinefelter and Turner syndromes have how many chromosomes respectively?

47, 45

Assume that there are 12 map units between two loci in the mouse and that you are able to microscopically observe meiotic chromosomes in this organism. If you examined 200 primary oocytes, in how many would you expect to see a chiasma between the two loci mentioned above?

You have been working on a phenotypic trait believed to be controlled by a number of genes. In an experiment you have crossed two lines of pure breeding plants with the two extreme phenotypes of this trait. You have grown up 2000 plants resulting from this cross. 2 of these plants are at one phenotypic extreme, 2 others are of the other phenotypic extreme. What is the most likely number of genes affecting this trait?

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? 3' TACCGTGCGTGACATTAAGCC 5'

5' ATGGCACGCACTGTAATTCGG 3'

The discontinuous aspect of replication of DNA in vivo is caused by A. polymerase slippage B. trinucleotide repeats C. the 5' to 3' polarity restriction D. topoisomerases cutting the DNA in a random fashion E. sister-chromatid exchanges

5' to 3' polarity restriction

α subunit

5'-->3' polymerization

What direction does DNA polymerase add dNTP monomers?

5'->3'

Name two mutagens that would be classified as base analogs.

5-bromouracil and 2-aminopurine

Present a description of the molecular mechanism of the mutagenic action of any two of the following mutagens: 5-bromouracil, proflavin, ultraviolet light.

5-bromouracil is an analog of thymine, which anomalously pairs with guanine. Proflavin adds or removes single bases from DNA, thus causing frameshift mutations. Ultraviolet light causes thymine dimers.

E. coli bacteria are placed into a medium containing glucose and lactose. Which of the genes below do you expect to be turned on? 1. F-galactosidase 2. Lac I 3. Lac P 4. Permease 5. None of the above

5. None of the above

It is estimated that transposable elements compose approximately what percent of the human genome?

Assume that a given plasmid vector to be used in a cloning experiment contains 4000 base pairs of DNA. Assume also that the restriction endonuclease Cuj cuts this plasmid at the following sites (starting from an arbitrary zero point): 1000, 1500, and 3000. Given complete digestion of the plasmid with the endonuclease so that only linear fragments are produced, what sizes of DNA are expected?

500 bp, 1500 bp, and 2000 bp

In a three point mapping experiment, how many different genotypic classes are expected?

How many different kinds of gametes can be produced by an individual with the genotype AABbCCddEeFf?

8 Solve via 2^n (n being the # of heterozygous gene pairs)

Drosophila melanogaster, the fruit fly, has a 2n chromosome number of 8. Assuming that a somatic G2 nucleus contains about 8.0 picograms of DNA, how many picograms of nuclear DNA would you expect in: Mitotic metaphase A primary oocyte (metaphase) A secondary oocyte (metaphae) A first polar body (metaphase)

8, 8, 4, 4

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be phenotypically ABCD ?

81/256

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be phenotypically ABCD?

81/256

Assume that a dihybrid cross is made in which of the genes loci are autosomal, independently assorting, and incompletely dominant. How many different phenotypes are expected in the offspring?

Assume that four polygenic gene pairs are involved in determining phenotypes of F2. How many phenotypic classes are expected?

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids?

900

Assuming Mendel's Second Law is correct, what is the expected segregation ratio for traits in a dihybrid cross?

9:3:3:1

Explain dominance and codominance with respect to the ABO blood groups. Which blood types are dominant, which are recessive, and which are codominant? What does it mean to say that two blood types are codominant?

A and B blood types are co-dominant, they are bothdminant alleles and because they are co dominant they are expressed equally. O is the absence of an antigen, so it's not technically recessive

What is a cDNA molecule?

A cDNA molecule is a molecule of DNA that has been produced from an mRNA template.

It has been found that a particular "+ —" combination of frameshift mutations in gene X gives a wild-type phenotype, whereas a "— +" combination gives a mutant phenotype, even though the sites of insertion/deletion are the same. How might these results be explained?

A frameshift in the "+ -" direction may have introduced a nonsense triplet, which was not introduced, by chance, by the opposite "- +" combination.

Define polymorphism.

A gene or a trait is said to be polymorphic if there is more than one form of that trait in a population.

How might one determine whether a particular suspected gene is capable of causing cancer in mammals when it is overly expressed?

A general method could take the normal gene and, through the use of genetic manipulations such as translocations, inversions, or insertions, place the gene in question next to relatively strong gene promoters and enhancers. One could then introduce the composite gene complex into a mouse to generate a transgenic strain. If the transgene is expressed at high levels, one could determine its influence on the induction of cancer.

What is a homeobox, and what is its significance?

A homeobox is a DNA sequence, around 180 base pairs long, found within genes that are involved in the regulation of patterns of anatomical development (morphogenesis) in animals, fungi and plants.

Why is a karyotype done at metaphase of the cell cycle? Specifically, what is being observed at this point in the cell cycle?

A karyotype is a picture of a squash of chromosomes taken at metaphase of the cell cycle (following DNA synthesis) bc that's when condensations of the chromosomes has taken place prior to segregation to daughter cells. At other times in the cell cycle, the chromosomes would not be visible. Specifically, we are observing two sets of "sister chromatids" for each chromosome bc the photograph is taken after DNA synthesis has occurred but before chromatid separation happened.

The primary structure of a protein is:

A linear chain of amino acids

Which statement is true regarding heritability and continuous variation?

A low heritability score means that genes are less influential than environment in determining phenotypic variation.

What is meant by a suppressor mutation?

A suppressor mutation is a second mutation that alleviates or reverts the phenotypic effects of an already existing mutation in a process defined synthetic rescue. Genetic suppression therefore restores the phenotype seen prior to the original background mutation.

What are the four nucleotides that make up RNA

Adenine (A), Guanine (G), Cytosine (C), Uracil (U)

What are the four nucleotides that make up RNA? Give full names, not abbreviations.

Adenine (A), guanine (G), cytosine (C), and uracil (U)

Which of the following human genotypes is associated with Klinefelter syndrome? XXY all of the above XXXY none of the above XXYY

All of the above

What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common?

All produce DNA chains as a product.

What is meant by the symbolism p + q = 1.0?

All the dominant alleles and all the recessive alleles comprise all of the alleles for that gene in the given population.

Telomerase

An enzyme that catalyzes the lengthening of telomeres in eukaryotic germ cells.

Under ideal conditions, how many copies of all the sequences of the host genome should be represented in a genomic library? Why?

At least one should be represented. Typically, library construction includes a several-fold greater number of clones than necessary for one representative of each fragment in order to increase the likelihood of cloning difficult fragments and stochastic loss.

In what part of the mRNA does degradation generally begin?

At the 5' end with the removal of the methyl cap

Select three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes. A) 3'-capping, 5'-poly A tail addition, slicing B) 5'-capping, 3'-poly A tail addition, slicing C) 5'-poly A tail addition, excision of introns, capping D) Removal of exons, insertion of introns, capping E) Base modification, heteroduplex formation, capping

B) 5'-capping, 3'-poly A tail addition, slicing

Which of the following is TRUE for both prokaryotic and eukaryotic gene expression? After transcription, a 3' poly-A tail and a 5' cap are added to mRNA RNA polymerase binds to the promoter region to begin transcription mRNA is synthesized in the 3'--> 5' direction The mRNA is the exact compliment of the gene from which it was copied

B. RNA polymerase binds to the promoter region to begin transcription

Splicing of eukaryotic pre-mRNA involves__reactions and occurs in the__ Methylation Transesterification Polyadenylation Nucleus cytoplasm

B. Transesterification D. Nucleus

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces high amounts of B-galactosidase. What is a possible genotype of the cells? lacI+, lacP+, lacO+, lacZ-, LacY+, lacA+ lacI+, lacP+, lacOc, lacZ+, lacY+, lacA+ lacI-, lacP+, lacO+, lacZ-, lacY+, lacA+ lacI+, lacP-, lacO+, lacZ+, lacY+, lacA+

B. lacI+, lacP+, lacOc, lacZ+, lacY+, lacA+

What enzyme is exploited to produce synthetic mRNAs? Polynucleotide kinase Polynucleotide phosphorylase Ligase RNA polymerase II

B. polynucleotide phosphorylase

What is the general position of the consensus sequence called the GC box? What is its sequence?

B. promoter, GGGCGG

The _________________, which binds to a core promoter, consists of general transcription factors and RNA polymerase.

Basal Transcription Apparatus

Because real-life populations are, of course, not infinitely large, why is the Hardy-Weinberg condition of an "infinitely large population" usually met for natural populations?

Because most populations large enough that chance factors like sampling errors and genetic drift have little to no effects on allele frequencies

The anticodon on the tRNA molecule: A. binds to the mRNA in a complementary fashion B. is oriented and written in the 5' to 3' direction C. is a catlytic part of protein synthesis D. is the same for all tRNA molecules E. contains amino-acyl-tRNA synthase

Binds to the mRNA in a complementary fashion

Kornberg, in his experiments to demonstrate the function of DNA polymerase I, sought to show that DNA Pol 1 was capable of replicating biologically active DNA. what is the definition of biologically active DNA in this context?

Biologically active DNA is capable of supporting metabolic activities and directs reproduction of the organism from which it was originally duplicated

Kornberg, in his experiments to demonstrate the function of DNA polymerase I, sought to show that DNA Pol 1 was capable of replicating biologically active DNA. What is the definition of biologically active DNA in this context?

Biologically active DNA is capable of supporting metabolic activities and directs reproduction of the original organism from which it was originally duplicated

The bicoid gene of Drosophila generates embryos with two posterior regions. What aspect of embryonic development does the bicoid gene control?

Body segmentation, in this case, the posterior region (3

Compare and contrast positive and negative control of gene expression in bacteria.

Both forms of control result from an interaction of a molecule (usually considered to be a protein) with the genetic material (either RNA or DNA). Positive control results when the interaction stimulates transcription, whereas negative control occurs when the interaction inhibits transcription.

What experimental methods led Avery, McCarty, and Macleod to determine that DNA was the "transforming material" in their classic experiment? Be as specific as possible in your answer for full credit.

By first removing proteins they still got transformation in vitro. Next they removed RNA and still got transformation. However, when they degraded DNA they no longer got transformation, therefore they concluded that DNA must be the transforming material.

Which of the following are among the major components of prokaryotic ribosomes? A) 12A rRNA, 5.8S rRNA, and proteins B) 16S rRNA, 5.8S rRNA, and 28S rRNA C) 16S rRNA, 5S rRNA, and 23srRNA D) 18S rRNA, 5.8S rRNA, and proteins E) None of the above

C) 16S rRNA, 5S rRNA, and 23srRNA

During the polymerization of nucleic acids, covalent bonds are formed between neighboring nucleotides. Which carbons are involved in such bonds?

C-3' and C-5'

Telomeres ____________ the end of chromosomes Transcribe Replicate Stabilize Destabilize

C. Stabilize

Assuming one mutational event in a gene, on average, which of the following mutagens would be expected to cause the most damage to a protein synthesized by such a mutagenized gene? 5-bromouracil 2-amino purine Acridine orange Ethylmethane sulfonate

C. acridine orange

LINES differ from retrotransposons in that LINES: Do not encode transposase Do not encode reverse transcriptase Do not contain LTRs Do not transpose in a replicative manner Do not contain the transposase gene

C. do not contain LTRs

The spliceosome is a large enzyme that catalyzes removal of specific Junk sequences in the DNA by splicing different pairs of a gene Amino acid sequences in the protein by splicing different parts of a protein Introns in pre-mRNAs Sequences in either a DNA or an RNA None of the above

C. introns in pre-mRNAs

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by Knowing the isoelectric points of the piece in equation Measuring the sizes of the bands on the gel Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest Identifying the molecular weights of the fragments in question None of the above

C. removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest

When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that The two proteins have identical functions The two proteins have no common origin The two proteins share a common ancestry The two proteins have identical tertiary structures The primary structures differ, but the secondary structures are identical

C. the two proteins share a common ancestry

The _____ box sequence appears to be critical to the ability of many eukaryotic promoters to facilitate transcription.

CAAT

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences?

CAAT, TATA

Name three types of consensus sequences or modular DNA sequences that exist upstream from the coding regions of some eukaryotic genes.

CAAT, TATA, GC repeats

Of the DNA sequences below, which would probably be the harder to determine? CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA

CGATATATATATATATACGAT

We discussed cis regulatory elements (CRMs) in transcriptional networks. What are CRMs and how are they involved in gene regulation?

CRMs are DNA sequences found within the introns and or upstream or downstream of genes. They consist of a few hundred base pairs that contain binding sites for transcription factor proteins that are involved in activating (or repressing) transcription of the genes that they are located adjacent to..

This process moves a nucleosome from the TATA box of a gene's promoter so that transcription can occur.

Chromatin Remodeling

Microscopy to look at a cell's chromosomes is often done when the cell is in mitotic metaphase. For example, karyotypes that extract chromosomes from a single cell and photograph them to look for abnormalities are done on metaphase, rather than interphase. Why?

Chromosomes are condensed and visible.

In anaphase:

Chromosomes move to opposite poles

Which of the following clusters of terms applies when addressing enhancers or silencers as elements associated with eukaryotic genetic regulation?

Cis-acting, variable orientation, variable position

γ complex

Clamp enzyme loading

What is the name given to the three bases in a messenger RNA that bind to the anticodon of tRNA to specify an amino acid placement in a protein?

Codon

Coding Strand of DNA

Complement to template strand, analogous sequence of mRNA

In order to determine if mutations from different organisms that exhibit the same phenotype are allelic, which test would you perform?

Complementation test

What conditions are likely to apply if the progeny from the cross AaBb X AaBb appear in the 9:3:3:1 ratio? complete dominance no gene interaction independent assortment linked genes co-dominance

Complete dominance Independent assortment No gene interaction

What xfdels were suggested to originally describe the nature of DNA replication? A. conservative B. semiconservative C. dispersive D. continuous E. semidispersive

Conservative, semiconservative, dispersive

Heterochromatin is characterized by all the following, EXCEPT that it Contains genes that require high levels of transcription Is present all over the inactive X chrom in mammals Is present on most of the Y chrom Remains highly condensed throughout the cell cycle Is present at centromeres and telomeres

Contains genes that require high levels of transcription

θ subunit

Core assembly

Name one characteristic of X-linkage that is often used to identify X-linked genes in pedigree analysis.

Criss-cross pattern of inheritance-where all sons exhibit mutant mother phenotype, the phenotype largely or exclusively affects males.

Chromosomes are randomly partitioned during ___, contributing to genetic diversity. A. mitosis prophase B. mitosis telophase C. meiosis I prophase D. meiosis I anaphase E. meiosis II prophase F. meiosis II anaphase

Which is true about the secondary structure of DNA? Thymine pairs with guanine Cytosine pairs with adenine Sugar-phsophate groups are on the inside of the DNA molecule Bases on complementary strands are held together by hydrogen bonds Nucleotide bases are on the outside of the DNA molecule

D. bases on complementary strands are held together by hydrogen bonds

Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides? Centrifugation sedimentation gradient Fluorescently labeled dNTPs Fluorescently labeled dATP Different fluorochromes attached to the four different ddNTPs

D. different fluorochromes attached to the four different ddNTPs

The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function after it has been heated to 95 degrees C. Why would such heat-stable polymerase be beneficial in PCR? Each cycle includes a "hot" saturation phase (95C), which allows the primers to anneal to the target DNA Each cycle includes a "hot" denaturation phase (95) which serves to sterilize the culture Each cycle includes a "hot" denaturation phase (95C), which activates the Taq polymerase Each cycle includes a "hot" denaturation phase (95C) , which separates the hydrogen bonds that hold the strands of the template DNA together More than one of these answers is correct

D. each cycle includes a "hot" denaturation phase (95C), which separates the hydrogen bonds that hold the strands of the template DNA together

Which of the following is NOT true regarding the differences in mRNA between prokaryotic cells and eukaryotic cells?

D. in eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not

A mutant E. coli strain, grown under conditions that normally induce the lac operon, does not produce B-galactosidase. What is a possible genotype of the cells?

D. lacI+, lacP- , lacO+, lacZ+, lacY+ , lacA+

Compared with eukaryotic chromosomes, bacterial chromosomes are Large, mainly organized in monocistronic transcription units without introns Small, mainly organized in monocistronic transcription units with introns Large, mainly organized in polycistronic transcription units without introns Small, with high gene density Large, triple-helix, Z-DNA, organized in monocistronic units with introns

D. small, with high gene density

in the lactose operon, the product of structural gene lacZ is capable of Nonautonomous replication Forming lactose from two glucose molecules Replacing hexokinase in the early steps of glycolysis splitting the β-linkage of lactose

D. splitting the β-linkage of lactose

In general, a "model organism" used in genetics studies is one in which there is a large body of genetic knowledge that has been compiled over decades of genetic research. In addition, model organisms have available their DNA sequences and collections of ____ that make detailed genetic analysis possible and efficient. Complete metamorphic systems Incomplete metamorphic systems Epigenetic developmental systems Strains with specific mutations Museum specimens

D. strains with specific mutations

siRNAs and miRNAs are produced by: The cleavage of RISCs by endonucleases The cleavage of functional mRNA within the cytoplasm The cleavage of pre-mRNA in the nucleus The cutting and processing of double-stranded RNA by DICER enzymes The cutting and processing of double-stranded RNA by Slicer enzymes

D. the cutting and processing of double-stranded RNA by DICER enzymes

It has been recently determined that the gene for Duchenne muscular dystrophy (DMD) is over 2000 kb (kilobases) in length; however, the mRNA produced by this gene is only about 14 kb long. What is a likely cause of this discrepancy? The exons have been spliced out during mRNA processing The DNA represents a double-stranded structure, while the RNA is single stranded There are more amino acids coded for by the DNA than the mRNA The introns have been spliced out during mRNA processing When the mRNA is produced, it is highly folded and therefore less long

D. the introns have been spliced out during mRNA processing

The long-term storage of genetic information in a cell occurs in the:

DNA

Experiments conducted in the 1920s by Frederick Griffith involving the bacterium Diplococcus pneumoniae demonstrated that a substance from one bacterial strain could genetically transform other bacterial strains. What was the name of the substance capable of such transformation? Who finally determined its identity?

DNA Avery

Which of the following enzymes are known to be involved in the replication of DNA in bacteria? DNA Polymerase II DNA Polymerase I RNA Polymerase II RNA primase ligase

DNA Polymerase I RNA Primase Ligase

Which term most appropriately refers to a regulatory protein in prokaryotes?

DNA binding protein

During interphase of the cell cycle,

DNA content essentially doubles

Viral chromosomes exist in a variety of structures and can be made up of the following:

DNA or RNA

Which of the following enzymes are known to be involved in the replication of DNA in bacteria? DNA polymerase I DNA polymerase II Ligase RNA primase RNA polymerase II

DNA polymerase I Ligase RNA primase

Which enzyme catalyzes the addition of nucleotides to a growing DNA chain?

DNA polymerase catalyzes the addition of nucleotides to a growing DNA chain.

Strand discrimination during the process of _____________ is based on DNA methylation in E. coli.

DNA repair

It is common to use ddNTPs in which of the following biochem reactions? Citric acid cycle DNA sequencing Restriction digestion Electron transport plasmolysis

DNA sequencing

In biology, most information flows through which sequence?

DNA to RNA to protein

Hersey-Chase conclusion

DNA was acting as the genetic material in T2 bacteriophage Additional evidence followed in subsequent years that supported this conclusion

When regions around genes become sensitive to the enzyme ______________ this is an indication that those regions are becoming ______________ active.

DNase I, transcriptionally

Explain at least two reasons why the following definition of a gene is incomplete: "A gene consists of DNA sequences that encode a single polypeptide."

Definition does not include 1. regulatory sequences 2. not all genes are DNA sequences (see RNA virus) 3. not all genes transcribe a single RNA molecule 4. not all RNA molecules encode for a single polypeptide. Answer should have 2 of these elements (or others that make sense).

Explain at least TWO reasons why the following definition of a gene is incomplete: "A gene consists of DNA sequences that encode a single polypeptide"

Definition does not include: 1. Regulatory sequences 2. Not all genes are DNA sequences 3. Not all genes transcribe a single RNA molecule 4. Not all RNA molecules encode for a single polypeptide

Experiments conducted in the 1920s by Frederick Griffith involving the bacterium Diplococcus pneumoniae demonstrated that a substance from one bacterial strain could genetically transform other bacterial strains. What was the name of this transformation? Who finally determined its identity?

Deoxyribonucleic acid, Avery

_______ is the process whereby a cell's determined state is expressed

Differentiation

What three possible models were suggested to originally describe the nature of DNA replication?

Dispersive Semiconservative Conservative

What is the function of dideoxynucleotides in Sanger DNA sequencing? They act as primers for DNA polymerase They act as primers for reverse transcriptase They cut the sequenced DNA at specific sequencing of the RNAs of a genome They allow only the specific sequencing of the RNAs of a genome They stop synthesis at a specific site, so the base at that site can be determined

E. they stop synthesis at a specific site, so the base at that site can be determined

Restriction endonucleases are typically used to clone genes. What factors determine the sites at which these endonucleases will cleave DNA? What characteristics do these sites tend to have?

Each RE will cleave at a specific sequence. These sequences tend to be short (4-8 bp), and tend to be palindromic (e.g., GAATTC).

Condition the location of genes in the interphase nucleus, certain chromosomal territories appear to exist, specifically,

Each chromosome appears to occupy a discrete domain

_____________ can cause the same genotype to produce a range of potential phenotypes.

Environmental effects

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes Excision of introns Linkage to histone molecules Fusion into circular forms known as plasmids Union with ribosomes

Excision of introns

If one compares the base sequences of related genes from different species, one is likely to find that corresponding ______ are usually conserved, but sequences of ______ are much less well conserved. Exons; introns Introns; exons Introns; chaperons Chaperons; exons Introns; proteins

Exons; introns

TRUE or FALSE The data obtained from the Meselson-Stahl experiment after one generation of replication eliminated the dispersive model of DNA replication.

False

True or False. The data obtained from the Meselson-Stahl experiment after one generation of replication eliminated the dispersive model of DNA replication.

False

Assume that an organism has a diploid chromosome number of six. Two chromosomal pairs are telocentric, and the other pair is metacentric. Assume that the sex chromosomes are morphologically identical. The drawing above could represent which stage(s)? Check all that apply.

First polar body (metaphase) Secondary oocyte (metaphase) Secondary spermatocyte

What is the function of peptidyl transferase activity?

Forms peptide bonds

Describe what is meant by the term forward genetics.

Forward genetics involves the isolation of mutants that show differences in a particular phenotype of interest. Mutant isolation is usually followed by an analysis of gene pathways through epistasis and/or complementation analyses. Then the gene is usually mapped and cloned and studied by a variety of molecular and developmental approaches.

What is functional complementation?

Functional complementation is a process whereby plasmids or other vectors containing all, or at least a high percentage, of the genes from an organism are individually transformed into a mutant strain until one clone restores the mutant phenotype to wild type. This process usually allows the investigators an opportunity to isolate a functional stretch of DNA about which some knowledge of function is already available.

Assume that the molar percentage of thymine in a double-stranded DNA is 20. What are the percentages of the three other bases (G, C, A)?

G = 30 C = 30 A = 20

What is the role of maternal-effect genes?

Genes derived from the maternal genome are actively transcribed to support the zygote and are required for the proper patterning of the embryo. Mutant phenotypes of maternal-effect reflect the genotype of the mother.

What does the expression 2pq represent?

Genotype frequency of heterozygotes

The catabolite repression system in E. coli essentially represses the lac operon when glucose is present. What evolutionary advantage would favor the evolution of such a system?

Glucose can enter glycolysis "as is," while lactose must first be split into glucose and galactose. To do this, the energy requiring synthesis of B-galactosidase is needed. It is energy efficient to burn glucose rather than lactose.

How was it determined that X rays are mutagenic?

H. J. Muller determined that a direct relationship occurred between X-linked recessive lethals and X ray dose in Drosophila.

Which of these are major structural classifications of DNA-binding domains that are found in eukaryotic transcription factors?

Helix turn helix, zinc finger, leucine zipper

______ is a measure of the degree to which the phenotypic variation of a given trait is due to genetic factors

Heritability

Ability to roll the tongue is caused by a dominant allele. A woman is a "roller", but one of her parents is not. What is the woman's genotype?

Heterozygous

What is unusual about the amino acid composition of histones? How is the function of histones related to the amino acid composition? Of which histones are nucleosomes composed?

Histones contain large amounts of positively charged amino acids such as lysine and arginine. Thus, they can bind electrostatically to the negatively charged phosphate groups of nucleotides. Nucleosomes are composed of all histones except H1.

What class of genes controls the developmental identity of segments along the anterior-posterior axis?

Homeotic genes

What are homeotic genes and what do they do?

Homeotic genes are hox genes and they determine the identity of each segment in embryo development and the adult structure formed from the segment

Describe the difference between meiosis I and meiosis II

Homologs pair and segregate in meiosis I. Sister chromatids are paired and segregate in meiosis II. Crossing over occurs in meiosis I but not in meiosis II.

This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.

Human Genome Project

A woman who has blood type A has a daughter who is type O and a son who is type B. Which of the following is a possible genotype for the son?

IBi

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins?

When generating a series of mutations in an organism, how does a genetic screen differ from a mutation selection?

In a genetic screen, one mutagenizes the organism and then physically searches for the mutations. In a selection experiment, conditions are established in which only the relevant organisms survive. Selection is usually accomplished by killing or inhibiting the growth of irrelevant organisms.

What is catabolite repression? How does it allow a bacterial cell to use glucose in preference to other sugars?

In catabolite repression, the presence of glucose inhibits or represses the transcription of genes involved in the metabolism of other sugars. Because the gene expression necessary for utilizing other sugars is turned off, only enzymes involved in the metabolism of glucose will be synthesized. Operons that exhibit catabolite repression are under the positive control of catabolic activator protein (CAP). For CAP to be active, it must form a complex with cAMP. Glucose affects the level of cAMP. The levels of glucose and cAMP are inversely proportional—as glucose levels increase, the level of cAMP decreases. Thus, CAP is not activated.

Molecular/structural orientations (gradients) in an egg are thought to play a significant role in development. What is the origin of such gradients? What evidence indicates that the maternal genotype is involved in providing such gradients?

In examples of maternal effects, the mother's genotype establishes the early body plan. During formation of any egg, nutritional, regulatory, and informational molecules (RNAs) are placed in appropriate positions for development of the embryo. In Drosophila many maternal-effect genes have been identified.

Why is the genetic code "nearly" universal?

In some organisms or in mitochondrial genomes, the codon usage is different What a codon transcribes in one organism may be different in another.

Briefly describe what is meant by the term exon shuffling.

In the 1970s, Walter Gilbert suggested that the functional regions of genes in eukaryotes consist of collections of exons originally present in ancestral genes that are brought together through various recombination events over time.

Describe two mating patterns that have an impact on the genetic composition of a population.

Inbreeding—preferential mating with close relatives Assortative mating—preferential mating with individuals of dissimilar or similar genotype or phenotype.

Channels between chromosomes in the interphase nucleus are called

Interchromosomal compartments

A(n) ________ is a section of an RNA that gets spliced out.

Intron

Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why?

Introns are removed from mRNA before translation.

What is the function of cAMP in regulation of the lac operon?

It activates an activator protein.

There is some indication that the code is in some way ordered; a certain pattern exists. Name an observation that supports this view.

It has been observed that amino acids that are chemically similar share the middle base of their respective codons. Also, codons that share the same two starting nucleotides frequently encode the same amino acid.

It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing.

Transposable elements are also known as:

Jumping genes, mobile genetic elements

What do kinase enzymes do to other proteins? In what ways can this activity affect the function of these proteins?

Kinase enzymes act by phosphorylating (adding a phosphate) to other proteins. This has an effect on the phosphorylated protein by changing that protein's target, activity, or association with other proteins.

Which are abnormalities involving numbers of X chromosomes? XXXX syndrome Klinefelter syndrome Huntington's disease Turner syndrome Down syndrome

Klinefelter Syndrome Turner Syndrome XXXX Syndrome

The lac repressor binds to

Lactose and DNA

Which of the following are general categories of mutations? Select all that apply Lethal Conditional Behavioral DNA protein

Lethal Conditional Behavioral

What is meant by the term low gene density? Give an example of an organism with low gene density.

Low number of genes per base pairs -humans have low gene density (ex: chromosome 22)

Assume that a base addition occurs early in the coding region of a gene. Is the protein product of this gene expected to have more or fewer (state which) altered amino acids compared with the original gene with a base deletion late in the coding region?

The genes for mahogany eyes and ebony body are approximately 25 map units apart on chromosome III in Drosophila. Assume that a mahogany-eyed female was mated to an ebony-bodied male and that the resulting F1 phenotypically wild-type females were mated to mahogany, ebony males. Of 1000 offspring, what would be the expected numbers of the following phenotypes:

Mahogany: 375 Ebony: 375 Wildtype: 125 Mahogany, ebony: 125

List two statistical terms commonly used in the analysis of quantitative traits

Mean and variance

Chromosomes are randomly partitioned during _____, contributing to genetic diversity.

Meiosis I anaphase

Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression).

Microarray

What is the difference between a missense mutation and nonsense mutation?

Missense mutations alter the coding sequence so that one amino acid is substituted for another. Nonsense mutations change a codon originally specifying an amino acid into a translation termination codon.

The stage at which "sister chromatids go to opposite poles" immediately follows which stage listed below?

Mitotic metaphase

The __________ hypothesis suggests that many factors or genes contribute to the phenotype in a cumulative or quantitative manner.

Multifactorial trait

What is a significant drawback to using the mouse as a model organism compared with Drosophila?

Mutations can be generated more easily in drosophila

Describe the function of N-formylmethionine in prokaryotes.

N-formylmethionine is a modified amino acid, which serves as the starting amino acid in protein synthesis.

conservative replication

New & old strands re-anneal w/one another following replication

The triplet binding assay utilized to verify 50 of the 64 possible codons in the genetic code was developed by:

Nirenberg and Leder

Genes can be located in which organelles? Ribosome Nucleus Golgi Chloroplast Vacuole mitochondria

Nucleus Chloroplast mitochondria

The F1 offspring of Mendel's classic pea cross always looked like one of the two parental varieties because

One allele was completely dominant over another

_____________ are complexes where, among other activities, a great deal of RNA degradation takes place.

P bodies

Degradation of a eukaryotic mRNA is generally preceded by shortening of the _____________.

Poly(A) tail

Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli? repressible system constitutive negative control inducible system positive control

Positive control

Certain triplets (AUG) commonly signal the starting point for protein synthesis, while other triplets typically signal stop (UAA, UGA, UAG). In terms of the genetic code, what is the term for this type of signal?

Punctuation (initiation, termination). AUG (rarely GUG) for initiation; UAA, UGA, and UAG for termination

_______________ is also known as RNA silencing and posttranscriptional gene silencing.

RNA Interference

Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe. RNA Pol I; RNA Pol II; RNA Pol III a. mRNA b. tRNA c. rRNA d. snRNA

RNA Pol I: c RNA Pol II: a, d RNA Pol III: b, c, d

Ribozymes

RNA molecules that act as enzymes

An intron is a section of

RNA that is removed during RNA processing.

The RNA World theory suggests that

RNA was the genetic material in the first living cells

The "RNA World" theory suggests that:

RNA was the genetic material in the first living cells.

A cross was made bw homozygous wild-type female Dros and yellow-bodied male Dros. All resulting offspring were wild-type. F2 gen offspring had the following phenotypes: Sex: Pheno: #: Male wild 96 Male yellow 99 Female wild 197 Is the mutant gene for yellow body behaving as a recessive or dominant? Is the yellow locus on an autosome or on the X chrom?

Recessive X chrom

What is recombinant DNA technology? What are the safety issues related to recombinant DNA technology?

Recombinant DNA technology refers to the creation of new combinations of DNA molecules that are not normally found in nature. Safety issues generally center around the creation and release (accidental or intentional) of genetically engineered organisms that are a threat to human health or animals and plants in the environment. Many organisms that are "genetically engineered" carry genes for antibiotic resistance.

Phenotypically, what two general categories of offspring did Sturtevant and Morgan observe in the F2 generation of their fly crosses?

Red eyes and white eyes was wrong I think the answer is recombinant and non-recombinant.

Describe the positive control exerted by the catabolite activating protein (CAP). Include a description of catabolite repression.

Regarding regulation of the lac operon, in the absence of glucose, CAP (dependent on cAMP and adenyl cyclase) binds to the CAP site and facilitates transcription (positive control). Transcription of the operon is inhibited in the presence of glucose (catabolite repression).

rRNA genes

Regions of high conservation & regions of high variability

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by

Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest

What is the name of the replication unit in prokaryotes, and how does it differ in eukaryotes?

Replicon; one replicon in prokaryotes, multiple replicons in eukaryotes

The complex of proteins that is involved in the replication of DNA is called a ____ .

Replisome

What introns donnot require a cofactor?

Mitochondrial mRNA & tRNA Group II introns

In a human population, the genotype frequencies at one locus are 0.5 AA, 0.4 Aa, and 0.1 aa. The frequency of the A allele is:

0.70 (sqrt of 0.5)

If a typical somatic cell has 64 chromosomes, how many chromosomes are expected in each gamete of that organism?

Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), what is the frequency of the R1 allele?

0.9

Given an inheritance pattern of incomplete dominance and 81 flowers are red (R1R1), 18 flowers are pink (R1R2), and 1 flower is white (R2R2), what is the frequency of the R1 allele?

0.9 sqrt 81/100

Three major types of RNAs were discussed in some detail: mRNA, rRNA, and tRNA. For each of the conditions below predict the consequences in terms of the population of proteins being synthesized in a particular cell. What qualitative and quantitative changes, if any, are expected in the individual protein involved (if one is involved) and in the population of proteins produced in that cell? (a) An acridine dye-induced mutation in mRNA. The condition is heterozygous in the involved cell. (b) A deletion (homozygous) that removes approximately half of the rRNA genes.

(a) Population of proteins: Half of the protein products of that gene will be defective, and the other half will be normal. Individual protein: The protein should show multiple amino acid substitutions "downstream" from the point of the mutation. If a nonsense triplet is introduced, the protein would be shortened in the substituted region. (b) Population of proteins: There would be an overall reduction in protein synthesis. Individual protein: All of the proteins would be made in their normal form, but at reduced levels.

Comb shape in chickens represents one of the classic examples of gene interaction. Two gene pairs interact to influence the shape of the comb. The genes for rose comb (R) and pea comb (P) together produce walnut comb. The fully homozygous recessive condition (rrpp) produces the single comb. Assume that a rose-comb chicken is crossed with a walnut-comb chicken and the following offspring are produced: 17 walnut, 16 rose, 7 pea, 6 single. (a) What are the probable genotypes of the parents? (b) Give the genotypes of each of the offspring classes. Some classes may have more than one possible genotype. Separate and clearly label your answers for a-b in the box below.

(a) Rrpp × RrPp (b) R_Pp (walnut) R_pp (rose) rrPp (pea) rrpp (single)

(a) Describe the structural components of the lactose operon in E coli. (b) State the function of the lac regulator gene. (c) State the function of β-galactosidase in the lac system.

(a) operator-physical component of DNA where repressor binds, repressor-trans-acting protein that binds operator when lactose is absent, lacZ-Bgal structural gene, lacY-Bgal permease, lacA-Bgal transacetylase (b) The regulator gene produces a repressor protein, which interacts with the operator to shut off transcription. In the presence of lactose, the repressor protein does not interact with the operator. (c) β-galactosidase cleaves the lactose sugar into its components glucose and galactose.

Huntington's disease is a late-onset disease caused by a single, dominant mutation. The following pedigree is for a family width a history of Huntington disease. Those individuals who are already suffering form the disease are shaded black. However, some additional individuals in generations II and III also have the Huntington allele and will develop Huntington disease but have not yet shown symptoms. Assume that individuals marrying into the family have no history of the disease (homozygous recessive for the gene). Also assume that the diseased male in generation I is heterozygous for the disease. (i) What is the probability that the male IIIa carries a Dominant Huntington allele? (ii) What is the probability that the female IId carries the Dominant Huntington allele? (iii) If IIIa and IIg have a child, what is the probability that the child would receive the Dominant Huntington allele

(i) 1/4 (ii) 1/2 (iii) 1/8

Huntington's disease is a late-onset disease caused by a single, dominant mutation. The following pedigree is for a family with a history of Huntington disease. Those individuals who are already suffering from the disease are shaded black. However, some additional individuals in generations II and III also have the Huntington allele and will develop Huntington disease but have not yet shown symptoms. Assume that individuals marrying into the family have no history of the disease (homozygous recessive for the gene). Also assume that the diseased male in generation I is heterozygous for the disease. (i) What is the probability that the male IIIa carries a Dominant Huntington allele? (ii) What is the probability that the female IId carries the Dominant Huntington allele? (iii) If IIIa and IIg have a child, what is the probability that the child would receive the Dominant Huntington allele?

(i) 1/4 (ii) ½ (iii) 1/8

Assume that in a Hardy-Weinberg population, 9% of the individuals are of the homozygous recessive phenotype. What percentage of the individuals would be expected to be heterozygous? (Enter only a number in the box below.) What percentage of the individuals would be expected to be homozygous dominant? (Enter only a number in the box below.)

0.09 = aa = p2 sqrt = 0.3 = p q = 1-0.3 = 0.7; 2(0.3)(0.7) = 0.42 0.7^2 = q^2 = AA = 0.49

Assume that A + T/G + C equals 0.5 in one strand of DNA. What is the ratio of these bases in the complementary strand?

0.5

Define the term "fitness". What are three critical points to keep in mind when measuring fitness?

-Fitness refers to the ability of an individuals genotype or phenotype to survive and reproduce. -Must understand that it is measured: 1. relative to other genotypes/phenotypes in the population 2. in a specific environment 3. by reproductive success

A certain form of color blindness in humans is sex-linked. Assume that 8% of the males in a population are color blind. What percentage of the females in this population are expected to be color blind? (Enter only a number in the blank below.)

.51

Assuming independent assortment, what proportion of the offspring of the cross AaBbCcDd x AabbCCdd will have the aabbccdd genotype?

Two forms of hemophilia are determined by genes on the X chrom. Assume that a phenotypically normal woman whose father had hemophilia is married to a normal man. What's the prob that their first daughter will have hemophilia?

If a female Drosophila that is heterozygous for a recessive X-linked mutation is crossed to a wild-type male, what proportion of female progeny will have the mutant phenotype?

If a recessive disease is found in 50 out of 100,000 individuals, what is the frequency of the heterozygote carriers for this disease?

0.043 If q 2 = 0.0005, then q = 0.022 and p = 1 − q = 0.978. The heterozygote frequency is 2pq, or 2 (0.978) (0.022) = 0.043.

0.64%

What are three ways in which gene regulation is accomplished by modifying the structure of chromatin?

1 Modification of Histone proteins. 2. Chromatin remodeling 3. DNA methylation

In a tropical human population in Hardy-Weinberg equilibrium for an autosomal locus determining presence/absence of pigment in the skin, the frequency of albinism (aa) is 1 in 10,000. The frequency of heterozygotes is approximately:

1 in 50

A typical prokaryotic genome has

1 million base pairs of DNA, containing 1000 genes.

Gel Electrophoresis Steps

1) Make the gel 2) Set up gel apparatus 3) Load DNA sample into gel 4) Hook up electric current and run gel 5) Stain gel and analyze results

The following table shows several bacterial strain lac operon genotypes (some are partial diploids). Fill in the blanks in the "lactose absent" and "lactose present" columns in this table. (+) means significant levels of active ß-galactosidase enzyme can be detected. (-) means no significant levels of active ß-galactosidase enzyme. Label your answers: Lactose absent #1-6 and Lactose present #1-6 Strain Geno Type Lac Abs Lac pres 1. lacI+ lacP+ lacO+ lacZ+ lacY+ 2. lacI+ lacP+ lacOc lacZ+ lacY+ 3. lacI+ lacP+ lacOc lacZ- lacY+ 4. lacIs lacP+ lacOc lacZ+ lacY+ 5. lacI- lacP+ lacO+ lacZ+ lacY+ / lacI+ 6. lacIs lacP+ lacO+ lacZ+ lacY+/ lac I+

1. - + 2. + + 3. - - 4. + + 5. - + 6. - -

The following table shows several bacterial strain lac operon genotypes (some are partial diploids). Fill in the blanks in the "lactose absent" and "lactose present" columns in this table. (+) means significant levels of active ß-galactosidase enzyme can be detected. (-) means no significant levels of active ß-galactosidase enzyme. Label your answers: Lactose absent #1-6 and Lactose present #1-6 1. lacI+ lacP+ lacO+ lacZ+ lacY+ 2. lacI+ lacP+ lacOc lacZ+ lacY+ 3. lacI+ lacP+ lacOc lacZ- lacY+ 4. lacIs lacP+ lacOc lacZ+ lacY+ 5. lacI- lacP+ lacO+ lacZ+ lacY+ / lacI+ 6. lacIs lacP+ lacO+ lacZ+ lacY+/ lac I+

1. - , + 2. + , + 3. - , - 4. + , + 5. - , + 6. - , -

Describe a difference between the RNA polymerases of eukaryotes and prokaryotes.

1. Bacterial cells contain a single RNA polymerase, whereas eukaryotic cells have three. 2. Bacterial RNA polymerase can initiate transcription without the help of additional proteins, whereas eukaryotic RNA polymerases need general transcription factors. 3. In eukaryotic cells, transcription regulators can influence transcriptional initiation thousands of nucleotides away from the promoter, whereas bacterial regulatory sequences are very close to the promoter. 4. Eukaryotic transcription is affected by chromatin structure and nucleosomes, whereas bacteria lack nucleosomes.

Describe some important differences between bacterial and eukaryotic cells that affect the way in which genes are regulated.

1. Bacterial genes are often clustered in operons and are coordinately expressed through the synthesis of a single polygenic mRNA. Eukaryotic genes are typically separate, with each containing its own promoter and transcribed on individual mRNAs. Coordinate expression of multiple genes is accomplished through the presence of response elements. Genes sharing the same response element will be regulated by the same regulatory factors. 2. In eukaryotic cells, chromatin structure plays a role in gene regulation. Chromatin that is condensed inhibits transcription. So, for expression to occur, the chromatin must be altered to allow for changes in structure. Acetylation of histone proteins and DNA methylation are important in these changes. 3. At the level of transcription initiation, the process is more complex in eukaryotic cells. In eukaryotes, initiation requires a complex machine involving RNA polymerase, general transcription factors, and transcriptional activators. Bacterial RNA polymerase is either blocked or stimulated by the actions of regulatory proteins. 4. Finally, in eukaryotes the action of activator proteins binding to enhancers may take place at a great distance from the promoter and structural gene. These distant enhancers occur much less frequently in bacterial cells.

Over the past decade, the most significant finding in biology has been the identification of miRNAs and siRNAs and their role in regulating the development of many multicellular organisms. Briefly describe the four different ways these small RNAs influence gene expression.

1. Cleavage of mRNA 2. Inhibition of translation 3. Transcriptional silencing 4. Degradation of mRNA

One of the dominant features of the immune system is the capacity to generate new cells that contain different combination of antibodies. Because there are billions of combinations it is impossible for each combination to be encoded by a single gene. Explain in sufficient detail how such diversity is accomplished in the case of the light chain of a typical antibody.

1. It is achieved by the process of somatic recombination: 2. One of 70-100 L-V segments joined to one of 6 J regions. 3. Recombination to J region is imprecise over a 6 bp region. 4. Break and nibble mechanism adds or removes bases during this recombination process. 5. Introns spliced out 6. Translation produces light-chain polypeptide 7. Leader polypeptide removed, producing mature light chain. Grading: full points for explanation that has most of the steps in the key below, partial credit based on completeness of answer.

An operon is controlled by a repressor. When the repressor binds to a small molecule, it is released from binding to DNA near the operon. The operon is never expressed if a mutation prevents the repressor from binding to the small molecule. 1. Negative inducible 2. Negative repressible 3. Positive inducible 4. Positive repressible

1. Negative inducible

Describe two methods used to study inheritance of human genetic characteristics.

1. Pedigree analysis 2. Twin studies 3. Adoption studies

Name and describe three different kinds of bacterial cloning vectors.

1. Plasmid cloning vector: It generally can load fragments of interest about 5-10kb long and it is derived from bacterial plasmids. It has polylinker regions, selection system, insert discrimination system and an origin of replication. 2. Phage cloning vector: it can handle insert about 10-15kb; it is derived from bacterial virus (phage). To insert DNA fragments, the central third portion of the phage DNA, resulting in a left arm and a right arm and a centrol region. The fragments of interest then are inserted between the two arms, then ligated by DNA ligase. 3. Cosmid cloning vector: it can carry up to 50kb inserts; it is made of part phage and part plasmid, which makes it to an engineered vector 4. Bacterial Artificial chromosomes cloning vector

Answer the following questions about standard PCR: 1. What enzyme is required for PCR? State the specific name of the enzyme, not just the type of enzyme. 2. Apart from the enzyme, what 3 DNA molecules are required (give the technical names by which they are called)? What must be true about the sequences of these molecules? Note that dNTPs are individual nucleotides, not DNA molecules. 3. Name the three basic steps of PCR and describe the molecular processes that occur in each. How is each step induced? 4. How does this system work to amplify DNA?

1. Taq polymerase 2. 2 primers, 1 template, dNTPs. The primer sequence must be complementary to the ends of the sequence to be amplified 3. Denaturation: Temperature is raised to ~94 C. Strands of DNA separate Annealing: The temperature is lowered to 50-65 C. Primer strands anneal to the template strand. Extension (or elongation): The temperature is raised to ~72 C. Taq polymerase synthesizes a complementary DNA strand form dNTPs. 4. The amount of DNA is doubled in each reaction, so that after (for example) 30 cycles, it has increased by a factor of 2^30.

Integration into the genome may cause cancer

1. The provirus integrates near a proto-oncogene 2. A retrovirus may pick up a host proto-oncogene which is further mutated and expressed at high levels under control of viral promoters 3. Expression of a viral gene may act to stimulate cell cycle --> inappropriate cell growth

What role does RNA stability play in gene regulation? List three types of RNA structural elements that can affect the stability of an RNA molecule in eukaryotic cells. Explain how these elements act to influence RNA stability.

1. The total amount of protein synthesized is dependent on how much mRNA is available for translation. The amount of mRNA present is dependent on the rates of mRNA synthesis and degradation. Less-stable mRNAs will be degraded and become unavailable as templates for translation. 2. The presence of the 5' cap, 3' poly(A) tail, the 5' UTR, 3' UTR, and the coding region in the mRNA molecule affects stability. Poly(A) binding proteins (PABP) bind at the 3' poly(A) tail. These proteins contribute to the stability of the tail, and protect the 5' cap through direct interaction. Once a critical number of adenine nucleotides have been removed from the tail, the protection is lost and the 5' cap is removed. The removal of the 5' cap allows for 5' to 3' nucleases to degrade the mRNA.

hardy weinberg assumptions

1. all genotypes have equal rates of survival and equal reproductive success (NO SELECTION) 2. no new alleles created or converted (NO MUTATION) 3. no migration into or out of pop 4. pop is infinitely large, in practice pop is large enough to remove sampling errors 5. individuals mate randomly

1. assembling a DNA sequence from an amino acid sequence. 2. assembling an RNA sequence from a DNA sequence. 3. translating in the 3' to 5' direction. 4. transcribing first, then translating. 5. making an amino acid sequence from a DNA sequence

1. assembling a DNA sequence from an amino acid sequence.

At what stage of the meiotic cell cycle and during what chromosomal configuration does crossing over occur? Mark all that apply. 1. at the four strand stage of meiosis 2. after synapsis of homologous chromosomes 3. before the end of prophase I 4. during anaphase I 5. during prophase II

1. at the four strand stage of meiosis 2. after synapsis of homologous chromosomes 3. before the end of prophase I

At what stage of the meiotic cell cycle and during what chromosomal configuration does crossing over occur? after synapsis of homologous chromosomes before the end of prophase I during prophase II at the four strand stage of meiosis during anaphase I

1. before the end of prophase I 2. at the four strand stage of meiosis 3. after synapsis of homologous chromosomes

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication 1. DNA ligase 2. theta replication 3. DNA gyrase 4. Okazaki fragments 5. continuous synthesis 6. rolling-circle replication

1. i 2. k 3, a 4. d 5. h 6. f

Fill in the blanks in the "strain genotype" column of the following table. Write chromosomal genotypes with no partial diploidy. (+) means transcription of the lac operon. (-) means no transcription of the operon. The first line is filled in for reference. Please label your answers 1-3. Include the strain genotype for lacI, lacP, lacO, lacZ, and lacY Strain genotype Lactose absent Lactose present 1 - + 2 + + 3 - -

1. lacI+ lacP+ lacO+ lacZ+ lacY+ 2. lacI+ lacP+ lacOc lacZ+ lacY+ OR lacI- lacP+ lacO+ lacZ+ lacY+ 3. lacI+ lacP- lacO+ lacZ+ lacY+ OR lacIs lacP- lacO+ lacZ+ lacY+ OR lacIs lacP+ lacO+ lacZ+ lacY+

Restriction endonuclease are especially useful if they generate "sticky" ends. What makes an end sticky? 1. single-stranded complementary tails 2. blunt ends 3. poly-A sequences 4. 5' cap 5. interference

1. single-stranded complementary tails

Huntington's disease is inherited in humans as an autosomal dominant gene. Affected individuals show progressive brain deterioration from cell death in the cerebral cortex. Onset of the disease usually occurs between ages 30 and 50. Give two possible reasons for the observed variation in the age of onset of this disease.

1. variable physiological states; 2. environmental conditions

In a survey of 240,000 human births, six achondroplastic births were recorded to parents who were unaffected. Given that this form of dwarfism is caused by a fully penetrant, dominant, autosomal gene, what is the mutation rate?

1.25x10^-5

Explain two different ways that intragenic suppressors may reverse the effects of mutations.

1.Intragenic suppression is the result of second mutations within a gene that restore a wild-type phenotype. The suppressor mutations are located at different sites within the gene from the original mutation. One type of suppressor mutation restores the original phenotype by reverting the meaning of a previously mutated codon to that of the original codon. The suppressor mutation occurs at a different position than the first mutation, which is still present within the codon. Intragenic suppression may also occur at two different locations within the same protein. If two regions of a protein interact, a mutation in one of these regions could disrupt that interaction. The suppressor mutation in the other region would restore the interaction. Finally, a frameshift mutation due to an insertion or deletion could be suppressed by a second insertion or deletion that restores the proper reading frame.

Suppose that a given gene undergoes a mutation to its dominant allele such that two out of 100,000 offspring exhibit the new mutant phenotype. Assuming that these offspring are heterozygous, what is the mutation rate for the gene?

1/100,000

Two organisms, AABBCCDDEE and aabbccddee are mated to produce an F1 that is self fertilized. If the capital letters represent dominant, independently assorting alleles, what proportion of the F2 genotypes will be recessive for all five loci?

1/1024

Ability to roll the tongue is caused by a dominant allele. A woman is a "roller," but one of her parents is not. The woman is expecting a child with a man who is a "nonroller." What is the probability that their child will be a "roller"?

1/2

One form of hemophilia is caused by a sex-linked recessive gene. Assume that a man with hemophilia marries a phenotypically normal woman whose father had hemophilia. Given that their first child is a son, what is the probability that their first son will have hemophilia?

1/2

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be genotypically AABBCCdd ?

1/256

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be phenotypically recessive?

1/256

A cross is made between a female calico cat and a male cat having the gene for black fur on his X chromosome. What fraction of the offspring would one expect to be calico?

1/4

Albinism, lack of pigmentation in humans, results from an autosomal recessive gene (a). Two parents with normal pigmentation have an albino child. What is the probability that their next child will be albino?

1/4

In the following cross, what proportion of individuals will have the Bombay phenotype? AB Hh x AB Hh

1/4

One form of hemophilia is caused by a sex-linked recessive gene. Assume that a man with hemophilia marries a phenotypically normal woman whose father had hemophilia. What is the probability that they will have a daughter with hemophilia? (Note: In this problem you must include the probability of having a daughter in your computation of the final probability.)

1/4

If the proportion of F2 individuals resembling either of the two most extreme phenotypes (the parental phenotypes) can be determined, what formula can be applied to determine the number of gene pairs involved?

1/4^n

1/8

Most of the bacterial genomes described in the text have fewer than

10,000 genes

If they live long enough, the penetrance of individuals carrying the Huntington's Disease allele will be what?

100%

In snapdragons, heterozygotes for one of the genes have pink flowers, whereas homozygotes have red or white flowers. When plants with red flowers are crossed with plants with white flowers, what proportion of the offspring will have pink flowers?

100%

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?

12%

Meselson and Stahl determined that DNA replication in E coli is semiconservative. What additive did they initially supply to the medium in order to distinguish "new" from "old" DNA?

15N

If a typical somatic cell has 32 chromosomes, how many chromosomes are expected in each gamete of that organism?

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. What is the total number of telomeres in a rat cell in G2?

168

Which of the following are among the major components of prokaryotic ribosomes? 12S rRNA, 5.8S rRNA, and proteins 16S rRNA, 5.8S rRNA, and 28S rRNA 18S rRNA, 5.8S rRNA, and proteins lipids and carbohydrates 16S rRNA, 5S rRNA, and 23S rRNA

16S rRNA, 5S rRNA, and 23srRNA

If A + G/T + C equals 0.5 in one strand, what is the ratio of these bases in the complementary strand?

1:1

What types of phenotypic ratios are likely to occur in crosses when dealing with a single gene pair where all genotypic combinations are of equal viability?

1:2:1, 3:1

The 9:3:3:1 ratio is typical of a dihybrid cross in which complete dominance and independent assortment occur. What is the dihybrid ratio with independent assortment of polygenes?

1:4:6:4:1

1|2

How many gene pairs are involved in generating a typical 1:4:6:4:1 ratio?

A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yield a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites? 1. A 12-kb fragment 2. An 8-kb fragment 3. An 8-kb and a 2-kb fragment 4. A 10-kb and a 2-kb fragment 5. A 10-kb, an 8-kb, and a 2-kb fragment

2. An 8-kb fragment

The first commercial production of what human enzyme led to the explosion of the biotechnology industry? 1. Polynucleotide Phosphorylase 2. Insulin 3. Amylase 4. Lactose Dehydrogenase

2. Insulin

Which of the below are not steps in the production of genome sequence maps: 1. Read the sequence of individual piece of the genome 2. Isolate whole chromosomes 3. When sequences are obtained, assemble and organize the sequences in order 4. Identify molecular markers on specific chromosomes 5. All of these are steps you would use

2. Isolate whole chromosomes

Which of the following statements is not true concerning RNA and DNA? 1. The sugar portion of RNA and DNA are different 2. RNA is more stable than DNA 3. DNA is transcribed into RNA which is translated into protein 4. DNA is permanent in a cell, RNA is temporary

2. RNA is more stable than DNA

Two eukaryotic proteins were found to be very similar except for one domain that was different. Which of the following processes is most likely to have contributed to this phenomenon? 1. multiple random mutations within specific axons of the gene. 2. differences in pre-mRNA splicing that results in an altered pattern of exon inclusion. 3. differential acetylation of specific histone proteins prior to transcription. 4. use of different transcriptional activators. 5. All of the above.

2. differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.

Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes? 1. double-stranded, parallel (A+T)|C+G)=variable, (A+G)|(C+T)=1.0 2. double-stranded, antiparallel, (A+T)|C+G)=variable, (A+G)|(C+T)=1.0 3. single-stranded, antiparallel, (A+T)|C+G)=1.0, (A+G)|(C+T)=1.0 4. double-stranded, parallel (A+T)|C+G)=1.0, (A+G)|(C+T)=1.0 5. double-stranded, antiparallel (A+T)|C+G)=variable, (A+G)|(C+T)=variable

2. double-stranded, antiparallel, (A+T)|C+G)=variable, (A+G)|(C+T)=1.0

An organism has an A+T content of 60%. What is the percentage for C?

20%

If a typical somatic cell has 44 chromosomes, how many chromosomes are expected in each gamete of that organism?

The house fly, domestica, has a haploid chromosome number of 6. How many chromatids should be present in a diploid, somatic, metaphase cell?

The house fly, Musca domestica, has a haploid chromosome number of 6. How many chromatids should be present in a diploid, somatic, metaphase cell?

24 chromatids

Two organisms, AABBCCDDEE and aabbccddee, are mated to produce an F1 that is self fertilized. If the capital letters represent dominant independently assorting alleles, how many genotypes will occur in the F2?

243

Myrmecia pilosula actually consists of several virtually identical, closely related species of ants, with females having chromosome numbers of 18, 20, 32, 48, 60, 62, and 64. The males are haploid, and each gamete contains the n complement. Assume one crossed a female of species (A) with 32 chromosomes and a male species (B) with 9 chromosomes. How many chromosomes would one expect in the body (somatic) cells of the female offspring?

If a crossover event happened in one half of all tetrads, how many recombinant gametes could be produced?

25%

At what approximate wavelengths do DNA, RNA, and proteins maximally absorb light? DNA: ____ nm RNA: ____ nm Protein: ____ nm

260 260 280

A trihybrid cross is a cross between two individuals who are heterozygous for three genes. For example: AaBbCc x AaBbCc. Assuming these three genes are unlinked and assorting independently, what segregation ratio would be observed?

27:9:9:9:3:3:3:1

How many haploid sets of chromosomes are present in a diploid individual cell with a chromosome number of: 46? _____ 32? _____

2; 2

What formula can be used to determine the number of categories (phenotypes) possible in the F2 results of a polygenic system?

2n+1

The heterozygote genotype frequency term for a gene with two alternate alleles A (frequency of p) and a (frequency of q) in the Hardy-Weinberg equation is:

2pq

When codons that code for the same amino acid differ in their ____, a single tRNA might bind both of them through wobble base pairing 5' base Middle base 3' base

3' base

ε subunit

3'-->5'exonuclease

What are the two major components of the Tobacco Mosaic Virus? 1. RNA and DNA 2. DNA and protein 3. RNA and protein 4. lipids and nucleic acids carbohydrates and nucleic acids

3. RNA and protein

Transcription of the sequence AATGCGGTC would result in: 1. TTACGCCAG 2 Three amino acids 3. UUACGCCAG 4. Not enough information to tell

3. UUACGCCAG

Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? 1. palindrome 2. consensus sequence 3. multiple cloning site 4. beta-galactosidase 5. complementation

3. multiple cloning site

The DNA replication enzyme that most closely resembles RNA polymerase is 1. DNA polymerase I. 2. DNA polymerase II. 3. primase. 4. telomerase. 5. helicase.

3. primase

One form of post-translational modification of a protein includes 1. removal of introns. 2. shuffling of exons. 3. removal or modification of terminal amino acids. 4. removal of axons. 5. self-splicing.

3. removal or modification of terminal amino acids.

The packaging of DNA into a confined space is what level of DNA structure? 1. primary 2. secondary 3. tertiary 4. quaternary

3. tertiary

By their experimentation using the Neurospora fungus, Beadle and Tatum were able to propose the far-reaching hypothesis that: 1. phototrophs will grow only if provided with nutritional supplements. 2. several different enzymes may be involved in the same step in a biochemical pathway. 3. the role of specific gene to produce a specific enzyme. 4. genetic recombination occurred in Neurospora. 5. more than one codon can specify a given amino acid.

3. the role of specific gene to produce a specific enzyme.

Flower diameter in sunflowers is a quantitative trait. A plant with 6-cm flowers, from a highly inbred strain, is crossed to a plant with 30-cm flowers, also from a highly inbred strain. The F1 have 18-cm flowers. F1 × F1 crosses yield F2 plants with flowers ranging from 6 to 30 cm in diameter, in approximately 4-cm intervals (6, 10, 14, 18, 22, 26, 30). An 18-cm F1 plant is crossed to a 6-cm plant. What is the probability of an offspring with one additive allele, if all genes that influence this trait are unlinked?

3/8

Assume that a trait is caused by the homozygous (or hemizygous) state of a gene that is recessive and X-linked. Nine percent of the females in a given population express the phenotype caused by this gene. What percentage of males would be expected to express this trait? (Enter only a number in the box below.) 1. What percentage of the females would be heterozygous for the gene? (Enter only a number in the box below.) 2.

30 42

An organism has a T content of 20%. What is the percentage of C?

30%

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?

30%

375, 375, 125, 125

Assuming a typical monohybrid cross in which one allele is completely dominant to the other, what phenotypic ratio is expected if the F1's are crossed?

3:1

How many haploid sets of chromosomes are present in an individual that is tetraploid (4n)?

There is about as much nuclear DNA in a primary spermatocyte as in ________ (how many) spermatids?

Use the following table for the questions below: Supplements: 1 2 3 4 Strain A + - + - Strain B + + + - Strain C + + + + Strain D - - + - Determine a possible metabolic pathway that would give the results seen for the four mutant strains, A through D. (If necessary, use a separate piece of paper to diagram the pathway). Then, fill-in the blanks below with Strain A-D or Supplement 1-4, using this generic metabolic pathway as a guide: (X) --> + --> 1a --> + --> 1b --> + --> 1c --> + --> 1d (supplements) | | | | 1e 1f 1g 1h (mutant strains) Which supplement (1-4) is needed at position 1a? Which supplement (1-4) is needed at position 1b? Which supplement (1-4) is needed at position 1c? Which supplement (1-4) is needed at position 1d? Which strain's (A-D) gene product would function at position 1e if it were not mutant? Which strain's (A-D) gene product would function at position 1f if it were not mutant? Which strain's (A-D) gene product would function at position 1g if it were not mutant? Which strain's (A-D) gene product would function at position 1h if it were not mutant?

4 2 1 3 C B A D

The haploid human genome contains about 3 × 109nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter cleave?

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _____. 1. chromosome 2. sequence 3. map 4. contig 5. clone

4. Contig

A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? 1. Information about bacterial orthologs of the gene 2. An EST database of the human genome 3. Microarray data of tissues in which the gene is expressed 4. Data about the inheritance of SNP markers in families with the disease 5. Whole-genome-shotgun clones of the human genome

4. Data about the inheritance of SNP markers in families with the disease

A class of mutations that results in multiple contiguous amino acid changes in proteins is likely to be the following. 1. Base analog 2. Transversion 3. Transition 4. Frameshift 5. Recombinant

4. Frameshift

_____ mutations produce new traits and are usually dominant. 1. Induced 2. Spontaneous 3. Forward 4. Gain of function 5. Lethal

4. Gain of function

Considering the electromagnetic spectrum, identify likely mutagens from the following list. 1. Radio waves 2. Microwaves 3. Infrared 4. Ultraviolet 5. X-rays 6. Gamma rays 7. Cosmic rays

4. Ultraviolet 5. X-rays 6. Gamma rays 7. Cosmic rays

The following may be caused by mobile genetic elements except ______. 1. Activate a gene in which they reside 2. Cause chromosome breaks 3. Disrupt a gene 4. Undergo mutation 5. All of the above

4. Undergo mutation

The chemical difference between DNA and RNA make RNA _____ stable than DNA and allow it to exist _____ in the life of most cells. 1. more, permanently 2. more, temporarily 3. less, permanently 4. less, temporarily

4. less, temporarily

In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinate control that are transcribed as a single unit. Such contiguous gene families are called 1. transcriptomes 2. proteomes 3. contigs 4. operons 5. pseudogenes

4. operons

Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? 1. DNAse 2. gene cloning 3. hydrogen sulfide 4. reverse transcriptase 5. isolation of stem cells from a lamb embryo and production of a zygotic equivalent

4. reverse transcriptase

The difference between a genetic screening experiment and a selection experiment is that screening experiment involves _____, whereas a selection experiment creates conditions that _____ irrelevant organism. 1. complementation analysis, enhance 2. temperature extremes, enhance 3. epistasis analysis, enhance 4. visual examination, eliminate 5. chemical removal, activate

4. visual examination, eliminate

You may have heard through various media of an animal alleged to be the hybrid of a rabbit and a cat. Given that the cat (Felis domesticus) has a diploid chromosome number of 38 and a rabbit (Oryctolagus cuniculus) has a diploid chromosome number of 44, what would be the expected chromosome number in the somatic tissues of this alleged hybrid? Why?

A diploid somatic cell from a rat has a total of 42 chromosomes (2n=42). As in humans, sex chromosomes determine sex: XX in females and XY in males. What is the total number of chromosomes present in the cell during metaphase I of meiosis?

Klinefelter syndrome in humans, which leads to underdeveloped testes and sterility, is caused by which chromosomal condition?

47, XXY

If the following DNA strand was used as a template, what would the sequence of an RNA be? 5' GTACCGTC 3' 5' GACGGUAC 3' 5' GUACCGUC 3' 5' GACGGTAC 3' 5' CAUGGCAG 3' 5' GUCGGUAC 3'

5' GACGGUAC 3'

Select 3 posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes A. 5' capping, 3' PolyA tail addition, splicing B. 3' capping, 5' PolyA tail addition, splicing C. removal of exons, insertion of introns, capping D. 5' polyA tail addition, insertion of introns, capping E. heteroduplex formation, base modification, capping

5' capping, 3' polyA tail addition, splicing

What is meant by the term antiparallel?

5' to 3' directionality of two strands running in opposite directions

Conditional mutations are more likely to result from which of the following alterations to the coding region of a gene. 1. A mutation caused by a based addition or deletion 2. A mutation caused by a base addition 3. A mutation caused by X rays 4. A mutation caused by a deletion 5. A mutation caused by a tautomeric shift

5. A mutation caused by a tautomeric shift

All of the following are characteristics of the genomics revolution EXCEPT _____. 1. Large scale acquisition of DNA sequences 2. Ability to conduct discovery-based research 3. Enabled reverse genetics approach to genetics research 4. Facilitated collaborative research networks 5. Inability to understand single genes

5. Inability to understand single genes

Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? 1. UAA, UGA, UAG are initiator codons, not termination codons. 2. Exons are spliced out of mRNA before translation. 3. These triplets cause frameshift mutations, but not termination. 4. More than one termination codon is needed to stop translation. 5. Introns are removed from mRNA before translation.

5. Introns are removed from mRNA before translation.

The ribonucleic acid components known to exist in eukaryotic ribosomes are the following: (check all that apply) 18S 28S 5.8S 5S 16S

5.8S, 18S, 28S, 5S.

A recessive gene for red-green color blindness is located on the X chromosome in humans. Assume that a woman with normal vision (her father is color-blind) marries a color-blind male. What is the likelihood (give a percentage) that this couple's first son will be color-blind?

50%

Two forms of hemophilia are determined by genes on the X chromosome in humans. Assume that a phenotypic normal woman whose father had hemophilia is married to a normal man. If there first child is a son, what is the probability that their first son will have the hemophilia?

50%

When crossing an organism that is homozygous recessive for a single trait with a heterozygote, what is the chance of producing an offspring with the homozygous recessive phenotype?

50%

Human albinism is an autosomal recessive trait. Suppose that you find a village in the Andes where 1/4 of the population is albino. If the population size is 1000 and the population is in Hardy-Weinberg equilibrium with respect to this trait, how many individuals are expected to be heterozygotes?

500 250/1000 = 0.25 sqrt = 0.5 freq a 1-0.5 = 0.5 = freq A 2(0.5)(0.5) = 0.5 = freq Aa 0.5 * 1000 = 500 individuals

500, 1500, 2000

What appears to be the range of number of protein-coding genes per genome in eukaryotes?

5000-45000

A260 = 1 =

50μg/ml

The horse (Equus caballus) has 32 pairs of chromosomes, whereas the donkey (equus asinus) has 31 pairs of chromosomes. How many chromosomes would be expected in the somatic tissue of a mule?

63 '

An organism has a haploid number of 6. How many possible assortments of chromosomes are possible based on the independent assortment of the chromosomes?

An organism has a haploid number of 6. How many possible assortments of chromosomes are possible based on the independent assortement of the chromosomes?

64 (2^6)

A recessive allele in tigers causes the white tiger. If two normally pigmented tigers are mated and produce a white offspring, what percentage of their remaining offspring would be expected to have normal pigmentation?

75%

You are producing a heteropolymer of synthetic mRNA using a 1C:5G ratio. In this synthetic mRNA what is the proportion of codons with 2Gs and 1C?

75/216

How many different F2 genotypes would you expect in a cross with four heterozygous gene pairs?

81 (3^4)

Typical ratios resulting from epistatic interactions in dihybrid crosses would be ________.

9:3:4, 9:7

What types of ratios are likely to occur in F2 crosses when is dealing with two interacting , epistatic gene pairs?

9:7; 9:3:4; 12:3:1; 15:1

Which of the following is NOT an explanation as to why dominant disease-causing genes exist in populations?

>The genes are masked and therefore are passed only through carriers. The genes exert their effects late in life, beyond reproductive age. Despite the genes' effects, individuals stay healthy enough to reproduce. The genes may be the result of new mutations.

Describe the general structure of a transcription factor. What two domains do transcription factors tend to have?

A DNA binding domain (binds to enhancers and promoters), and an activation domain (activates transcription). They bind through hydrogen bonds etc. versus base pairs

One speaks of UAS (upstream activating sequences) as being DNase hypersensitive. We would interpret this to mean that: A UAS is constitutively open More than one strand of DNA exists in each UAS Each UAS is likely to be single-stranded Each UAS has more histone binding sites than non-UAS sites Any given UAS composed of a double-stranded site with a bound repressor

A UAS is constitutively open

Red-green color blindness is X-linked recessive. A woman with normal color vision has a father who is color blind. The woman has a child with a man with normal color vision. Which phenotype is NOT expected? A color-blind female A color-blind male A noncolor-blind female A noncolor-blind male

A color-blind female

Give a brief definition of the term genetic equilibrium.

A condition for a population in which the frequency of a given gene remains constant from generation to generation

Complementation analysis can be used to determine whether two mutations are in the same gene. Explain how to test for complementation and how one would interpret the results.

A cross is made between the two homozygous strains. If the F1 progeny are wild type, complementation has occurred and the two mutations must lie in two separate genes.

Which one of the following statements regarding eukaryotic transcriptions is not true? a. Eukaryotic transcription involves a core promoter and a regulatory promoter. b. There is no one generic promoter. c. A group of genes is transcribed into a polycistronic RNA. d. Chromatin remodeling is necessary before certain genes are transcribed.

A group of genes is transcribed into a polycistronic RNA.

In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. What is a map unit, and why is it so different in these two different types of organisms?

A map unit is the amount of measured recombination between two linked points in a genome. Because one map unit in humans is many more base pairs than in yeast, the amount of homologous recombination per DNA length must be lower in humans than in Saccharomyces cerevisiae.

What is a gene? A sequence of DNA that encodes a protein A sequence of RNA that regulates expression A sequence of amino acids that catalyze a reaction A sequence of DNA that tells polymerase where to begin transcription

A sequence of DNA that encodes a protein

Describe the three basic components of a typical plasmid cloning vector and the reason/use for those plasmid vector components.

A typical plasmid vector will have the following components: -Polylinker: First, there will be a multiple cloning site OR polylinker that is "cut" with specific restriction enzymes. The same restriction enzyme can then be used to "cut" templated DNA. When the cut vector and template are mixed together the complementary single stranded regions will anneal to one another and this complementarity is covalently linked using DNA ligase. Once in the vector, the vector is transferred into a bacterial host, where is multiplied. -Antibiotic resistance marker: The vector also contains antibiotic resistance genes so that when growing in the presence of antibiotic, only those bacteria with the vector will be able to grow. -Selectable marker: Lastly, the vector will contain a selectable marker, eg. the lacZ gene. The polylinker is located within this gene, when a template is ligated within the lacZ gene it is made nonfunctional. In the presence of a colorimetric indicator, such as X-gal, which is broken down into a blue byproduct by lacZ, the presence of a template fragment in the plasmid vector is visualized by white bacterial colonies. These colonies can then be chosen for further analysis.

In the context of recombinant DNA technology, what is meant by the term vector?

A vector is a vehicle to carry recombinant DNA molecules into the host cells where independent replication can occur.

In the fruit fly, Drosophila melanogaster, a spineless (no wing bristles) female fly is mated to a male that is claret (dark eyes) and hairless (no thoracic bristles). Phenotypically wild-type F1 female progeny were mated to fully homozygous (mutant) males, and the following progeny (1000 total) were observed: Phenotypes Number Observed spineless 321 wild 38 claret, spineless 130 claret 18 claret, hairless 309 hairless, claret, spineless 32 hairless 140 hairless, spineless 12 (a) Which gene is in the middle? (b) With respect to the three genes mentioned in the problem, what are the genotypes of the homozygous parents used in making the phenotypically wild F1 heterozygote? (c) What are the map distances between the three genes? D) what is the coefficient of coincidence?

A) the hairless gene B) cl h + and ++ sp C) the distance between sp and h is mu. The distance between h and cl is 30 mu. D) the coefficient of coincidence is 1

Which of the following parental genotypes will produce only heterozygous F1 offspring?

AA x aa

The _________ can be used to quickly screen chemicals for their ability to be mutagenic (and hence potentially carcinogenic).

AMES test

3' TACCGTGCGTGACATTAAGCC 5' What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template?

ATGGCACGCACTGTAATTCGG

The triplet _____ is commonly used as a start codon during translation.

AUG

3' TACCGTGCGTGACATTAAGCC 5' What would be the sequence of an RNA produced by using the DNA sequence shown as a template?

AUGGCACGCACUGUAAUUCGG

3' TACCGTGCGTGACATTAAGCC 5' What would be the sequence of an RNA produced by using the DNA sequence shown as a template? (type answer from 5' to 3' but do not include the characters)

AUGGCACGCACUGUAAUUCGG

Which of the following are examples of monohybrid crosses? 1. Aa x aa 2. Aa x Aa 3. AaBb x aabb 4. AaBb x AaBb 5. AaBB x AaBB

Aa x aa Aa x Aa

Wobble Hypothesis

Ability of the tRNAs to recognize more than one codon; the codons differ in their third nucleotide.

Approximately how much of the mammalian genome is composed of repetitive DNA?

About 5% to 10% of a mammalian genome is highly repetitive; about 30% is moderately repetitive.

You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment?

Accept anywhere from 28 to 30 cycles as a correct answer or the following equation 3 x (2^n) => than 1 billion)

What modification neutralizes the charges of histones that promote ionic interaction with DNA?

Acetylation

What modification neutralizes the charges on histones that promote ionic interaction with DNA?

Acetylation

After translation, eukaryotic proteins can be modified by

Acetylation, the addition of phosphate groups, the removal of amino acids, the addition of methyl groups.

The human metallothionein IIA gene (hMTIIA) is transcriptionally regulated through the interplay of regulatory elements and transcription factors. What is the function of this gene, and how is it regulated by environmental circumstances?

Acts as an enhancer element and codes for a metal protein

Three human disorders- fragile X syndrome, myotonic dystrophy, and Huntington disease - are conceptually linked by a common mode of molecular upset. Describe the phenomena that links these disorders.

All 3 are caused by disparate genes, but each gene was found to contain repeats of a unique trinucleotide sequence. Additionally, the number of repeats may increase in each subsequent generation (genetic anticipation).

Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common?

All are derived from a single ancestor

Three human disorders-fragile X syndrome, myotonic dystrophy, and Huntington disease-are conceptually linked by a common mode of molecular upset. Describe the phenomena that link these disorders.

All three are caused by disparate genes, but each gene was found to contain repeats of a unique trinucleotide sequence. In addition, the number of repeats may increase in each subsequent generation (genetic anticipation).

What is the function of the TATA binding protein?

Allows eukaryotic RNA polymerase II to bind to the promoter of genes

Interpret the meaning of an H2 value (broad-sense heritability) that approaches 1.0.

Almost all the phenotypic variation is determined by heredity/genetics.

________ RNA processing generates different mRNAs, which can direct the synthesis of different polypeptides.

Alternative

Describe alternative gene splicing. What is the result of the alternative splicing mechanism?

Alternative splicing is differential splicing of alternative exons from an initial pre-mRNA transcript. The result is that the possible proteins that a cell can produce (its proteome) is far larger than the number of genes in the genome.

A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites?

An 8-kb fragment

reverse transcriptase

An enzyme encoded by some certain viruses (retroviruses) that uses RNA as a template for DNA synthesis.

endonuclease

An enzyme that cleaves its nucleic acid substrate at internal sites in the nucleotide sequence.

Kornberg used the phage PhiX174 to demonstrate DNA pol 1 was able to produce biologically active DNA in vitro. Describe in sufficient detail the experimental methods that he used to draw the conclusions in DNA pol 1 could produce biologically active DNA. For full credit include details about any reagents, chemicals, or labels that Kornberg utilized in order to draw his conclusions.

An initial (+) strand of PhiX174 was labeled w 3H, this was added to DNA pol 1, ligase, bromouracil and 32P labeled dNTP to produce (-) strand. The dsRF was nicked, made single stranded, and the new (-) strand was isolated following centrifugation. The (-) strand was then used with DNA pol 1, ligase, unlabeled dNTPs, and NO BU, to produce a new (+) strand in vitro. This new (+) strand was successfully used to infect E. coli and produce new PhiX175 phage particles. This demonstrated that DNA pol 1 was capable of producing biologically active DNA in vitro.

Kornberg used the phage PhiX174 to demonstrate DNA pol 1 was able to produce biologically active DNA in vitro. Describe in sufficient detail the experimental methods that he used to draw the conclusions in DNA pol 1 could produce biologucally active DNA. For full credit include details about any reagents, chemicals, or labels that Kornberg utilized in order to draw his conclusions.

An initial (+) strand of PhiX174 was labeled w/ 3H, this was added to DNA pol 1, ligase, bromouracil and 32P labeled dNTP to produce (-) strand. The dsRF was nicked, made single stranded, and the new (-) strand was isolated following centrifugation. The (-) strand was then used with DNA pol 1, ligase, unlabeled dNTPs, and NO BU, to produce a new (+) strand in vitro. This new (+) strand was successfully used to infect E. coli and produce new PhiX175 phage particles. This demonstrated that DNA pol 1 was capable of producing biologically active DNA in vitro.

Describe 3 pieces of evidence that supports the hypothesis that DNA methylation is important factor in gene regulation

An inverse relationship exists bw the degree of methylation and the degree of gene expression Methylation patterns are tissue specific and heritable for all cells in that tissue Incorporation of 5-azacytosine (which can't be methylated) causes changes in the pattern of gene expression.

The sketch above depicts a cell from an organism in which 2n=2 and each chromosome is metacentric. What stage does the sketch represent?

Anaphase of meiosis II

What is evolution? Describe four different mechanisms by which it can occur.

Answer: Evolution is a change in the allele frequencies in a population. It can occur via the following four mechanisms: a) Genetic drift. Conditions under which it occurs: Random change in allele frequencies due to small population size or a small founder population colonizing a new habitat. b) Migration/gene flow. Conditions under which it occurs: New individuals are added to a population. If their genetic makeup for any particular gene is different from that of the population they join, the overall allele frequency in the new population changes. c) Mutation. Conditions under which it occurs: A direct change in an allele as a result of some environmental insult and/or a problem in replication. d) Natural selection. Conditions under which it occurs: If there is variation for a trait, heritability for that trait, and differential reproductive success based on that trait, evolution by natural selection is occurring.

List at least two different types of DNA repair and briefly explain how each is carried out.

Any three of the following - 1. Mismatch repair. Replication errors that are the result of base-pair mismatches are repaired. Mismatch repair enzymes recognize distortions in the DNA structure due to mispairing and detect the newly synthesized strand by the lack of methylation on the new strand. The bulge is excised and DNA polymerase and DNA ligase fill in the gap. 2. Direct repair. DNA damage is repaired by directly changing the damaged nucleotide back to its original structure. 3. Base excision repair. The damaged base is excised, and then the entire nucleotide is replaced. 4. Photo reactive repair - reversal of pyrimidine dimers formed by uv light exposure. Requires the photoactivation enzyme 5. Post-replication repair - occurs on damaged DNA that has escaped initial mismatch repair during DNA replication. In this mechanism the RecA protein recombines the corresponding on the undamaged parental strand of the same polarity 6. Double strand break repair - responsible for attaching two broken strands of DNA - uses homologous recombination repair and the corresponding region on the sister chromatid as a template 7. Nucleotide Excision Repair (NER) - able to remove wide range of defects in DNA especially bulky DNA lesions. Chunk of roughly 22-30 nucleotides is removed leaving a single stranded gap that is then filled in and sealed.

Approximately 5% of the cytosine residues are methylated in the genome of any given eukaryote. In what way is DNA methylation related to genetic regulation?

Scientists use the pink bread mold Neurospora to study meiosis. What are the features of this organism that lend itself for this line of study?

Asexual colonies are easily and inexpensively maintained in the lab. The haploid state of Neurospora makes it ideal for mutational analyses as mutant alleles are always expressed directly in the phenotype.

Briefly define the term "autoradiography." Identify and describe a classic experiment that used autoradiography to determine the replicative nature of DNA in eukaryotes.

Autoradiography is a technique that allows an isotope to be detected within a cell. The Taylor, Woods, and Hughes (1957) experiment used 3H-thymidine.

Briefly define the term "autoradiography". Identify and describe a classic experiment that used autoradiography to determine the replicative nature of DNA in eukaryotes.

Autoradiography is a technique that allows an isotope to be detected within a cell: The Taylor, Woods, and Hughes (1957) experiment used 3H-thymidine.

What inheritance is suggested by each description? Extensive pedigree analysis on a characteristic shows all of the following: • the characteristic affects males and females equally. • two unaffected parents can have an affected child. • in families in which the parents are unaffected but the children are affected, 1/4 of the children are affected.

Autosomal recessive

Assume that you wished to generate conditional mutations (such as temperature sensitive mutations) for the study of cell-cycle genes in yeast. Of the mutagens listed in the following, which would be the most likely to generate such mutations? A. transposon insertion B. nitrosoguanidine C. ethyl methane sulfonate (EMS) D. B and C E. radiation

B and C

Genetic distances within a given linkage group Cannot exceed 100cM Are dependent upon crossover frequencies between paired, non-sister chromatids Are measured in centiMorgans Cannot be determined A, B, and C B, C, and D B and C

B and C

Assume that you wished to generate conditional mutations for the study of cell-cycle genes in yeast. Of the mutagens listed in the following, which would be the most likely to generate such mutations?

B and C (only multi-option, no A and B or A and C)

Which of the following statements is NOT true about enhancers? A) Enhancers contain sequences that are recognized by transcription factors. B) Enhancers are recognized by and bind directly to RNA polymerase. C) Enhancers can differ for each gene in a eukaryotic cell (although overlap is possible). D) Enhancers represent control elements located far away from the promoter. E) Enhancers can be located thousands of nucleotides upstream of downstream of the gene they affect.

B) Enhancers are recognized by and bind directly to RNA polymerase.

A principle problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that Prokaryotes use a different genetic code from that of eukaryotes Bacteria cannot remove eukaryotic introns Bacterial RNA polymerase cannot make RNA complementary to mammalian DNA Bacterial DNA is not found in a membrane-bounded nucleus and therefore incompatible with mammalian DNA

B. bacteria cannot remove eukaryotic introns

Translation is directly dependent on all of the following associations except __________ Complementary base pairing between mRNA and rRNA Complementary base pairing between mRNA and DNA Association of the 30S and 50S ribosomal subunits Complementary base pairing between mRNA and tRNA

B. complementary base pairing between mRNA and DNA

Regulation of gene expression using siRNAs is found in Prokaryotes only Eukaryotes only Prokaryotes and eukaryotes

B. eukaryotes only

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA? Two Three Four Six five

B. three

What is the purpose of a cDNA library? To produce a library of genomic DNA of an organism To produced a library of expressed genes To replicate the genomic DNA To produce a library of chloroplast genes

B. to produce a library of expressed genes

Molecular biologists rely on many, often sophisticated, techniques to pursue their discipline. One may list ultracentrifugation, electron microscopy, X-ray diffraction, electrophoresis, and computer interfacing as fundamental. Model organisms provide the raw materials for study. List four "organisms" (or organismic groups) often used by molecular biologists and describe a major advantage of each group to the molecular biologist. We might consider these as "model organisms" of the molecular biologist.

Bacteriophage: relatively simple, short generation time. Bacteria: relatively simple, short generation time, simple growth requirements. Yeast: relatively simple for a eukaryote, short generation time, simple growth requirements. Drosophila: relatively simple to culture, extensive genetic and developmental information available, "giant" polytene (salivary gland) chromosomes.

For a physical map of a chromosome, distances are measured in units of Base pairs RFLPs Percent recomination centiMorgans contigs

Base pairs

Why do insertions and deletions often have more drastic phenotypic effects than base substitutions do?

Because amino acid codons consist of three nucleotides, insertions and deletions that involve any multiple of three nucleotides will leave the reading frame intact. However, the addition or removal of one or more amino acids may still affect the phenotype. Insertions or deletions that do not alter the translation reading frame are called "in-frame" insertions and deletions.

Why does DNA polymerase III exist as a dimer?

Because both strands are replicated simultaneously

Assume that you have cut λ DNA with the restriction enzyme HindIII. You separate the fragments on an agarose gel and stain the DNA with ethidium bromide. You notice that the intensity of the stain is less in the bands that have migrated closer to the "+" pole. Give an explanation for this finding.

Because the smaller fragments migrate toward the "+" pole, away from the origin, they bind less stain than the larger fragments near the origin.

Regulatory proteins that bind DNA have common motifs that interact with sequences of DNA. How do amino acids in DNA-binding proteins interact with DNA?

By forming hydrogen bonds with DNA bases

Which of the following statements best describes the relationship between the Hardy-Weinberg principle and the effects of natural selection? A) The Hardy-Weinberg equation assumes that all genotypes occur with equal frequency, but if there is selection against one or more genotypes, equal frequency of all genotypes is not possible. B) If it can be determined that selection favors a particular genotype, the Hardy-Weinberg equation should not be applied. C) If selection can be quantified, relative fitness values can be calculated and used to appropriately modify the Hardy-Weinberg equation. D) Natural selection can influence the genotype frequencies predicted by Hardy-Weinberg, but allele frequencies are not affected.

C) If selection can be quantified, relative fitness values can be calculated and used to appropriately modify the Hardy-Weinberg equation.

In an analysis of the nucleotide composition of double stranded DNA to see which bases are equivalent in concentration, which of the following would be true? A. A = C B. A = G and C = T C. A + C = G + T D. A + T = G + C

C. A + C = G + T

Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common? All are alternate forms of the ancestor All require plasmid cloning techniques All are derived from a single ancestor All contain mutations

C. All are derived from a single ancestor

What are the approximate positions (in bp) of each type of consensus sequence (modular element) found at the 5' end of eukaryotic genes?

CG box = -110 CAAT box = -70 TATA box = -30

What determines serotypes?

Cell Surface Antigens Cell Capsule (Virulent Cells)

List four applications of PCR technology. Do not describe what PCR *does* (well, you can if you want, but you won't get points for it). Instead, list activities or fields in which PCR is useful.

Cell-free cloning Identification of restriction enzyme variants Screening for genetic disorders Diagnostic screening for infectious organisms Forensics Paleobiology

Kornberg Experiment

Cell-free extract of bacteria and test each component to see which allows synthesis. Identified dNTPs and DNA Polymerase 1 Base pairing is the reaction mechanism for DNA synthesis

What is comparative genomics? How does its study contribute to our understanding of genetics?

Comparative genomics is a relatively new field involved in identifying similarities and differences in organization and gene content among the genomes of different organisms. Such studies are important for studying the genetic relatedness of species and for identifying gene families.

Describe the differences between dominance, co-dominance, and incomplete dominance.

Complete dominance is when one allele completely shows and the other is hidden. Ex. Color of peas (yellow dominant, green recessive) . Codominace two or more alleles are dominant. Ex ABO blood type. Incomplete dominance is when both alleles show because none fully dominant. Ex. Red flower +white flower = pink flower

Assume that a cross is made between AaBb and aabb plants and that all the offspring are either AaBb or aabb. These results are consistent with the following circumstance. Complete linkage alternation of generations codominance incomplete dominance hemizygosity

Complete linkage

Yellow leaves on a plant can be caused by genetic mutations, viruses, or unfavorable environmental conditions. Suppose you find a plant that has yellow leaves and want to determine if the cause of the phenotype is a genetic mutation or an environmental stress. Design an experiment to differentiate between the different possibilities.

Cross the yellow plant with a normal plant and examine the F₁ generation for a consistent, predictable segregation pattern (Ex: The presence of 3 green: 1 yellow segregation ratio suggests that the yellow phenotype was caused by a recessive mutation)

____ refers to the splitting of the cytoplasm, separating one cell into two.

Cytokinesis

The following are features and characteristics of the DNA molecule except ______. A. composed of 4 nitrogenous bases B. capable of being replicated C. can be mutated D. is used as genetic material by all organisms E. all of the above

What do PCR, reverse transcriptase, and dideoxy DNA sequencing all have in common? All produce RNA as a product All produce RNA as a product All produce lipid as a product All product DNA chains as a product

D. all product DNA chains as a product

This question relates to the regulation of enzymes involved in the synthesis of tryptophan in E. coli. If tryptophan is present in the medium and available to the bacterium, The repressor is inactive and the tryptophan operon is "off" The repressor is inactive and the tryptophan operon is "on" The repressor is bound to the operator, thus blocking transcription The five structural genes associated with tryptophan synthesis are being transcribed at "induced" levels Positive control is occurring

D. the repressor is bound to the operator, thus blocking transcription

Which of the following enzymes are known to be involved in the replication of DNA in bacteria? Check all that apply. RNA Polymerase I RNA Polymerase III DNA polymerase III helicase gyrase

DNA Polymerase III Helicase Gyrase

The region of a protein that is capable of holding on to a particular nucleotide sequence in order to affect proper gene regulation.

DNA binding domain

Reverse transcriptase (from a retrovirus like HIV) generates

DNA from RNA

Which of these is a level or type of genetic regulation in eukaryotes? Select all that apply post-translational RNA splicing co-transcriptional DNA methylation transcriptional

DNA methylation, transcriptional, post-translational

Which of the following enzymes are known to be involved in the replication of DNA in bacteria? RNA polymerase I DNA polymerase III helicase gyrase RNA polymerase III

DNA pol III, helicase, gyrase

After primer removal, how is the gap filled?

DNA polymerase I also fills in the primer region with DNA

Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction?

DNA polymerase III

How are the initial primers removed?

DNA polymerase Iremoves the RNA primer (5'-->3'exonuclease activity, UNIQUEto DNA polI)

A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task?

Data about the inheritance of SNP markers in families with the disease

For the purposes of this question, assume that being Rh+ is a consequence of D and that Rh- individuals are dd. The ability to taste phenylthiocarbamide (PTC) is determined by the gene symbolized T (tt are nontasters). A female whose mother was Rh- has the MN blood group, is Rh+ and a nontaster of PTC, and is married to a man who is MM, Rh-, and a nontaster. List the possible genotypes of the children. Assume that all the loci discussed in this problem are autosomal and independently assorting.

DdMMtt, DdMNtt, ddMMtt, ddMNtt

Experiments involving nuclear transplantation in amphibians indicate that nuclei derived from blastula are more likely to support development of complete and normal adults compared with those derived from later stages of development. What do these experiments tell us about the process of development?

Development occurs as a series of cascades, with early genes influencing late genes, at times with stability. Such progressive determination, if stable, may be irreversible and fail to support development of an entire organism from a single cell. A number of epigenetic factors such as chromatin remodeling and DNA methylation are also likely to come into play.

Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides?

Different fluorochromes attached to the four different ddNTPs.

Frederick Griffith

Discovered transformation during an experiment that involved injecting mice with smooth S cells, rough R cells, heat-killed S cells, and heat-killed S cells with living R cells.

LINES differ from retrotransposons in that LINES:

Do not contain LTRs

Maternal effects are cases of extrachromosomal inheritance in which the genotype of the mother influences the phenotype of her immediate offspring in a non-Mendelian manner. Explain the general molecular basis of a maternal effect.

During development of the egg, females provide numerous nutritional and informational substances, which direct and support early embryonic development. These substances are often in the form of transcription factors, receptors, mRNA, and proteins, although other substances are also likely (substrates and products). In some cases, these maternally supplied substances override the actual genotype of the zygote and produce a phenotype much like the genotype of the mother.

During gel electrophoresis, _____ will migrate more rapidly than _____ a. cloning vectors b. ethidium bromide c. large DNA fragments d. DNA size markers e. small DNA fragments

E, C

Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites in the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion. 400, 800, 1000 (2 of these) 400, 1200, 1600 300, 700, 2200 700, 400, 1400, 2600 300, 700, 1000, 1200

E. 300, 700, 1000, 1200

Compared with prokaryotic chromosomes, eukaryotic chromosomes are: Larger, mainly organized in monocistronic transcription units without introns Small, mainly organized int monocistronic transcription units with introns Large, mainly organized into polycistronic transcription units without introns Small, mainly organized in polycistronic transcription units without introns Large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns

E. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns

A short segment of an mRNA molecule is shown below. The polypeptide it codes for is also shown: 5'-AUGGUGCUGAAG: methionine-valine-leucine-lysine Assuming that a mutation in the DNA occurs so that the fourth base (counting from the 5' end) of the mRNA now reads A rather than a G. What sequence of amino acids will the mRNA now code for? Methionine-valine-leucine-lysine Methionine-lysine-leucine-lysine Methionine-leucine-leucine-lysine Methionine-valine-methionine-lysine methionine-methionine-leucine-lysine

E. methionine-methionine-leucine-lysine

Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together

As a model system, what are three of the advantages of the mouse as a model system?

Easy to grow Mice have similar body plans and stages of development as humans Similar genome size and number of chromosomes to humans

What is meant by the designation EcoRI? Do not simply state the type of macromolecule designated by EcoRI, but explain why it is so named.

Eco is derived from the beginning letters of the organism's name. R is the specific strain. I distinguishes that this organism was the first variant of the strain R to be identified and named.

Genetic information can be carried in which of the following biomolecule?

Either DNA or RNA

Mario Capecchi, Sir Martin Evans, and Oliver Smithies recently won a Nobel Prize for gene targeting (gene knockouts) in mice. Describe the steps involved in creating a knockout mouse.

Embryonic stem (ES) cells heterozygous for a knockout mutation in a gene of interest (X) and homozygous for a marker gene (here, black coat color) are transplanted into the blastocoel cavity of 4.5-day embryos that are homozygous for an alternate marker (here, white coat color). The early embryos then are implanted into a pseudopregnant female. Some of the resulting progeny are chimeras, indicated by their black and white coats. Chimeric mice then are backcrossed to white mice; black progeny from this mating have ES-derived cells in their germ line. By isolating DNA from a small amount of tail tissue, it is possible to identify black mice heterozygous for the knockout allele. Intercrossing of these black mice produces individuals homozygous for the disrupted allele, that is, knockout mice.

How do enhancer elements differ from suppressor mutations?

Enhancer elements enable transcription of a gene to be increased, and supressor mutations cause transcription to be inhibited.

RNA polymerase

Enzyme similar to DNA polymerase that binds to DNA and separates the DNA strands during transcription

Briefly discuss general trends relating to DNA content and gene number in major groups of organisms. How do eukaryotes and prokaryotes differ in regard to gene number and organization? As a general rule, what can be said about the genomes of more complex eukaryotes vs. less complex eukaryotes? If two species are very closely related, what can be said about the relative sizes of their genomes?

Eukaryotes contain more DNA in their genomes than bacteria and exhibit a wide variation of DNA amount among different groups. Evolutionary expansion has been accompanied by increased amounts of DNA, with more "complex" forms containing more DNA than less complex forms. Such change in DNA content is not universally accompanied by increases in gene number. Some closely related species may vary more than tenfold in their DNA content.

Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.

Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes. -or- Genes are more densely spaced in prokaryotes versus eukaryotes -or- prokaryotic genomes typically encode fewer genes than eukaryotic genomes Other answers are acceptable, provided they are true and make sense.

There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates?

Eukaryotic: repetitive DNA

There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? Eukaryotic: repetitive DNA Eukaryotic: ESTs Prokaryotic: repetitive DNA Prokaryotic: presence of plasmids Eukaryotic: circular DNA

Eukaryotic: repetitive DNA

Design an experiment that would allow you to determine if a particular nucleus in a Drosophila embryo is capable of directing development of an entire new fly.

Experiments in support of such genomic equivalence include the following: the observation that chromosome number and structure do not consistently change in different cells of an organism, nuclear transplantation in amphibians, and the presence of genes but no gene products in some tissues (hemoglobin, for example). The recent cloning of Dolly also supports the above. For the Drosophila experiment, one could do nuclear transplantation similar to the classic experiments in amphibians and recent experiments in mammals or transplant a cell from embryos of one genotype to the posterior end of the early embryos of another genotype. The transplanted cells would be reprogrammed into germ cells by the posterior P granules. The transplant can be detected in the next generation by the recognizable different phenotypes due to different genotypes of the donor and recipient.

Under certain circumstances, one can make use of expression libraries to identify and clone a gene of interest. Describe an expression library and how one could be used to clone a gene.

Expression libraries contain cDNA clones inserted into vectors that have a promoter that will drive the expression of the cDNA within E. coli host cells. Antibodies specific for a purified protein will recognize the protein produced in bacteria from the cDNA vector. This allows the investigator an opportunity to select the relevant clone from the library.

Riboswitches were first discovered in 2002 and have been found in... Plants Bacteria Fungi Archaea In none of the listed organisms In all of the listed organisms

F. in all of the listed organisms

List 2 methods that we have discussed used to map human genes.

FISH and Synteny Testing

Define the term "fitness". What are three critical points to keep in mind when measuring fitness?

Fitness is the relative probability of survival and reproduction of a genotype or phenotype. Critical to assessing fitness is understanding that it is measured: a) relative to other genotypes/phenotypes in the population; b) in a specific environment; c) by reproductive success.

Group II Introns

Found in mRNA and tRNA of mitochondria and chloroplasts, NO co-factor required

Two "naked" (without histones or other proteins) double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?

Fragment A likely has a low Gaunosine/Cytosine content than fragment B. Because Guanosine/Cytosine has 3 h-bonds and Adenine/Thymine only has 2 h-bonds, more energy (higher termperature) is required to break apart the G/C rich fragment.

When cells withdraw from the continuous cell cycle and enter a "quiescent" phase, they are said to be in what stage?

You have embarked on some additional heteropolymer experiments to further evaluate the codon table. In your current heteropolymer experiment you are using guanine and uracil to produce a synthetic mRNA using the enzyme polynucleotide phosphorylase to make the synthetic mRNA. You are using these two ribonucleotide diphosphases in the following ratio, 3G:5U. Using the information, what are ALL of the expected triplets produced in this experiment? Further, what are expected percentages of each of these triplets in the synthetic mRNA?

GGG: 5.3% GGU: 8.8% UGG: 8.8% GUG: 8.8% GUU: 14.6% UGU: 14.6% UUG: 14.6% UUU: 24.4%

__________ mutations produce new traits and are usually dominant.

Gain-of-function

Genetic involvement in development appears to be achieved at least in part by variable _________

Gene activity

Define gene regulation. What are three ways gene regulation can be controlled in a cell?

Gene regulation is defined as the control of a gene's transcript and its protein product. It can be achieved by altering either the transcription of the gene (RNA level), the translation of the protein from that transcript or by altering the structure of DNA such that transcription cannot occur.

Present an overview of the gene organization in large-genome plants. What general level of gene density do plant genomes normally exhibit? What is the composition of the non-gene portions of the DNA?

Generally genome divided into 1. highly repetetive sequence (10%): It is non gene portion, contains 1. Tandem repeats:. 2.Dispersed repeats: 2. moderatly repetative sequence (20%) : Gene families 3. non repetative sequence(70%): Almost all structural genes.

Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map?

Genes mapped based on recombination will appear to be very close together in centromeric regions due to low rates of recombination. Distances between the same genes on the physical map may be much greater when compared to other regions of the chromosome.

Describe the relationship between the maternal-effect gene bicoid and the zygotic gene hunchback.

I said "Maternal effect gene bicoid helps govern the anterior-posterior orientation of the developing embryo, and this plays a big role in proper early development. Later, the zygotic gene hunchback is activated and takes over anterior-posterior organization and development of the embryo." Got a ⅔ - please update if you got a 3 or find a better answer Quizlet says: The bicoid protein is a transcription factor that binds to a series of consequences in the upstream promoter of hunchback. Such binding activates the expression of hunchback. Does anyone know if this is correct?

How does genetic drift alter the genetic variation in a population? Why is it a relatively insignificant agent of evolution in all but the very smallest populations?

Genetic drift, one of four agents of evolution, is characterized by a random change in allele frequencies. Because in altering allele frequencies it can produce fixation of one allele or another, genetic drift decreases the genetic variation in a population over time. There is a probabilistic component to fertilization—it is not certain which sperm and/or egg will be involved—and, consequently, the outcome of crosses cannot always be predicted with accuracy. For example, when a homozygous recessive individual (such as for blue eyes: bb) is crossed with a heterozygote (for brown eyes: Bb), we expect half of the offspring to be heterozygous and half to be homozygous recessive. It is conceivable, however, that all of the offspring (say two or three or more offspring in a row) could be homozygous recessive (and blue-eyed). This can lead to a change in the population's allele frequencies. Just as likely, though, would be for all of the offspring of a cross to be heterozygous (and brown-eyed), again altering the allele frequencies but this time in the opposite direction. The larger a population is, the more likely that any deviations in one direction from our expectations are offset by deviations in the other direction. When this happens, the net effect is that the allele frequencies do not change. For this reason, genetic drift generally plays a significant role only in very small populations.

In extreme cases, genetic drift may lead to the chance fixation of one allele. What happens to other alleles of that gene?

Go away unless mutation occurs

Name the single individual whose work i the mid-1800s contributed to our understanding of the particulate nature of inheritance as well as the basic genetic transmission patterns. With what organism did this person work?

Gregor mendel, Pisum sativum

Describe the structure of a helix-turn-helix (HTH) motif. What is the general function of such motifs?

HTH motif were the first DNA-binding motifs identified. A geometric conformation is formed by two adjacent alpha helices separated by a "turn" of several amino acids. They bind to the major grooves of DNA and interact with the DNA backbone. Many HTH-containing proteins regulate gene expression.

List the components of a nucleosome. Be sure to list specific protein, not just protein type.

Histones H2A, H2B, H3, and H4 exist as two types of tetramers: (H2A)2 + (H2B)2 and (H3)2 + (H4)2.

From a human developmental standpoint, what is the significance of Hox genes?

Hox genes are essential genetic elements that aid in coordinating and regulating body plan for a developing embryo. Based on these genes, limb development and body part placement are determined. They are highly conserved among different organisms.

The__ is an international effort to construct a physical map sequence of the 3.3 billion base pairs in the haploid human genome.

Human Genome Project

The_________________ is an international effort to construct a physical map sequence of the 3.3 billion base pairs in the haploid human genome.

Human Genome Project

The finding that virtually all organisms use the same genetic code provides the basis for declaring that the code is universal. Name one exceptionality to such universality.

Human and yeast mitochondrial cells For a certain STOP codon, they encode for a Trp instead

Explain why the greatest diversity of human SNPs is found among African people.

Humans are thought to have first evolved in Africa. This means that any distinct population of humans (however defined) arose from a subset of the African population that became geographically isolated. Thus, any SNPs in this population arose from precursors that were already present in the African population, and another branch of those ancestral SNPs' descendents is likely still extant in the African population. Basically, for any SNP "family" in a distinct human Population X, the African population probably has a SNP family very similar to that one, plus several others with no clear analogue in Population X.

Considering the structure of double-stranded DNA, what kinds of bonds hold one complementary strand to the other? A. ionic B. covalent C. van der waals D. hydrogen E. hydrophobic and hydrophilic

Hydrogen

The relationship between codon and anticodon can be characterized as involving _____ bw complementary bases (usually) in typical ____ fashion.

Hydrogen bonds, antiparallel

Give a brief definition of homeobox.

I got 3

Assume that a new mutation occurs in the germ line of an individual. What finding would suggest that the new mutation is dominant rather than recessive?

If dominant and if passed on to the next generation, it would be expressed. New recessive mutations are not normally passed on in the next generation, unless, through a combination with a like mutation from the other parents, they are homozygous.

You are studying a population of kangaroo rats. You calculate the expected frequencies of the alleles for coat color. When you compare these to the observed genotype frequencies, there is a large discrepancy. What can you deduce, based on these findings?

If the expected genotype frequencies and the observed genotype frequencies are very different, then the population is not in Hardy-Weinberg equilibrium. At least one of the assumptions must be being violated.

If the frequency of the M allele in the human MN blood group system is 0.65 in a population at equilibrium, then the frequency of the N allele must be 0.04

Nucleic acid blotting is commonly used in molecular biology. Two types, Southern blots and norther blots, involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure of "blotting" in this context and differentiate between Southern and northern blots.

In a Southern blot the DNA to be "probed" is cut with a restriction enzyme(s); then the fragments are separated by gel electrophoresis. Alkali treatment of the gel denatures the DNA, which is then "blotted" onto the filter (nylon or nitrocellulose). A labeled probe (RNA or DNA) is then hybridized to complementary fragments on the filter. In a northern blot, RNA is separated in the gel and "probed" with the labeled DNA.

Nucleic acid blotting is commonly used in molecular biology. Two types, Southern blots and northern blots, involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure of "blotting" in this context and differentiate between Southern and northern blots.

Riboswitches were first discovered in 2002 and have been found in... A. archaea B. bacteria C. In none of the listed organisms D. In all of the listed organisms E. plants F. fungi

In all of the listed organisms

DNA Polymerase III

In charge of synthesizing nucleotides onto the leading end in the classic 5' to 3' direction.

Explain how one would use epistasis analysis to determine order of gene action in genetic networks?

In epistasis analysis, if the phenotype of the double mutant is the same as one of the single mutants, then that single mutation probably occurs at an earlier step in the network.

Which of the following is NOT true regarding the differences in mRNA between prokaryotic cells and eukaryotic cells? In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled. In eukaryotic cells, the 3' end of mRNA is modified with a tail, while in porkaryotic cells there is no tail. In eukaryotic cells, mRNA is spliced before translation, while in prokaryotic cells there is no mRNA splicing. In eukaryotic cells, the 5' end of mRNA is modified with a cap, while in prokaryotic cells there is no cap.

In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled.

What is the general scheme for generating a transgenic mouse strain?

In short, generating transgenic mice involves five basic steps: 1. purification of transgenic construct, 2. harvesting donor zygotes, 3. microinjection of transgenic construct, 4. implantation of microinjected zygotes into the pseudo-pregnant recipient mice, 5. genotyping and analysis of transgene expression in founder mice.

All of the following are characteristics of the genomics revolution EXCEPT_____________ Large scale acquisition of DNA sequences Ability to conduct discovery-based research Enabled reverse genetics approach to genetics research Facilitated collaborative research networks Inability to understand single genes

Inability to understand single genes

A Barr body is a(n)

Inactivated X chromosome, visible in the nucleus of a cell that is from a female mammal

What is the term given to a measure of the loss of fitness caused by inbreeding?

Inbreeding depression

In zoo animals, inbreeding often occurs because there is a lack of a sufficient pool of breeding individuals. Under such conditions, what characteristics often attend inbred organisms?

Increase in genetic disorders. Reduced survival rate. Reduced litter size. Reduce sperm viability Distortions in face symmetry. Reduced genetic variations and increased homogeneity.

Which of the following are general categories of mutations?

Induced, morphological, regulatory

Since the binding of the _________ to the _________ prevents it from binding to DNA by causing a conformational change in its structure, it is called an _________ protein.

Inducer, repressor, allosteric

Present a detailed description of the actions of the regulatory proteins in a) inducible and b) repressible enzyme systems.

Inducible system: The repressor is normally active, but the inducer inactivates the repressor. Repressible system: The repressor is normally inactive but is activated by the corepressor. Active repressors turn off transcription.

What functions earlier in development, maternal-effect genes or zygotic genes?

Maternal-effect genes

Describe the role of the various types of nucleic acids in the storage and expression of information in living organisms.

Information contained in the base sequences of DNA is transcribed into a variety of RNAs. Certain RNAs (tRNA) carry amino acids to the site of translation where proteins are assembled. Other RNAs (mRNA and rRNA) provide a mechanism for ordering the sequence of amino acids in proteins.

The first commercial production of what human enzyme led to the explosion of the biotechnology industry?

Insulin

Which of the below are not steps in the production of genome sequence maps:

Isolate whole chromosomes

Which of the below are not steps in the production of genome sequence maps: Read the sequence of individual piece of the genome. Isolate whole chromosomes. When sequences are obtained, assemble and organize the sequences in order. Identify molecular markers on specific chromosomes. All of these are steps you would use.

Isolate whole chromosomes

You are performing a Hardy-Weinberg test for a particular set of genotypes. You calculate the following: degrees of freedom are 1, and the chi-square value is 9.3 (the associated probability is < 0.005). What can you conclude about these genotypes?

It is very unlikely that these genotypes are in H-W equilibrium p<0.005 means there is less than .5% that it is in H-W equilibrium, reject null

The Hershey and Chase experiments involved the preparation of two different types of radioactively labeled phage. Which of the following best explains why two preparations were required?

It was necessary that each of the two phage components, DNA and protein, be identifiable upon recovery at the end of the experiment.

The molecular nature of transposable elements was first understood in E. coli due to the simplicity of the E. coli genome. Which of the following types of transposable element contribute significantly to the genome complexity of eukaryotic organisms?

LINES, SINES, LTR retrotransposons

Lactose Absent: - + - + - - Lactose Present: + + - + + -

Compared with prokaryotic chromosomes, eukaryotic chromosomes are

Large, linear, less densely packed with protein-coding genes, mainly organized in single gene units with introns.

Linkage with approximately 33 map units between the two gene loci

Assume that investigators crossed a strain of flies carrying the dominant eye mutation Lobe on the second chromosome with a strain homozygous for the second chromosome recessive mutations smooth abdomen and straw body. The F1 Lobe females were then back crossed with homozygous smooth abdomen, straw body males, and the following phenotypes were observed. Smooth abdomen, straw body 820 Lobe 780 Smooth abdomen, Lobe 39 Straw body 54 Wild type 4 Smooth abdomen 148 Lobe, straw body 152 Lobe, straw body, smooth abdomen 3 Give the gene order and map units between these three loci

Lobe is in the middle Smooth abdomen-----5mu---lobe------15.35mu-------------------straw body

Explain how inbreeding can have a positive effect on population fitness.

Many deleterious recessive alleles are weeded out by natural or artificial selection so that the population becomes homozygous for beneficial alleles. In this way, the harmful effects of inbreeding may eventually be eliminated leaving a population that is homozygous for beneficial traits.

In Drosophila, _____ genes are influential in determining the anterior-posterior organization of the developing embryo.

Maternal effect

Fill in the blanks in the "level of transcription" column of this table with: + for high levels of transcription, and - for minimal levels of transcription of the lac operon. Consider regulation by both the lac repressor and CAP (catabolite activator protein). The strain is wild type, with no partial diploidy. Please label your answer with numbers 1-4 based on the chart below. Medium conditions Level of transcription high glucose, no lactose no glucose, high lactose high glucose, high lactose no glucose, no lactose

Medium conditions Level of transcription high glucose, no lactose - no glucose, high lactose + high glucose, high lactose - no glucose, no lactose -

Homologous chromosomes move toward opposite poles of the dividing cell during A. Mitosis B. Meiosis I C. Binary Fission D. Meiosis II

Meiosis I

A measurable or observable trait or characteristic is called a(an) phenotype Chromosomes are in unseparated, sister-chromatid form, at the end of which phase(s)? Meiosis I anaphase Meiosis I prophase Meiosis II anaphase Meiosis II prophase Mitosis telophase Mitosis prophase

Meiosis I anaphase (a), Meiosis I prophase (b), Meiosis II prophase (d), mitosis prophase (f)

Chromosomes are in unseparated, sister-chromatid form, at the end of which phase(s)? Meiosis I anaphase Meiosis I prophase Meiosis II anaphase Meiosis II prophase Mitosis telophase Mitosis prophase

Meiosis I anaphase, Meiosis 1 Prophase, Meiosis II prophase, mitosis prophase

After what meiotic stage would one expect gonads to be formed?

Meiosis II

After what meiotic stage would one expect monads to be formed?

Meiosis II

Explain how it is that genetic variation is maintained in the population. Why is it that dominant alleles do not eventually take over?

Meiotic segregation in randomly mating populations results in an equilibrium distribution of genotypes after only one generation, so genetic variation is maintained. As long as there is random mating occurring, then the frequency of dominant and recessive alleles will remain the same.

Present two forms of post-translational modification of proteins

Methylation and phosphorylation

We have looked at the cloning experiments involved in producing Snuppy. After Snuppy was born, it was critical to show that Snuppy was indeed a clone of the donor Afghan hound. Describe the specific technique that was used and how the results demonstrated that Snuppy was in fact a clone of the donor Afghan hound.

Microsatellite analysis was used to show that Snuppy was a clone. Microsatellite loci are highly variable loci that contain a large number of DNA repeats (eg. 2, 3, or 4 nucleotides in length) at the population level. However, an individual can only have 2 of these alleles at any one microsatellite locus. By comparing the alleles that Snuppy had at 8 different microsatellite loci with those allele that the donor afghan hound and the surrogate mother had, it was shown that Snuppy had exactly all of the same alleles as the afghan hound, providing that Snuppy was a clone of the donor afghan

We have looked at the cloning experiments involved in producing Snuppy. Describe the specific technique that was used and how the results demonstrated that Snuppy was in fact a clone of the donor Afghan hound.

Microsatellite analysis was used to show that Snuppy was a clone. Microsatellite loci are highly variable loci that contain a large number of DNA repeats (eg. 2, 3, or 4 nulceotides in length) at the population level. However, an individual can only have 2 of these alleles at any one microsatellite locus. By comparing the alleles that Snuppy had at 8 different microsatellite loci with those alleles that the donor Afghan hound and the surrogate mother had, it was shown that Snuppy had exactly all of the same alleles as the Afghan hound, proving that Snuppy was a clone of the donor Afghan.

How will variation for a gene in a given population be increased?

Migration from other populations that may bring in alleles not already in the population or that is present in low frequencies

What is the difference between a missense mutation and a nonsense mutation?

In addition to highly repetitive and unique DNA sequences, a third category of DNA sequences exists. What is it called, and what types of elements are involved?

Moderately repetitive DNA, SINEs, LINEs and VNTR

Inbreeding in populations that are normally outbreeding leads to which of the following?

More individuals affected by rare diseases

Present a general definition for a multigene superfamily.

Multigene superfamilies share DNA sequence homology, and their gene products are functionally related. They are often (but not always) found together in a single location in a chromosome. They are believed to be derived from a common ancestral gene.

What are null mutations? What classes of mutagens would most likely generate null mutations?

Mutations causing loss-of-function in a gene, usually recessive; missense and nonsense

If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the chromosome number of the four resulting gametes with respect to the normal haploid number (n)?

N+1, n+1, n-1, n-1

If the following DNA sequence 5'---------TTT AGA CCC CCC AGA TTT-----3' 3'---------AAA TCT GGG GGG TCT AAA-----5' is transcribed and translated, what would be the primary sequence of the final protein product? Note: UUU, AGA, and CCC code for phenylalanine (Phe), arginine (Arg) and proline (Pro), respectively. N and C in the following answers refer to the N and C termini, respectively.

N-----Phe-Arg-Pro-Pro-Phe-Arg------C

The following table lists several genotypes associated with the lac operon in E. coli. For each, indicate with a "+" or a "—" whether β-galactosidase would be expected to be produced at induced levels. (Assume that glucose is not present in the medium.) Genotype No lactose With lactose a I + O+ Z+/ F' I + O+ Z+ __________ _________ b I - Oc Z -/ F' I - Oc Z- __________ _________ c I - Oc Z +/ F' I - O+ Z+ __________ _________ d I s Oc Z -/ F' I s O+ Z+ __________ _________

NEED ANSWER

What term would be applied to a regulatory condition that occurs when protein greatly reduces transcription when associated with a particular section of DNA?

Negative control

Negative inducible

E. coli lac operon control by lac I

Negative inducible

The phenomenon in which one crossover increases the likelihood of crossovers in nearby regions is called:

Negative interference

An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operson. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule.

Negative repressible

What are the differences between neutral mutations and silent mutations?

Neutral mutations are changes in DNA sequence that alter the amino acid coding sequence of a polypeptide, but do not change its biological function. Silent mutations, on the other hand, are changes in DNA sequence that produce synonymous codons specifying the same amino acid as the original, non-mutated sequence.

What advantages does pUC18 have in terms of recombinant DNA technology? List 3 such advantages

Small size High copy number Polylinker in lacZ gene

Introns

Noncoding segments of nucleic acid that lie between coding sequences.

In Drosophila, an individual female fly was observed to be of the XXY chromosome complement (normal autosomal complement) and to have white eyes as contrasted with the normal red eye color of wild type. The female's mother and father had red eyes. The mother, however, was heterozygous for the gene for white eyes. Knowing that white eyes are X-linked and recessive, present an explanation for the genetic and chromosomal constitution of the XXY, white eyed individual. It is important that you state in which parent and at what stage the chromosomal event occurred that caused the genetic and cytogenetic abnormality.

Nondisjunction could have occurred either at meiosis I or meiosis II in the mother, thus giving the XwXwY complement in the offspring.

How might one generate a line of male mice that contain two X chromosomes?

Nondisjunction during meiosis to cause two X's and one Y

An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it?

None

Which of the following statements about a mammalian messenger RNA are FALSE? It is synthesized in the nucleus. It is translated in the cytoplasm. It is usually much smaller than the initial transcript (that is copied directly from the gene). None of the above. It usually contains a cap at the 5' end.

None of the Above

E. coli bacteria are placed into a medium containing glucose and lactose. Which of the genes below do you expect to be turned on? Lac I None of the above Lac P f-galactosidase Permease

None of the above

Which of the following features distinguishes RNA from DNA? A. DNA has only primase bases B. RNA has a pentose sugar while DNA utilizes a hexose C. Unlike RNA, DNA uses a phosphodiester backbone D. RNA has only pyrimidine bases E. None of the above

None of the above

What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined.

Northern blots are used to detect/compare/study RNA in a sample. Steps: (1) RNA is extracted from tissue, cells etc. (2) Gel electrophoresis separates RNA molecules based on size (3) RNA is "blotted" (transferred) from the gel onto a membrane. (4) RNA is fixed to the membrane and hybridized with a probe (probe is labeled radioactively or with enzymes for chemiluminesence) (5) Visualization of RNA using X-ray film or phosphoimager screen. RNA levels can be determined and quantified by the darkness of the bands in the image.

What is the name of the precursor molecule used in nucleic acid synthesis?

Nucleoside triphosphate

This organic subunit is the monomer from which nucleic acid is formed

Nucleotide -This is the answer I put but it marked it wrong, but other quizlets say this is the answer?

A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons.

OH; 2'; 3'

Short "bursts" of DNA synthesis on the lagging strand produce ___________.

Okazaki Fragments

In what ways are specific DNA sequences of the template amplified in the polymerase chain reaction? In other words, how does one target the target?

Oligonucleotide primers anneal to specific, complementary sequences in the template DNA, and dNTPs are added so they extend from the primer

In what way are specific DNA sequences of the template amplified in the polymerase chain reaction? In other words, how does one target the target?

Oligonucleotide primers associate by hydrogen bonding to specific sections; primers are then extended

Transcription factors appear to be important molecules relating to the regulation of gene activity. Regarding eukaryotes, two general classes of transcription factors exist. Briefly describe each.

One class assembles at promoter regions adjacent to the site of transcription. Activator and Repressor. Recruitment of an activator to a promoter results in increased gene expression. Recruitment of a repressor leads to decreased gene expression. The other class binds at more distant regions enhancers, silencers

How might gene targeting be used to help understand the function of a given gene?

One could use gene targeting to remove a specific part of a gene (ie. an exon) to observe how a change in structure affects its function.

The chi-square test involves a statistical comparison bw measured and predicted values. One generally determines degrees of freedom as

One less than the number of classes being compared

What term refers to a contiguous genetic complex that is under coordinate control?

Operon

P-element transposons provide a powerful tool for the study of Drosophila genetics. What are P elements, and why are they so useful?

P-element transposons are mobile genetic elements that can move in and out of the genome. A transposase enzyme recognizes and acts on 31 bp inverted repeats at each end of the P element. Genetically engineered P elements can be injected into eggs, which enables the P-element bearing gene to be inserted into the embryo's DNA. With proper markers, the flies bearing the modified element can be recognized and transformed and mosaic flies may pass the element in the germ cells. P-elements can also be used to generate mutations by inserting into genes, thus disrupting their function.

In deer mice, red eyes (r) is recessive to normal black eyes (R). Two mice with black eyes are crossed. They produce two offspring, one with red eyes and one with black eyes. Give the genotypes of parents and offspring of this cross.

Parents: Rr or Rr Offspring: rr and Rr

You are viewing a pedigree and trying to determine the inheritance pattern of a trait. List three characteristics that, if observed, would indicate that the trait is X-linked recessive.

Pedigrees with autosomal recessive traits will show both affected males and females arising with equal frequency from unaffected parents. The trait often appears to skip generations. Unaffected people with an affected parent will be carriers.

A conditional mutation is one that allows a mutant gene product to function normally under the ____ condition, but to function abnormally under the ____ condition. Such mutations are especially useful for the study of _____ mutations.

Permissive, restrictive, lethal

What chemical group is found at the 5' end of a DNA molecule?

Phosphate Group

What chemical group is found at the 5' end of a DNA molecule? A. Hydroxyl group B. nitrogenous base C. carboxyl group D. dideoxy group E. phosphate group F. sulfate group

Phosphate group

The bonds that connect nucleotides in the backbone of a DNA strand are called _________bonds.

Phosphodiester

A map of the order, overlap, and orientation of physically isolated pieces of the genome

Physical map

The ____________________ stabilizes the 5' cap, which must be removed before the mRNA molecule can be degraded from the 5' end.

Poly(A) tail

Enhancers have several structural and functional characteristics that distinguish them from promoters. Describe three such characteristics, focusing on how these traits differ between enhancers and promoters.

Position need not be fixed. Orientation may be inverted without significant effect. They can act at a great distance from the promoter.

Listed below are blood types for several children and their mothers. Give all possible genotypes and blood types for the father of each child. Child's blood type Mother's blood type a. A A b. O B c. AB A d. B AB

Possible genotypes of father: a. BO, OO, AO, AA, AB b. BO, OO or AO c. BO, BB, AB d. BO, BB or AO

In studies of human genetics, usually a single individual brings the condition to the attention of a scientist or physician. When pedigrees are developed to illustrate transmission of a trait, what term does one use to refer to this individual?

Proband

A coworker in your lab discovered a strain of E. coli that has nonfunctional RNA polymerase. He felt sorry for the suffering E. coli and decide to add an RNA polymerase enzyme and gene from Drosophila to this mutant to survive. You think that this is a foolish idea that will not work. Put together an argument as to why the addition of a Drosophila RNA polymerase could not possibly allow this mustant E. coli to survive.

Prokaryotic and eukaryotic RNA polymerases are different. The Drosophila RNA polymerase will not be able to find the E. coli promoters and thus not be able to transcribe any of the E. coli genes. Alt. answer: change it up by having a be a strain of yeast and complementing with the Drosophila polymerase III enzyme and asking why it doesn't work.

Describe the function of promoters in eukaryotes. Where are they usually located, relative to the corresponding gen? What two sequence elements do they normally possess?

Promoter regions are necessary for the initiation of transcription. Promoters that interact with RNA pol II are usually located within 100 bp upstream of a gene and usually contain TATA box (-26 to -30) and a CAAT box (-70 to -80)

Describe the function of promoters in eukaryotes. Where are they usually located, relative to the corresponding gene (give a quantitative answer in base-pairs)? What two sequence elements do they normally possess?

Promoter regions are necessary for the initiation of transcription. Promoters that interact with RNA polymerase II are usually located within 100 bp upstream of a gene and usually contain a TATA box (-25 to -30) and a CAAT box (-70 to -80).

What does RNA polymerase recognize to initiate transcription?

Promoters

In eukaryotes, what factors (either DNA sequences or proteins) appear to encourage the specific association of RNA polymerase(s) to a specific region of DNA?

Promoters, enhancers, and transcription factors

What are the basic regulatory elements in a strand of DNA that allow for genes to be regulated? Are these different in eukaryotes and prokaryotes? If so, how?

Promoters, operators in prokaryotes. Promoters, proximal promoter elements, enhancers, and silencers in eukaryotes. Eukaryotic transcription is different in a few ways, most notably in that prokaryotic genes are transcribed as operons, while eukaryotic genes are not. In addition, the role of the nucleosome is different in eukaryotic transcription.

In eukaryotes, chromosomes do not contain:

Proteases

What is meant by the term pseudogene?

Pseudogenes are nonfunctional versions of genes that resemble other gene sequences but that contain significant nucleotide substitutions, deletions, and duplications that prevent their expression. Pseudogenes are designated by the prefix (psi).

What are the two major components of the Tobacco Mosaic Virus?

RNA and Protein

Telomerase is composed of what 2 types of macromolecules? What is the name for such a combination?

RNA and protein, called a ribonucleoprotein

5' ...GGAGCUCGUUGUAUU... 3' Is this sequence RNA or DNA? How can you tel

RNA because U instead of T

5' ...GGAGCUCGUUGUAUU... 3' Is this sequence RNA or DNA? How can you tell?

RNA because U instead of T

DNA polymerases cannot initiate replication, what is the primer used to allow replication?

RNA polymerase adds a Short segment of RNA (5-15 nucs) made complementary to DNA

Which of the following is TRUE for both prokaryotic and eukaryotic gene expression?

RNA polymerase binds to the promoter region to begin transcription.

Which of the following is TRUE for both prokaryotic and eukaryotic gene expression? mRNA is synthesized in the 3' → 5' direction. RNA polymerase binds to the promoter region to begin transcription. After transcription, a 3' poly-A tail and a 5' cap are added to mRNA. The mRNA is the exact complement of the gene from which it was copied.

RNA polymerase binds to the promoter region to begin transcription.

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can then take over for replication.

RNA primase

During DNA replication, what is the function of RNA primase?

RNA primase provides a free 3' OH upon which DNA polymerization depends

What is the general mechanism by which gene expression in eukaryotes is influenced by the extracellular environment?

RNA signaling endocrines and paracrines

Define RNA silencing (or interference). Explain how siRNAs arise and how they potentially affect gene expression. How are siRNAs different from the antisense RNA mechanisms?

RNA silencing, or RNA interference, occurs when double-stranded RNA molecules are cleaved and processed to produce small single-stranded interfering RNAs (siRNAs). These siRNAs bind to complementary sequences in mRNA molecules, stimulating cleavage and degradation of the mRNA. The siRNAs may also stimulate DNA methylation at DNA sequences complementary to the siRNAs. The paired mRNA-siRNA attracts a protein-RNA complex that cleaves the mRNA in an area bound by the siRNA. Following the initial cleavage, the mRNA is further degraded. The cleavage and subsequent degradation of the mRNA make it unavailable for translation. DNA methylation in the nucleus stimulated by siRNAs also affects transcription. Antisense RNA binds to mRNAs also, but physically interferes with transLATION.

Define RNA silencing (or interference). Explain how siRNAs arise and how they potentially affect gene expression. How are siRNAs different from the antisense RNA mechanism?

Gene Conversion

Recombination leading to mismatch

What function of telomerase makes the DNA strand from the RNA template?

Reverse transcriptase

Briefly describe two major differences between RNA and DNA at the level of the nucleotide

Ribose in RNA, deoxyribose in DNA Uracil in RNA, thymine in DNA

Translation of RNA into protein takes place on which cellular organelle?

Ribosome

A small part of the human Y chromosome contains the gene that is responsible for determining maleness. What is the name of this gene?`

SRY gene or the sex determining gene

A small part of the human Y chromosome contains the gene that is responsible for determining maleness. What is the name of this gene?

SRY gene or the sex-determining gene

A gene which specifies the fate of a particular anatomical segment in Drosophila is called a ________.

Selector gene

Homologous chromosomes are those that can be matched by virtue of their similar structure and function within a nucleus. What chromosomes making up a genome do not follow the same characteristics of homology?

Sex determining chromosomes

What proteins stabilize the open conformation of the unwound DNA?

Single‑strand binding proteins

Which of the following statements about DNA replication is true?

Single‑strand binding proteins stabilize the open conformation of the unwound DNA.

What different results can be expected in a mutagenesis experiment that uses radiation as compared with site-directed mutagenesis?

Site-directed mutagenesis is not random and uses technology in which it is directly inserted by transpon, radiation can alter DNA base structure and is not localized

Okazaki Fragments

Small fragments of DNA produced on the lagging strand during DNA replication, joined later by DNA ligase to form a complete strand.

What advantages does pUC18 have in terms of recombinant DNA technology? List 3 such advantages.

Small size, high copy number and polylinker in lacZ gene.

A mutation that occurs naturally, without exposure to a known mutagen, is called a ________.

Spontaneous

Synthesis of the lagging strand is accomplished through the repetition of the following steps.

Step 1: A new fragment begins with DNA polymerase III binding to the 3' end of the most recently produced RNA primer, primer B in this case, which is closest to the replication fork. DNA pol III then adds DNA nucleotides in the 5' to 3' direction until it encounters the previous RNA primer, primer A. Step 2: DNA pol III falls off and is replaced by DNA pol I. Starting at the 5' end of primer A, DNA pol I removes each RNA nucleotide and replaces it with the corresponding DNA nucleotide. (DNA pol I adds the nucleotides to the 3' end of fragment B.) When it encounters the 5' end of fragment A, DNA pol I falls off, leaving a gap in the sugar-phosphate backbone between fragments A and B. Step 3: DNA ligase closes the gap between fragments A and B.

Codons that specify the same amino acid are said to be _______.

Synonymous (or degenerate is also correct)

What is the specific application of reverse transcriptase in the preparation of cDNA?

Synthesis of DNA from an RNA template to form an RNA-DNA duplex

Transcription

Synthesizes RNA from a DNA template

Two modular elements that appear as consensus sequences upstream from RNA polymerase II transcription start sites are

TATA and CAAT

Regarding the efficient initiation of transcription by RNA polymerase II, what two major types of "upstream" signals appear to be involved?

TATA and CAAT base sequences and enhancers

Type the complementary strand to the following single-stranded DNA. 5' - ATAGCATGGGCCATACGATTACTGA - 3'

TCAGTAATCGTATGGCCCATGCTAT

What is the purpose of the LacZ gene in a plasmid cloning vector?

The LacZ gene is a selectable marker and acts as a reporter gene. Expression of the lacz gene causes bacterial host cells carrying pUC18 to produce blue colonies when grown on medium containing a compound Xgal.

If there are two alleles of a gene controlling coat color in a population of mice and the frequency of the dominant allele is 0.3, which of the following must be true? View Available Hint(s)

The frequency of the recessive allele is 0.7.

What is the relationship between the degree of crossing over and the distance between two genes?

The further apart on the chromosome two genes are, the high likelihood of crossing over.

What is the significance of the homeodomain?

The homeodomain is a highly conserved protein of 60 amino acids found in a variety of organisms, which, in conjunction with other factors, is thought to play a role in DNA binding and transcriptional activation.

Explain why lacOc mutations are cis-acting, whereas lacI mutations can be trans-acting?

The operator region does not produce a diffusible product, whereas the lacI gene does.

Regarding a gene's DNA sequence, what is meant by a sequence motif?

The pattern formed by bases in a conserved sequence of DNA such as a consensus sequence.

The population is not in Hardy-Weinberg equilibrium and at least one of the five assumptions are violated 1. no selection 2. no mutation 3. random mating 4. infinitely large population 5. no migration these things never happen in nature

Provide a general set of statements that describe enhancers.

The position of an enhancer need not be fixed; it can be upstream, downstream, or within the gene it regulates. It is orientation independent and can act at large distances from the promoter.

Which of the below is not true about the location of enhancers? The position of the enhancer has no effect on gene regulation. They can be found downstream of the promoter. They can be found 3' of the polyadenylation site. They can be found in introns. They can be found upstream of the transcription initiation site.

The position of the enhancer has no effect on gene regulation.

In what way is gene rearrangement related to gene regulation? Give an example.

The reshuffling of genes provides a way for certain gene segments to rearrange in order to produce new products or change their expression pattern. The relative positions of promoters and/or enhancers with respect to structural genes may influence transcription. In the production of immunoglobulins such gene reshuffling occurs.

You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful?

The single stranded overhangs must be complementary to one another and DNA ligase must be present to seal the fragments together.

You have cut DNA from a source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful?

The single stranded overhangs must be complementary to one another; DNA ligase must also be present to join the strands together.

What is the spliceosome?

The spliceosome is the RNA-protein complex that is responsible for intron-exon splicing in eukaryotes. Following the GU-AG rule, introns are excised and removed from mRNA and the exons are joined to form a mature mRNA molecule ready for translation. The spliceosome is made of five small nuclear ribonucleoproteins (snRNPs) which consists of proteins and one of five snRNAs (U1, U2, U4, U5 and U6) which together with over 100 proteins form the large biological machine used for splicing.

The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. Screening of genomic libraries of several other organisms reveals that all of them contain only one genomic clone -- pigs seem to be the exception to the rule here. What evolutionary events might have led to the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? How is this representative of a general type of occurrence in molecular genetic evolution?

There was likely a duplication of this gene in pigs. After duplication, the gene has diverged.Evolutionary divergence tends to follow gene duplications, as mutations in one gene are no longer selected against as strongly (the presence of a "back up" copy of the gene means the individual will generally have at least one functional copy of the gene product).

Antisense oligonucleotides are relatively short stretches (usually about 20 nucs long) that are likely to bind with sense RNAs in a given cell. Of what important might such a material have in human health?

They can be used in gene therapy. If there is a particular gene causing a disorder, the antisense oligonucs can bind to the responsible sense RNAs, disabling them and mitigating the effects of the gene.

Under what conditions does one expect a 1:1:1:1 phenotypic ratio among the offspring of a cross? What must be true about the parents? What must be true about the genes in question?

This occurs in a cross involving doubly heterozygous individuals crossed to fully recessive individuals. One parent is double heterozygote, other is fully recessive. The genes involved assort independently of each other.

Nutritional mutations can be defined as

Those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium.

When considering the binding of cAMP-CAP and RNA polymerase to the lac operon, both bind more efficiently than either singly. What term is applied to this increased efficiency of binding?

Transcription enhanced

List the following events in the pre-RNA processing of a one intron-two exon gene in correct sequence order: • Attachment of snRNP U1 to the 5' splice site • Transesterification reaction at the branch point adenine • Transcription of the DNA template into the pre-mRNA molecule • Recognition and binding the 3' AAUAAA sequence by specific protein factors • Cleavage at the poly(A) site • Addition of the 5' cap • Export to the cytoplasm • Addition of the poly(A) tail • Release of lariat structure • Splicing together of exons

Transcription of the DNA template into the pre-mRNA molecule Addition of the 5' cap Recognition and binding the 3' AAUAAA sequence by specific protein factors Cleavage at the poly(A) site Addition of the poly(A) tail Attachment of snRNP U1 to the 5' splice site Transesterification reaction at the branch point adenine Release of lariat structure Splicing together of exons Export to the cytoplasm

____________________act as intermediaries between ______________________________ and specific _____ sequences to modify chromatin structure and activate transcription.

Transcriptional activators,chromatin-remodeling complexes,DNA

Compare the transcriptome of an organism with the proteome. What is described by each? Which one will generally have more macromolecules, and why?

Transcriptome has all RNA transcripts, coding and non coding. Proteome only has the proteins that result from those transcripts. Some genes encode non-coding RNAs that are not translated into proteins.

One type of mutation involves the replacement of a purine with a purine, while another causes the replacement of a pyrimidine with a purine. What general terms are associated with these two mutational phenomena?

Transition (A,G) to purine, or pyrimidine (C,T) to pyrimidine

True or False. The process that determines the length of heteroduplex DNA on the chromatids is called branch migration.

True

State whether the following statement is true or false; then give your reasoning. The terminating "hairpin" loop occurs in the tryptophan operon when sufficient tryptophan is present.

True; the "hairpin" loops terminates transcription.

Monod discovered that if tryptophan is present in relatively high quantities in the growth medium, the enzymes necessary for its synthesis are repressed. How does this occur?

Tryptophan acts as a corepressor to activate the tryptophan repressor protein; it is also involved in an attenuation system, which causes the termination of transcription.

What two amino acids are encoded by a single codon?

Tryptophan and Methionine

In the late 1950s, Meselson and Stahl grew bacteria in a medium containing "heavy" nitrogen (^15N) and then transferred them to a medium containing (^14N). Which of the results in the above figure would be expected after one round of DNA replication in the presence of (^14N)? A. tube a B. tube b C. tube c D. tube d

Tube D

In what way do upstream activator sequences (UASs) regulatory sequences in yeast, differ from enhancers and silencers?

UASs only function upstream

In what way do upstream activator sequences (UASs), regulatory sequences in yeast, differ from enhancers and silencers?

UASs only function upstream.

Transcription of the sequence AATGCGGTC would result in:

UUACGCCAG

Name 2 methods that are used to produce mutations in a forward genetics approach

UV light, EMS

Name 2 methods that are used to produce mutations in a forward genetics approach.

UV light, EMS, nitrosoguanidine

Meselson-Stahl Experiment

Used isotope of nitrogen to change the weight of DNA N15 & N14, demonstrated that the semi-conservative model is the best description of replication.

How can the expression of a gene be drastiacally altered by the presence of comparatively small numbers of RNA molecules? What is the term for this class of gene regulation?

Using RNAi, one can systematically knock out the function of a gene. As a research tool, investigators introduced short synthetic double-stranded RNAi molecules into cells, which triggered an RNA degradation pathway which targets mRNA and causes inhibition.

The beta chain of adult hemoglobin is composed of 146 amino acids of a known sequence. In comparing the normal beta chain with the beta chain in sickle cell hemoglobin, what alteration is one likely to find? Valine instead of glutamic acid in the 6th position Glutamic acid replacing valine in the first position Extensive amino acid substitutions Trinucleotide repeats Frameshift substitutions

Valine instead of glutamic acid in the 6th position

Describe the use of DNA databases to characterize a cloned and sequenced gene whose function is unknown.

Various databases allow investigators access to a variety of comparison programs that search for regions of homology to other known sequences. When a homologous gene is identified, its function may already be known from work on another organism, thus providing hints about function. A particular DNA sequence can be "translated" into the sequence of a protein product, and that amino acid sequence can be compared with other proteins in databases such as SwissProt. BLAST searches allow researchers to search protein sequences for regions of homology in other proteins, which may indicate likely function.

Alternative RNA splicing is a method that apparently evolved for the production of many different polypeptides from the same pre-mRNA. Provide an example of alternative splicing.

Various splicing schemes occur in the CT/CGRP gene in different tissues. In thyroid tissue, only the first four exons remain, while in the brain, exons 5 and 6 are included, but not exon 4.

According to Hardy-Weinberg, if we know the frequency of each allele in the population, what can we predict?

We can predict what genotypes and phenotypes we should see in the population.

What inheritance is suggested by each description? Extensive pedigree analysis on a characteristic shows all of the following: • only males are affected. • affected fathers always pass the trait to sons.

Y-linked inheritance

The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans?

You could generate cDNA libraries and compare the transcribed regions of the genome.

What are zinc fingers, and why are they frequently encountered in descriptions of genetic regulation in eukaryotes?

Zinc fingers consist of amino acid sequences containing two cysteine and two histidine residues at repeating intervals. Interspersed cysteine and histidine residues covalently bind zinc atoms, folding the amino acids into loops (zinc fingers). They are one of the major groups of eukaryotic transcription factors. They were originally discovered in the Xenopus transcription factors TFIIA., and this structural motif has been identified in a variety of significant regulatory circumstances, including proto-oncogenes and developmental control genes in Drosophila.

Conditional mutations are more likely to result from which of the following alterations to the coding region of a gene. A. a mutation caused by a deletion B. a mutation caused by a base addition C. a mutation caused by a base addition or deletion D. a mutation caused by a tautomeric shift E. a mutation caused by X rays

a mutation caused by a tautomeric shift

In humans, the genetic basis for determining the sex "male" is accomplished by the presence of ________.

a portion of the Y chromosome

Given that the origin of replication is fixed in E. coli, what region signals the location of the origin? Give both the name of this region and a description of the sequences present.

a region called ori C which consists of about 250 base pairs characterized by repeating sequences of 9 and 13 bases (9mers and 13mers)

DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide? a) purine or pyrimidine nitrogen-containing bases b) phosphate c) a deoxyribose sugar d) DNA contains all of the above. e) a ribose sugar

a ribose sugar

PCR is

a technique for amplifying DNA sequences in vitro

Plasmids are important in biotechnology because they are

a vehicle for the insertion of foreign genes into bacteria

Neurospora crassa was one of the first eukaryotic microbes to be adopted by geneticists as a model organism. It is a haploid fungus (n = 7) found growing on dead vegetation. When an assexual spore germinates, it produces a tubular structure that extends rapidy by tip growth, and throws off multiple side branches. The result is a mass of branched threads called hyphae, which consitute a colony. a) Give two reasons why Neurospora crassa lends itself well to its use as a model organism. b) Two albino strains of Neurospora crassa were isolated. When either one was mated with wild type (pink), it produced ½ albino and ½ wild-type. What can you deduce about the mutations on each of the albino strains?

a) because it's asexual it does not need a partner to reproduce making it inexpensive to use. It grows quickly so reproduction can be studied as well as mutations without having to wait a long time for maturation of offspring b)wild types are heterozygous for the albino phenotype?

A new kind of tulip is produced that develops only purple or pink flowers. Assume that flower color is controlled by a single-gene locus, and that the purple allele (C) is dominant to the pink allele (c). A random sample of 1000 tulips from a large cultivated field yields 847 purple flowers, and 153 pink flowers. a.Determine the frequency of the purple and pink alleles in this field population. b.Estimate the proportion of all purple flowering plants that are heterozygotes and homozygotes.

a) freq of pink allele = q^2 = 153/1000 sq rt of 0.153 = 0.39 = q p = 1- q so 1- 0.39 = 0.61 0.39 is the frequency of c and 0.61 is the frequency of C b) 2(0.61)(0.39)=0.476 (1000) Cc = 476 individualsCc 847-476 = 371 = CC OR 0.61^2 = 0.371 = 371 (1000) individuals CC

Indicate the level of activity of the lac operon under the medium conditions listed below: a) No lactose present, no glucose present b) Lactose present, no glucose present c) No lactose present, glucose present d) Lactose present, glucose present For a-d, enter either "high" or "off", separated by commas.

a) off b) high c) off d) off

In corn, small pollen (sp) is recessive to normal pollen (sp+) and banded necrotic tissue, called zebra necrotic (zn), is recessive to normal tissue (zn+). The genes that produce these phenotypes are closely linked on chromosome 10. If no crossing over occurs between these two loci, give the types of progeny expected from the following crosses:

a)1/2 sp+ sp zn+ zn 1/2 spsp znzn b)1/2 spsp+znzn 1/2 spsp zn+zn c) 1/4 sp+sp+zn+sn+ 1/2spsp+znzn+ 1/4 spsp znzn d) 1/4 sp+sp+znzn 1/2 sp+sp znzn+ 1/4 spsp zn+zn+

A typical prokaryotic genome has a. 1 million base pairs of DNA, containing 1000 genes. b. 1 million base pairs of DNA, containing a few hundred genes. c. 1000 base pairs of DNA, containing a few hundred genes. d. 1000 base pairs of DNA, containing a few thousand genes.

a. 1 million base pairs of DNA, containing 1000 genes.

Two gene loci, A and B, are unlinked (and thus assort independently), and alleles A and B are dominant over alleles a and b. Indicate the probabilities of producing the following. a. An AB gamete from an AaBb individual? b. An AB gamete from an AABb individual? c. An AABB zygote from a cross AaBb × AaBb? d. An AaBb zygote from a cross AaBb × AABB? e. An Aabb zygote from a cross AaBb × AAbb? f. An AB phenotype from a cross AaBb × AaBb? g. An AB phenotype from a cross aabb × AABB? h. An aB phenotype from a cross AaBb × AaBB?

a. 1/4 b. 1/2 c. 1/16 d. 1/4 e. 1/4 f. 9/16 g. 100% h. 1/4

Which of these sequences could form a hairpin? a. 5′ GGGGTTTTCCCC 3′ b. 5′ AAAAAAAAAAAA 3′ c. 5′ ACACACACACAC 3′ d. 5′ TTTTTTCCCCCC 3′

a. 5′ GGGGTTTTCCCC 3′

Of the DNA sequences below, which would probably be harder to determine? a. CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA

a. CGATATATATATATATACGAT

Assume that you have a garden and some pea plants have solid leaves and others have striped leaves. You conduct a series of crosses (a through e) and obtain the results given in the table. CROSS PROGENY solid striped (a) solid X striped 55 60 (b) solid X solid 36 0 (c) striped X striped 0 65 (d) solid X solid 92 30 (e) solid X striped 44 0 Define gene symbols and give the possible genotypes of the parents of each cross. Some crosses may have more than one potential genotype.

a. Gene symbol: A & Solid b. Gene symbol :B & Solid c. Gene symbol : C & Stripped d. Gene symbol: D & Solid e. Gene symbol: E & Solid

A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons. a. OH, 2', 3' b. methyl, 2', 3' c. carboxyl, 5', 3' d. OH, 2', 5' e. None of these are correct.

a. OH, 2', 3'

In snapdragons, the allele for red flowers is incompletely dominant over the allele for white flowers, and thus heterozygotes have pink flowers. What ratios of snapdragon flower colors would you expect to see among progeny generated from the following crosses? a. red x white b. red x pink c. white x pink d. white x white e. pink x pink f. red x red

a. all pink b. 1/2 red, 1/2 pink c. 1/2 pink, 1/2 white d. all white e. 1/4 red, 1/2 pink, 1/4 white f. all red

Match each term with the best letter choice: in situ hybridization a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

a. chromosome spread

For a physical map of a chromosome, distances are measured in units of

base pairs

Which of the following are general categories of mutations? behavioral conditional lethal protein DNA

behavioral conditional lethal

Two autosomal genes in Drosophila code for eye color and wing shape (the wild type is dominant). The genetic symbols for these traits are for eyes: pr: purple and pr+: red and for wings vg: vestigal and vg+: normal. a) What are the genotypes of a pure-breeding purple vestigial fly and a purebred red normal fly? b) What do we get if we cross these two pure-breeding lines? Give the genotype and the phenotype. c) What would you expect if you test-cross these F1's? d) Which alleles are from the test-cross individual? e) The results that Morgan got were not what you would expect. Instead, he saw fewer of the purple normal (pr pr vg+ vg ) and red vestigial (pr+ pr vg vg). What do these results tell us about the gametes produced by the original heterozygote? f) How did Morgan explain these results?

a.) prpr vgvg and pr+pr+ vg+vg+ b.) genotype: pr+pr vg+vg phenotype: red normal c.) equal distribution of all 4 phenotypes d.) prpr vgvg (recessive) e.) The gametes produced by the original heterozygote did not have genes that assorted completely independently f.) Morgan proposed that the unusual ratios were a result of linkage and that the genes for eye color and wing shape must be on the same chromosome and usually inherited together.

Two crosses were done to map genes in the dipteran Drosophila melanogaster. Cross 1: Females homozygous for the recessive mutant characters a, b, and c were crossed with wild-type males from a pure-breeding stock. A testcross was then done by taking the F1 females (all wild-type in appearance) and crossing the with triple mutant males (a, b, c) taken from a pure-breeding stock. The following offspring were counted: Phenotype Number a, b, c 280 a + + 77 b + + 23 c + + 125 a, b + 127 a, c + 25 b, c + 75 wild-type 268 1000 Cross 2: A second cross was done, this time involving the same gene c, as in Cross 1, and a new mutant gene d. Females of phenotype "c" were taken from a pure-breeding line and crossed with males of phenotype "d" from another pure-breeding line. In the F1, the females were all wild-type in appearance, while the males were all of the "c" phenotype. The F1 males and females were crossed together to give F2 offspring. The F2 phenotypes occurred in the following numbers: Males: wild-type, 4; c d, 6; c, 43; d, 47. Females: wild-type, 48; c, 52. (a) Using the information from both of the crosses, map these genes. Calculate recombination frequencies and give map distances. Calculate the interference. (b) Give the genotypes, as chromosome diagrams, for the parents and the F1 flies in both crosses, and for the F2 flies in Cross 2.

b is in the middle NCO (abc, +++) = 54.8% DCO (ab+, +b+) = 4.8% SCO (++c, ab+) = 25.2% SCO (a++, +bc) = 15.2% distance (a-b) = 15.2+4.8 = 20 mu distance (b-c) = 25.2+4.8= 30 mu

Which one of the following statements regarding eukaryotic transcriptions is not true? a) Chromatin remodeling is necessary before certain genes are transcribed. b) A group of genes is transcribed into a polycistronic RNA. c) Eukaryotic transcription involves a core promoter and a regulatory promoter. d) There is no one generic promoter.

b) A group of genes is transcribed into a polycistronic RNA.

Translation is directly dependent on all of the following associations except _______. a) complementary base pairing between mRNA and tRNA b) complementary base pairing between mRNA and DNA c) complementary base pairing between mRNA and rRNA d) association of the 30S and the 50S ribosomal subunits

b) complementary base pairing between mRNA and DNA

Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.

b, c, e

Splicing of eukaryotic pre-mRNA involves ___ reactions and occurs in the ___ . a. methylation b. transesterification c. polyadenylation d. nucleus e. cytoplasm

b,d

Which of the following sequences, if paired with its complementary strand, would be a palindrome? 5' CCCCCC 3' 5' CCCGGG 3' 5' CTGCTG 3' 5' TCCCCT 3'

b. 5' CCCGGG 3'

You are producing a heteropolymer of synthetic mRNA using a 1C:5G ratio. In this synthetic mRNA, what is the proportion of codons with 2Gs and 1C? 25|216 75|216 1|216 125|216

b. 75|216

in the DNA double helix, the number of hydrogen bonds between the participating bases is always constant A purine always pairs with a pyrimidine Disulfide bridges are formed between the two DNA strands A pair with G, and T pairs with C None of the above

b. A purine always pairs with a pyrimidine

What is the function of cAMP in regulation of the lac operon? It activates a repressor protein It activates an activator protein It inactivates a repressor protein It inactivates an activator protein

b. It activates an activator protein

Genes can be located in which organelles? a. Ribosome b. Nucleus c. Golgi d. Chloroplast e. Vacuole f. mitochondria

b. Nucleus d. Chloroplast f. mitochondria

Which of the sequences could form a hairpin? ATTAGGCCCTACCGCCAATTTT TTACGGCGGTTCCGCCCGGTG GCCGCCGCCGCCCCATTATTATTAT TTCAATAATCHCTAATAACTGA ATTATTTCGRACCCCAATTTT

b. TTACGGCGGTTCCGCCCGGTG

The genetic code is said to be triplet, meaning that There are three amino acids per base in mRNA There are three bases in mRNA that code for an amino acid There may be three ways in which an amino acid may terminate a chain There are three "nonsense" triplets None of the answers

b. There are three bases in mRNA that code for an amino acid

The role of tRNA is: To serve as an intermediate in the decoding of genes To act as transporters bringing amino acids to the site of protein synthesis To serve as general translational components of the ribosome To facilitate splicing of pre-messanger RNAs

b. To act as transporters bringing amino acids to the site of protein synthesis

A principle problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that a. Prokaryotes use a different genetic code from that of eukaryotes b. Bacteria cannot remove eukaryotic introns d. Bacterial RNA polymerase cannot make RNA complementary to mammalian DNA e. Bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA

b. bacteria cannot remove eukaryotic introns

A bacterial polycistronic transcription unit is one that a. contains information for one protein product. b. contains information for more than one protein product. c. is capped at the 5'end and carries a poly-A tail at the 3'end. d. is void of start (AUG) and termination (UAA, UGA, UAG) triplets. e. none of these answers

b. contains information for more than one protein product.

A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that

bacteria cannot remove eukaryotic introns.

Until about 1970, mitotic chromosomes viewed under the microscope could be distinguished only by their size, positions of centromeres, and "satellites" in some cases. However, various staining techniques have allowed a different view of chromosomes because they allow the visualization of ________.

bands similar to those of polytene chromosomes

The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___. a. mRNA stability b. translation c. intron splicing d. protein stability

c, d

The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___. a. mRNA stability b. translation c. intron splicing d. protein stability

c,d

The secondary structure of a protein includes the following elements? Gamma and delta Alpha and gamma A-helix and B-pleated sheet Hydrophobic clusters Disulfide bridges

c. A-helix and B-pleated sheet

Which term most appropriately refers to a regulatory protein in prokaryotes? Translation RNA processing DNA binding protein Gyrase action Helicase activation

c. DNA binding protein

Two modular elements that appear as consensus sequences upstream from RNA polymerase II transcription start sites are microsatelites and transposons rDNA and nucleolar organizers TATA and CAAT TTAA and CCTT Enhancers and telomeres

c. TATA and CAAT

Plasmids are important in biotechnology because they are a. surfaces for respiratory processes in bacteria. b. surfaces for protein synthesis in eukaryotic recombinants. c. a vehicle for the insertion of foreign genes into bacteria. d.recognition sites on recombinant DNA strands.

c. a vehicle for the insertion of foreign genes into bacteria.

Match each term with the best letter choice: cloning vector a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

c. plasmid

One of the post-translational modification of a protein includes Removal of introns Shuffling of exons Removal or modification of terminal amino acids Removal of exons self-splicing

c. removal or modification of terminal amino acids

What are three key differences between a genomic and a cDNA library?

cDNA lib. represents only transcribed regions of the genome; all genes equally represented in genomic library while cDNA library reflects the level of expression of a gene in a particular cell type or tissue ; cDNA library contained only sequences found in the mature mRNA - introns are removed

Eukaryotic chromosomes contain two general domains that relate to the degree of condensation. These two regions are

called heterochromatin and euchromatin.

Proteins that affect chromatin structure without altering histone chemical structure are called _______________.

chromatin-remodeling complex

The Human Genome Project, which got under way in 1990, is an international effort to

construct a physical map of the 3.3 billions of base pairs in the human genome

Heterochromatin is characterized by all of the following, EXCEPT that it a) contains genes that require high levels of transcription. b) is present on most of the Y chromosome. c) remains highly condensed throughout the cell cycle. d) is present all over the inactive X chromosomes in mammals. e) is present at centromeres and telomeres.

contains genes that require high levels of transcription.

A bacterial polycistronic transcription unit is one that

contains information for more than one protein product.

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________.

contig

Restriction endonucleases... a. are used to randomly digest DNA molecules. b. are human enzymes. c. are all genetically engineered. d. cut DNA at specific sequences

d. cut DNA at specific sequences

A bacterial protein is encoded by the following mRNA sequence:5'-AUGGUGCUCAUGCCCTAA-3'. The second methionine codon (AUG) in this mRNA sequence will: serve as the initiation codon. encode N-formylmethionine. encode methionine that will eventually be removed. encode unformylated methionine.

d. encode unformylated methionine.

The set of all proteins encoded by the genome is called the _______ . a. genome b. transcriptome c. metabolome d. proteome e. pharmacogenome f. glycome

d. proteome

Structures located at the ends of eukaryotic chromosomes are called Centromeres Telomerases Recessive mutations Telomeres Permissive mutations

d. telomeres

The antiparallel nature of DNA refers to: Its charged phosphate groups The pairing of bases on one strand with bases on the other strand The formation of hydrogen bonds between bases from opposite strands the opposite direction of the two strands of nucleotides

d. the opposite direction of the two strands of nucleotides

A classic example of selection in natural populations involves the peppered moth Biston betularia in England. Industrial gases killed the lichens and mosses on buildings, trees, etc., and soot deposited on the landscape. Dark-colored moths gained a selective advantage. In this case, one would say that there was selection against the light-colored moths. Which morph, light or dark, would have the highest fitness? (Enter light or dark in the box below.)

dark

lagging strand

daughter strand elongates away from replication fork made in segments multiple primers needed

leading strand

daughter strand elongates toward replication fork made continuously only one primer needed

Mutations in the promoter region of the b-globin gene indicate that some areas are more sensitive than others. When mutations occur in consensus sequences (modular elements such as GC box, CAAT box, TATA box) transcription ________________.

decreases

Where does transcription occur?

nucleus

Mutations in the promoter region of the β-globin gene indicate that some areas are more sensitive than others. When mutations occur in consensus sequences (modular elements such as GC box, CAAT box, TATA box), transcription usually ________.

decreases

Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon?

differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.

The process by which excessive numbers of a sex chromosome are corrected, often by methylating the X chromosome to form a Barr body.

dosage compensation

Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes?

double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C+ T) = 1.0

One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that

each vector can take up only a relatively small fraction of the eukaryotic DNA.

Regulation of gene expression using siRNAs is found in

eukaryotes only

That some organisms contain much larger amounts of DNA than are apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in

eukaryotes than in prokaryotes.

Any change in a population from Hardy-Weinberg equilibrium can be defined as ______.

evolution

τ subunit

facilitates dimerization between 2 core polymerase

Which cluster of terms accurately reflects the nature of DNA replication in prokaryotes?

fixed point of initiation, bidirectional, semiconservative

A class of mutations that results in multiple contiguous (side-by-side) amino acid changes in proteins is probably caused by the following type of mutation:

frameshift

A class of mutations that results in multiple contiguous amino acid changes in proteins is likely to be the following:

frameshift

A class of mutations which results in multiple contiguous amino acid changes in proteins is likely to be the following

frameshift

Match each term with the best letter choice: real-time PCR a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

g. DNA quantification

Which of these are major structural classifications of DNA-binding domains that are found in eukaryotic transcription factors? promoters leucine zipper helix-turn-helix zinc finger coil-coil

helix-turn-helix leucine zipper zinc finger

Because of the mechanism of sex determination, males of many species can be neither homozygous nor heterozygous. Such males are said to be:

hemizygous

Males with X-linked gene are said to be _____ for these X-linked genes.

hemizygous

A highly-methylated region of a chromosome that has become largely deactivated and can be seen as dense-regions when viewed using electron microscopy.

heterochromatin

You are trying to develop a new species of newt as an experimental model system. You know that in other species of newt, green (G) is dominant to brown (g) skin color and is determined by a sex-linked gene. You cross brown males to green females and see that in the F1 all the males are green and all the females are brown. Which is the heterogametic sex in your species of newt?

heterogametic sex would be the female because the father is passing the receive allele on and the mother is not passing on the same allele (like the y chromosome in males)

Codominant alleles are expressed in individuals that are __________________________.

heterozygous

DNA may be damaged from the by-products of normal cellular aerobic respiration. Name three of these electrophilic oxidants that are generally classified as reactive oxidants.

hydrogen peroxide (H2O2) hydroxyl radicals (·OH) superoxides (O2·-)

define polymorphism

if there is more than one form of a gene or trait in a population

In the formation of nucleosomes, one histone class, H1, is not directly involved, yet it does associate with DNA to form higher level chromosomal structures. Where does this histone (H1) associate?

in the spaces between nucleosome/DNA complexes

What is the term given to a measure of the loss of fitness caused by inbreeding?

inbreeding depression

In a chi-square test, as the value of the (chi)^2 increases, the likelihood of rejecting the null hypothesis _____.

increases

When siRNAs or miRNAs are present, the rate of mRNA degradation_____________ , and the rate of protein production ___________.

increases, decreases

To be certain that the extract prepared from virulent cells still contained the transforming principle that was present prior to lysis, Avery _______.

incubated nonvirulent cells with the complete extract

According to Mendel's postulate of _____, all possible combinations of gametes will be formed in equal frequency.

independent assortment

Which of the following are general categories of mutations? regulatory protein-altering morphological induced DNA

induced, morphological, regulatory

Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC series of plasmids?

insert of DNA in polylinker inactivates lacZ component and allows identification of recomb plasmids under proper genetic and environmental conditions

A Mendelian population is defined by individuals

interbreeding

One major difference between prokaryotic and eukaryotic genes is that eukaryotic genes can contain internal sequences, called ________, that get removed in the mature message.

introns

Which of the following two terms relates most closely to split genes?

introns, exons

What is the purpose of a cDNA library?

it can be used for research, sequencing, or commercial purposes. "the complete set of plasmid containing cell clones".

One of the Hardy-Weinberg assumptions states that the population is infinitely large. What influence might small populations have on a Hardy-Weinberg equilibrium?

it will increase the chances of sampling errors resulting in fluctuations in gene frequencies

Match each term with the best letter choice: transgene a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. Foreign DNA k. mRNA l. Agrobacterium tumefaciens

j. foreign DNA

A photograph of a chromosome squash is called...

karyotype

A photograph of a chromosome squash is called....

karyotype

Constitutive mutations may occur in various components of the lac operon. Name two genes of the lac operon in which constitutive mutations could occur.

lac Oc and lac I-

What symbols are used to describe constitutive mutations in the lac operon?

lacOc

This new strand of DNA has its 3' end oriented in the opposite direction as that in which the replication fork travels.

lagging strand

Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.

less

What medical procedures are applied to reduce or avoid potential neurological damage caused by phenylketonuria (PKU)?

limit foods with phenylalanine

When two genes fail to assort independently, the term normally applied is:

linkage

Often, a mutation in a gene results in a reduction of the product of that gene. The term given for this type of mutation is:

loss-of-function or null (in the case of complete loss)

What are the genetic consequences of inbreeding?

lower genetic variance and subsequently increased risk of undesirable genes. it also increases the proportion of homozygotes

When propagating a clone in the lambda phage, would you have more immediate success if the phage entered the lysogenic or the lytic cycle?

lytic cycle

Attenuation involves the termination of ______ synthesis

mRNA

Which of the following statements best describes the messenger RNA?

mRNA is the only type of RNA that carries DNA's protein building instructions

The relationship between a gene and a messenger RNA is that

mRNAs are made from genes.

A short segment of an mRNA molecule is shown below. The polypeptide it codes for is also shown: 5'-AUGGUGCUGAAG : methionine-valine-leucine-lysine Assume that a mutation in the DNA occurs so that the fourth base (counting from the 5' end) of the messenger RNA now reads A rather than G. What sequence of amino acids will the mRNA now code for? (You do not need a copy of the genetic code to answer the question.)

methionine-methionine-leucine-lysine

List 2 types of small RNA molecules involved in gene regulation.

miRNA; siRNA

How are miRNAs produced? How do miRNAs function to affect production of proteins? Provide sufficient detail in your answer for full credit.

miRNAs are small RNA molecules transcribed from within an organism's genome. They are further processed after transcription by Dicer protein into small dsRNA molecules. These small ds molecules are targeted into RISC proteins where they are unwound into single stranded RNAs. These ss RNAs are then able to inhibit translation from mRNAs in a number of ways including inhibition of translation, targeting mRNAs for degradation, or sequestration of mRNAs.

Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labeled to identify levels of expression)

microarray

Match each number with the closest type of DNA: a. moderately repetitive DNA b. highly repetitive DNA c. short interspersed elements d. long interspersed elements e. unique-sequence DNA

moderately repetitive DNA rRNA, tRNA highly repetitive DNA telomeres short interspersed elements long interspersed elements unique-sequence DNA gene-encoding sequence

A gene or a trait is said to be polymorphic if:

more than one form exists in the population

Male mammals inherit an X chromosome from which of their parents? Their _______

mother

A situation where there are more than two alternative forms of a given gene would be called ________.

multiple alleles

multiple cloning site

frameshift mutation

mutation that shifts the "reading" frame of the genetic message by inserting or deleting a nucleotide

Mutation and migration introduce new alleles into populations. What is the principal force that shifts allelic frequencies within large populations?

natural selection

Under a system of ______________, genetic expression occurs unless such expression is shut off by some form of regulator.

negative control

Choose the type of control illustrated by each example: E. coli lac operon control by lac I

negative inducible*

An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule.

negative repressible

Assume that four polygenic gene pairs are involved in determining phenotypes of F2. How many phenotypic classes are expected?

nine n=4, so 2n+1=9

Which of the following evolutionary forces does NOT change allele frequencies?

nonrandom mating

A _________ mutation changes a codon that specifies an amino acid into one that terminates translation.

nonsense

A constitutive gene is _______ regulated and is expressed ____________.

not, continually

To establish that evolution by natural selection is operating in a population, one must demonstrate variability for a trait, heritability of that trait, differential reproductive success based on that trait, and:

nothing else

One of the strongest lines of evidence that specialized cells of an adult carry all the genetic information for an entire adult organism comes from what types of experiments?

nuclear transplantation experiments

In order to be functional, a chromosome requires all of the following except:

nucleomeres

What is the name of the precursor molecule used in nucleic acid synthesis (do not give an abbreviation)?

nucleoside triphosphate

Regarding the structure of DNA, the covalently arranged combination of a deoxyribose and a nitrogenous base would be called a

nucleoside.

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA?

nucleus

Three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes occur in which cellular organelle?

nucleus

operons

Given that the origin of replication is fixed in E. coli, what region signals the location of the origin? Give both the name of this region and a description of the sequences present

oriC- region of 250 base pairs that has repeating sequences of 9 and 13 bases, called 9mers and 13mers

List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each.

origin of replication for propagation in the host; selectable marker like Amp resistance; polylinker or unique restriction enzyme sites to facilitate cloning

Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called _______________ .

orthologs

In a population in Hardy-Weinberg equilibrium, what will be the proportion of matings between homozygotes?

p4 + q4 + 2p2q2

Assume that a trait is caused by the homozygous (or hemizygous) state of a gene that is recessive and X-linked. Nine percent of the females in a given population express the phenotype caused by this gene. What percentage of males would be expected to express this trait? (Enter only a number in the box below.) What percentage of the females would be heterozygous for the gene? (Enter only a number in the box below.)

p^2 = 0.09 sqrt 0.09 = .3 (b/c males only need one recessive allele this would be the percentage of males) p=0.3 q = 1- 0.3 = 0.7 (A) 2(0.3)(0.7) = 0.42

In a population of 10,000 individuals, where 3600 are MM, 1600 are NN, and 4800 are MN, what are the frequencies of the M alleles and N alleles?

p^2 = 3600/10000 = 0.36 sqrt = 0.6M=p 1-0.6=0.4=q=N

Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such words?

palindromic

Choose the answer that lists--in order of appearance--all the cell types expected to be formed during spermatogenesis. spermatogonia, primary spermatocyte, secondary spermatocyte, spermatid, spermatozoa spermatogonia, spermatozoa, primary spermatocyte, spermatid, secondary spermatocyte, spermatozoa, primary spermatocyte, spermatogonia, secondary spermatocyte, spermatid spermatogonia, secondary spermatocyte, primary spermatocyte, spermatid, spermatozoa

permatogonia, primary spermatocyte, secondary spermatocyte, spermatid, spermatozoa

A conditional mutation is one that allows a mutant gene product to function normally under the ________ condition, but to function abnormally under the ________ condition. Such mutations are especially useful for the study of ________ mutations.

permissive; restrictive; lethal

The bonds that connect nucleotides in the backbone of a DNA strand are called ______bonds.

phosphodiester

Hershey and chase labeled DNA using this radioactive atom.

phosphorus

The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacteriophages made use of the following labeled components:

phosphorus and sulfur

A map of the distribution of cloned genomic DNA from genomic clone libraries.

physical map

A map of the order, overlap, and orientation of physically isolated pieces of the genome.

physical map

___________ are those genes that are involved in determining continuously varying or multiple-factor traits.

polygenes

DNA Polymerase I

removes the RNA primer and replaces it with DNA

In the early part of this century, Nilsson-Ehle, East, and others described experiments showing that multiple loci may be involved in the inheritance of certain traits. Such patterns are often called ________.

polygenic traits

Which of the following is not a component within a single nucleotide of a nucleic acid? nitrogenous base phosphate sugar polymerase

polymerase

What enzyme is exploited to produce synthetic mRNAs?

polynucleotide phosphorylase

If Avery had observed transformation using only the extracts containing degraded DNA, degraded RNA, and degraded protein, but NOT the extract containing degraded polysaccharides, he would have concluded that _______.

polysaccharides are the genetic material

The ribosome is the primary site of:

protein synthesis

What is the function of the lacY gene in the lactose operon?

protein that facilitate the passage of lactose

The set of all proteins encoded by the genome is called the _______

proteome

The set of all proteins encoded by the genome is called the _______ .

proteome

Chromosomal regions that represent evolutionary vestiges of duplicated copies of genes that have underdone sufficient mutations to render them untranscribable are called ________.

pseudogenes

Apurinic (and apyrimidinic) sites (AP sites) involve a spontaneous loss of ______________ in an intact double-helix DNA molecule

purines

hardy weinberg equation

p² + 2pq + q² = 1 calculating frequencies of alleles in a gene pool if we know frequencies of genotypes. -p: freq of allele A -q: freq of allele a -p²: freq of AA -pq + qp = 2pq=freq Aa -q²: freq of aa -p² + 2pq + q² = 1 -p=1-q and q=1-p

What introns require a cofactor?

rRNA introns Group I introns

Mendel's law of independent assortment has its physical basis in the:

random arrangement of chromosomes on the metaphase plate in meiosis I.

panmixis

random mating in a population

Recombinational repair is activated when damaged DNA has escaped repair and the distortion disrupts the process of replication; which is dependent on the product of the ________ gene.

recA

Referring to the genetic code, what is meant by "wobble"?

relaxed pairing specificities in the third-base position of a codon

Frameshift mutations are caused by the __________ or __________ of one or more nucleotides in DNA. a. chemical modification b. removal c. reversion d. insertion e. suppression

removal and insertion

What is the name of the process by which bacterial colonies (cells) are transferred from one agar plate to another, maintaining the same spatial pattern

replica plating

What is the name of the process by which bacterial colonies (cells) are transferred from one agar plate to another, maintaining the same spatial pattern?

replica plating

The complex of proteins that is involved in the replication of DNA is called a(n) ________.

replisome

The general term for a non-polymerase protein that binds to an operator.

repressor

An example of a gene product encoded by a regulatory gene is

repressor protein

The __________ is a type of _________ protein that binds to a region of DNA in the promoter of a gene called the _________ and prevents transcription from taking place in bacteria.

repressor,regulator,operator*

What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?

restriction endonucleases restrict or prevent viral infection by degrading the invading nucleic acid of the virus

Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? DNA polymerase restriction enzymes specific for the target genes DNA ligase Both B and C

restriction enzymes specific for the target genes and DNA ligase (Both B and C)

Which of the following enzymes is used to make complementary DNA (cDNA) from RNA?

reverse transcriptase

mRNAs are degraded by enzymes called ____________.

ribonucleases

Uridine contains ____ as sugar.

ribose

The differential reproduction of genotypes, resulting from their variable fitness is called

selection

Which is more significant in changing gene frequencies: selection against a dominant gene or selection against a recessive gene?

selection against a dominant gene

A gene which specifies the fate of a particular anatomical segment in Drosophila is called a ____

selector gene

Which of the following terms accurately describes the replication of DNA in vivo? nonlinear conservative semiconservative nonreciprocal dispersive

semiconservative

Over the years, sophisticated plasmid vectors have been developed for use in recombinant DNA technology. Describe the useful features that have been introduced in these vectors.

small size to allow large inserts high copy number large numbers of unique restriction sites (polylinkers) variety of selection schemes (pigmented colonies, antibiotic resistance)

In general, a "model organism" used in genetics studies is one in which there is a large body of genetic knowledge that has been compiled over decades of genetic research. In addition, model organisms have available their DNA sequences and collections of ________ that make detailed genetic analysis possible and efficient.

strains with specific mutations

Template Strand of DNA

strand that is "read" by the RNA polymerase

Significant in the deciphering of the genetic code was the discovery of the enzyme polynucleotide phosphorylase. What was this enzyme used for?

the manufacture of synthetic RNA for cell-free systems

Provide a simple definition of inbreeding.

the mating of closely related individuals

This question relates to the regulation of enzymes involved in the synthesis of tryptophan in E. coli. If tryptophan is present in the medium and available to the bacterium,

the repressor is bound to the operator, thus blocking transcription.

Interpret the meaning of an H2 value (broad-sense heritability) that approaches 1.0.

the variance due to genetic factors is almost the same as the sum of the variances

Insulators can block the effects of enhancers only when

they lie between an enhancer and a promoter.

A base at the first position of an anticodon on the tRNA would pair with a base at the ___ position of the mRNA.

third

In what way might one use heat-shock genes in Drosophila to facilitate the use of RNAi as a research tool?

to reduce gene activity

DNA polymerase III adds nucleotides

to the 3' end of the RNA primer.

Genetic regulation in eukaryotes can take place at a variety of levels from transcriptional to post-translational. At what level is genetic regulation considered most likely in prokaryotes?

transcriptional

Which of these is a level of regulation in eukaryotes? Select all that apply processing transport post-translational operon transcriptional

transcriptional processing transport post-translational

The ___________ operon is typically characterized by the following two terms: negative control and repressible.

tryptophan

The following may be caused by mobile genetic elements except ________________

undergo mutation

What is the Ames test, and how does it work?

used to quickly screen chemicals for their ability to be mutagenic (and hence potentially carcinogenic); uses liver enzymes/extract along with a possible mutagen to see if a high number of reservants form to suggest the mutagen caused the mutation

variable genetic background, internal physiological environment, external environment

The white-eye gene in Drosophila is recessive and sex linked. Assume that a white-eyed female is mated to a wild-type male. What would be the phenotypes of the offspring? Explain your answer

wild type females and white eyed males Females receive 2 copies of X chrom, 1 from white-eyed mom and 1 from wild type dad. White eyes are recessive, so the trait is masked. Males receive Y chrom from dad and Xrecessive from mom, so their white-eyed phenotype is shown.

Ver todos los conjuntos de estudio

MolGen Final

Conjuntos de estudio relacionados

Dwelling Policy Practice Questions

50 - Cerebellum and Motor Activity

Ch. 6 Business Law

MARK 3000 CH 4 Test Bank

Econ Ch.19 Taxes

Understanding Psychology Chapter 8

PrepU- Exam 6

Prep U - Chapter 51: Assessment and Management of Patients with Diabetes

Ch. 16 Map exercises

C Law Ch. 12

Physics Unit 3 Exam - Ch. 30, 31, 32

HTN

practice acc 210 final

IS 560 Chapter 10 Quiz

Canada Location & Climate

Intermediate Exam 2

oncology

Psychology Chapter 13, Psychology Chapter 12, Psychology Chapter 11, Psychology Chapter 14

ThePoint Questions Chapter 14 Maternity and Pediatric Nursing

Psyc1010 Ch5