Objective Sheet 7
Describe why AMS radiocarbon dating is superior to C-14 dating
- A more refined technique know as the accelerator mass spectrometry (AMS) radiocarbon dating can be used to date a sample as small as 100 micrograms - this technique involves breaking the sample up into its constituent atoms so that the number of atoms of each isotope of carbon can be counted - using AMS it has become possible to date cave paintings accurately from tiny samples of pigments
Steps of Recombinant DNA (1)
- A specific gene is isolated and cut using restriction enzymes - A vector is also cut using restriction enzymes. - Vectors are sections of DNA able to replicate inside a host cell e.G plasmids (circular units of DNA) or phages (or bacteriophages, viruses that replicate inside bacteria) - The same restriction enzyme is used for both cuts
Repair of Injured tissue
- Adipose tissue (fat cells) can be cultured in vitro from bone marrow, source of multipotent adult stem cells - The adipose tissue can be used in reconstructive surgery to restore damage caused by congenital defects e.g. Cleft palate, from the removal of tumours or to repair tissue from the effects of traumatic injuries e.g. Burn victims
Comparative studies in Biochemistry - DNA (Genomic)(1)
- All living things have the same structure of DNA and use the same DNA code - The sequence of DNA varies between organisms - New genes are gained by mutation others are lost by natural selection/genetic drift
Endogenous Retroviruses (1)
- An ERV is a viral sequence that has become part of an organisms genome. - Retroviruses store genetic information as RNA (not DNA) and upon entering a cell the retrovirus will copy its RNA into the DNA of the host - reverse transcription. - A retrovirus is endogenous if its RNA is inserted into gametes - offspring of an infected individual will contain to ERV.
Cell Replacement Therapy
- Any disorder involving the loss of or injury to normal cells is a potential candidate for stem cell replacement therapy - Stem cell therapy for neurodegenerative disorders such as Parkinson's and Alzheimer's disease and multiple sclerosis has gained much interest. Parkinson's disease - Replace the dying neurons with healthy neuronal tissue. - The cloning and differentiation of stem cells is used to make specific cell type or tissue type in vitro
Vestigial Organs (2)
- Are evolutionary leftovers e.g. coccyx, - structures that no longer serve any purpose - are reduced in size to conserve energy over time due to natural selection (meaning different selection pressures have made them none functional) - provide evidence of change over time
Other tissue Regeneration
- Bone, cartilage tissue or even entire organs have the potential to be regenerated using stem cells - One of the issues is to create an extracellular scaffold for the tissue organ to grow 3 dimensionally - Chemicals that act as cell communicators are required to stimulate cell growth and differentiation
Purpose of DNA sequencing
- Can be used to show whether a person will develop an inherited disease - By comparing DNA sequences, changed alleles can be detected - Point mutations, small insertions or deletions are readily identified
Radiometric Dating (2)
- Carbon- 14 is an isotope of carbon, which decays to form the more stable product Nitrogen-14. - Radioisotopes emit radiation as they undergo decay and this can be measured and used to estimate the age of fossils and rock samples
Explain what comparative genomics involves and its use to evolutionary biologists
- Comparing genomes of species, to identify areas of similarities and differences, looks at evolutionary changes amongst organisms, as well as genes unique to organisms - All genomes consists of DNA, made much easier by human genome being sequenced in 2003. Scientists look at genome features preserved in a number of species over millions of years and begin to look at subtle differences between animal species. - Comparative genomics has revealed a high degree of similarity between closely related organisms such as humans and chimpanzees
Comparative protein studies
- Comparison of the amino acid sequence in particular proteins. - Proteins are a long chain of amino acids - They determine the sequence of amino acids Ubiquitous proteins appear to be in all species and carry out basic but essential tasks that are required for life. - The more recent a common ancestor with a species the less difference in amino acid sequences of Ubiquitous proteins are found
Describe how gene therapy can be used to treat genetic disorders - e.g. cystic fibrosis and diabetes (1)
- Cystic fibrosis is a single gene defect and the most common lethal genetic disorder - It was believed that treating it with gene therapy would be achievable - The gene for CF is known as the CFTR gene (cystic fibrosis trans-membrane regulator) - The gene controls movement of salt into and out of a cell - The defect affects several organs such as the lungs and pancreas through a build up of mucous
DNA Profiling Techniques
- DNA can be used to identify a person due to its unique nature (fingerprinting) - Restriction Enzymes are used to cut the DNA at specific sites producing pieces of different length - While most human DNA is identical, specific regions like those pieces produced above vary for different people. - These differences inherited from our parents can be analysed to give a DNA profile
Denaturing- PCR
- DNA is heated to 95°C to denature the strand. - Hydrogen bonds separated between two strands separating DNA into two strands - This process separates the double helix into separate strands - the template and coding strand
Chain Termination
- DNA polymerase will continue adding nucleotides to the chain until it happens to add a dideoxy nucleotide instead of a normal one. - At that point, no further nucleotides can be added, so the strand will end with the dideoxy nucleotide. - ddNTP's will eventually by incorporated onto every base on the template strand - The different length strands are then sorted based upon their size - which is done by gel electrophoresis
Problems with CF and Gene Therapy (1)
- Delivery vehicle or vector - Normal CF gene can be delivered by modified viruses or in vesicles - Depending on the vector used the viruses either are not easily taken into the target cells (lung epithelial cells) or can cause an immune response - Delivery of the gene into the cell's chromosomes also an issue
Sanger Method
- Dideoxy nucleotides are similar to regular, or deoxy nucleotides, but they lack a hydroxyl group on the 3' carbon of the sugar ring. - In a regular nucleotide, the 3' hydroxyl group acts as a "hook," allowing a new nucleotide to be added to an existing chain. - Once a dideoxy nucleotide has been added to the chain, there is no hydroxyl available and no further nucleotides can be added. - The chain ends with the dideoxy nucleotide, which is marked with a particular colour of dye depending on the base (A, T, C or G) that it carries
Tree Ring Dating (Dendrochronology)
- Each concentric ring on the surface of a tree indicates one year of growth - Certain rings are larger than others and indicate exceptional weather conditions are used as market rings - It is possible to analyse the marker rings of very old living trees and compare them with timber taken from ancient wooden structures to work out their age
Homologous Structures
- Features of organisms that have a fundamental similarity of structure - Example: Forelimb bones - Structures with a similar architecture eg: pentadactyl limb in vertebrates - Similar structures but different functions - Evidence of common ancestry
Comparative studies in Biochemistry - DNA (Mitochondrial) (1)
- Found in Mitochondria - Mitochondrial DNA is a ring of DNA containing 37 genes or 16 500 base pairs. - Most cells have between 500 and 1000 copies of the mtDNA molecule. - Only Inherited from the mother. - mtDNA has a higher rate of mutation than nuclear DNA meaning human mtDNA has been slowly diverging from the mtDNA of our original female ancestor. - The amount of mutation is roughly proportional to the time that has passed.
Problems with CF and Gene Therapy (2)
- Having the gene present does not always lead to gene expression. - If the gene does not become inserted into the cell's genome than it will only survive for a short period of time - This means the costly gene therapy will need to be re-administered - One other problem with the therapy is delivery of the normal CFTR gene to all of the cells of the lung surface
DNA profiling is used to
- Identify the probable origin of a body fluid sample associated with a crime or crime scene - Reveal family relationships (ancestry) - Identify disaster victims, for example, identify victims of the Thailand 2004 boxing day tsunami. - Identify genetic diseases quickly - Animal breeding pedigrees
Describe the differences between blunt' and 'sticky' ends.
- If it cuts the DNA straight across the DNA is said to have blunt ends (no overhanging bases) - If it cuts the DNA staggered, i.e So 1 strand overhangs it is said to have sticky ends. The exposed strand can rejoin to DNA with complimentary base pairs= - Restriction enzymes that make staggered cuts will cut DNA with specific sequences
Correlation of Rock Strata
- Involves matching rock layers (strata) from different locations - If the sequence of sedimentary rocks in different areas is similar it is likely that the rocks are of the same age
Limitations of potassium-argon technique
- K-Ar dating can be used to date rocks aged between 100 000- 200 000 years so the method cannot be used on younger or older rocks - There must be sufficient suitable rock available of the same age as the fossil to be dated. Eg: when a volcanic eruption buries bones
Comparative Embryology (2)
- Many vertebrate embryos are similar. - Many have features not present in adult e.g. gills, tail. - Common developmental pathway depends on closeness of relationship. - These provide evidence of common ancestry Closely related organisms are more similar in embryonic life - More distantly related organisms show more differences in embryonic life - All vertebrates have gill slits and tails in early embryonic development
Limitations of Superposition
- Movement of the earth's crust (such as those during earthquakes) may alter the rock layers and discount the principle of superposition. - Burial of fossils and artefacts by humans or scavengers may lead to recent specimens being found in older layers.
DNA Profiling (1)
- One of the current techniques for DNA profiling uses polymorphisms called short tandem repeats. (STRs) - Short tandem repeats are regions of non-coding DNA that contain repeats of the same nucleotide sequence. - For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times.
Polymerase Chain Reaction
- PCR is a technique widely used in molecular biology. - The polymerase chain reaction (PCR) is used for creating multiple copies of a specific section of DNA from a sample - Amplifies DNA - PCR is useful when only small amounts of DNA are available for analysis. - Useful before DNA sequencing because you need lots of DNA - Also useful at crime scenes when you have a small amount of DNA - 100 billion identical strands can be produced from a single DNA segment within a few hour
Radiometric Dating (1)
- Radiometric (or radioisotope) dating is an absolute dating method used to determine the age of a sample by measuring the proportions of an original radioactive material and decay product - Some elements have more than one atomic form (same atomic number but with different numbers of neutrons) - these are referred to as isotopes.
Recombinant DNA
- Recombinant DNA technology is the technology used in genetic engineering. - Recombinant DNA Is made by recombining fragments of DNA from different sources. - E.G. The DNA for the gene to make insulin is extracted from human cells and placed into yeast cells.
Limitations of Radiocarbon dating
- Requires at least 3 grams of organic matter to carry out this method - May only be used for organic fossils (containing carbon) of once lived organisms - Can only date samples up to 60 000 years old - Scientists base their calculations on the assumption that the ratio of carbon-12 to carbon-14 in the atmosphere of the earth has remained constant yet they now know that it has varied over time
How was the disorder located in the gene sequence
- Researchers studied two families whose members had the hereditary spastic paraplegia - Searched a segment of chromosome 2 and examined the DNA sequence of a number of genes - Located mutations in affected people but not in unaffected people - People can now be screened for the disorder before it becomes apparent because the gene mutations have been identified
DNA Profiling (2)
- STRs are found at different places or genetic loci in a person's DNA - One way to produce a DNA profile, is to examine STRs at 10 or more genetic loci. These genetic loci are usually on different chromosomes. - A DNA profile can tell if the DNA is from a man or woman, and if the sample being tested belongs to a particular person
Other examples of how DNA sequencing is used:
- Sickle cell anaemia - Cystic fibrosis - And some forms of cancer - To identify parentage when in dispute
Cell Replacement Therapy
- Stem cell trials in human has shown some success - Stem cells grew and established connections with adjacent neurons - However, the use of human embryonic stem cells is controversial and raises a number of ethical questions. - Other methods of treatment are currently being researched. - Induced pluripotent stems (IPS) cells could be used instead, reducing ethical issues and minimising the risk of immune rejection
Spray on Skin
- Stem cells are used to create spray on skin - These are skin cells that are sprayed on burn victims preventing the need for skin grafts - It also speeds up the time for skin cells to cover burns significantly reducing scarring
Vestigial Organs (1)
- Structures of reduced size that that appear to have no function but may have been important in previous ancestors. Examples in humans include: - Necessitating membrane - pinkish membrane found on inner eye, transparent third eyelid found in cats, birds, frogs and other vertebrates. - Muscles to move ears - Wisdom teeth - Pointed canine - Coccyx bone
Describe the potassium-argon technique of absolute dating
- The K-Ar method is based on the decay of radioactive potassium-40 (K-40) to form calcium-40 and argon-40 - K-40 is found in igneous rocks that have formed from volcanic lava that has cooled. Fossils found in layers above and below these rocks can then be dated - The amount of K-40 in a rock can be measured and using knowledge of the half life of K-40 the age of the rock can be calculated
Gene Probes (2)
- The cut DNA samples are placed in a solution with the gene probes. - If the altered sequence is present in a sample of a person's DNA, the probe will bind onto that piece of DNA, indicating the presence of the disease-causing gene. - Gene probes are used to detect: cystic fibrosis, some forms of haemophilia, muscular dystrophy, Huntington's disease, thalassaemia and tay-sachs disease
Comparative studies in Biochemistry - DNA (Mitochondrial) (2)
- The degree of similarity between the mtDNA of any two individuals provides an estimate of the closeness of their relationship through maternal ancestors. - mtDNA found to be of most value when comparing individuals within a species - been able to track migration routes of ancient peoples. - The closer the mDNA sequence between two organisms the closer the common ancestor
Primer Annealing
- The mixture is cooled to about 42°C. - Primers (short synthetic DNA fragments of 20 nucleotides) bind to each of the complimentary base sequences on the separated DNA strands. - More primers than DNA - The primers act as starting points for the replication of new DNA molecules. - Prevents the template strand and coding strand from recombining - Allows DNA polymerase to work - which joins new nucleotides together to form a new strand of DNA
Primer Annealing- PCR
- The mixture is cooled to about 50°C. (to slow down the movement of DNA and increase primer annealing) - Primers (short synthetic DNA fragments) bind to each of the complimentary base sequences on the separated DNA strands. - Primer is the starting point of DNA replication - If you don't have the primer you cant start a new strand
Primer Elongation- PCR
- The mixture is heated to about 72°C - Taq DNA polymerase attaches the nucleotides to the complementary DNA strands - Starting at the primer, the DNA polymerase reads the DNA code and builds a complementary strand of DNA, doubling the number of strands. - The 3 steps are repeated 30 times to obtain over 1 billion identical strands of DNA - Each cycle takes 3-5 minutes
Steps of Recombinant DNA (2)
- The plasmid and isolated gene are mixed in a solution - Another enzyme called DNA ligase is added. - This joins the sticky ends of the plasmid to the sticky ends of the isolated gene - The new molecule formed recombinant vector is inserted into a host cell. This could be a bacterium, fungus, plant or animal cell - When the host cell replicates, the plasmid replicates as well
Describe how gene therapy can be used to treat genetic disorders - e.g. cystic fibrosis and diabetes (2)
- The recombinant normal gene is inserted into a virus or into a lipid vesicle for delivery into the lungs - The virus infects your lungs (places the working gene into your lungs) - The lipid vesicle diffuses through phospholipid bilayer of lungs - The vectors are placed in large numbers into a nebuliser, which place the vectors into water droplets for delivery during inspiration
Restriction Enzymes
- These are enzymes that cut DNA across the double helix - These enzymes are found in bacteria they occur as a defence mechanisms that prevent viruses infecting bacteria - Restriction enzymes recognise specific arrangements of bases which are called recognition sites - Viruses that infect bacteria are called bacteriophages
Explain what bioinformatics is and its use to evolutionary biologists
- Use of computers to describe the molecular components of living things, used to look at evolution in organisms by analysing DNA changes in a large number of organisms rather than taxonomy (body structure) - We can now compare entire genomes, needs to be computerised as annotating (identifying genes) as the genome is so big, annotation is possible due to start and stop codons which are recognisable.
Endogenous Retroviruses (2)
- When comparing humans and chimpanzees - the same ERV's are located on the short arm of the chromosome 10, 6 and 1 and the long arm of chromosome 9. In total 16 human ERV's match exactly with chimpanzees. - Evidence that we share a common ancestor.
Gene Probes (1)
- When detecting genetic abnormalities using gene probes we cut the DNA into small fragments using restriction enzymes. - Gene probes are short sequences of DNA that have base sequences complementary to the gene change that is being tested for - The probe is labelled with a fluorescent marker or a radioactive isotope
Comparative studies in Biochemistry - DNA (Genomic) (2)
- When speciation occurs, the new species would have similar DNA to the ancestral species. Over time, the new species will gradually make changes to their DNA sequences. - Species that are distantly related have more differences in the DNA compared to two closely related species
Describe C-14 (radiocarbon) dating
- cosmic rays enter the earths atmosphere and collides with an atom creating an energetic neutron - Based on decay of C-14 to N-14. - One in every 1 trillion carbon atoms in the atmosphere is carbon-14 (others are C-12). - Living organisms absorb C-14 through photosynthesis (plants) or eating (animals). - When an organism dies, intake of C-14 ceases yet C-14 begins to decay at fixed rate. - by measuring the amount of radiation liberated by a sample the ratio of carbon 14 to carbon 12 can be estimated and from this the age of the sample can be calculated
List different forms of fossils.
- footprints - burrows - faeces or impressions of all or part of an animal or a plant - bones, shells or teeth
Use of recombinant DNA
- rDNA techniques have been used to artificially manufacture proteins such as - insulin, - growth hormone, - Clotting factor VIII, - FSH - It has also been used in the manufacture of vaccine - Gene therapy also uses rDNA
Denaturing/ Strand seperation
- separating the two strands of DNA - DNA is heated to 95°C to denature the strand. - This process separates the double helix into separate strands - the template and coding strand
DNA Sequencing
-DNA Sequencing: Working out the precise order of nucleotides in a sample of DNA - The Sanger Method: invented by Frederick Sanger - DNA is synthesised from four nucleotides (deoxynucleotide triphosphate) - Nucleotide - consists of 3 phosphate groups (shown as a P) joined to the sugar deoxyribose (5 Carbon) + a nitrogenous base (adenine or thymine or guanine or cytosine) - In a DNA sequence each nucleotide is bonded to the hydroxyl group (OH) of the previous nucleotide
4 Steps of DNA Sequencing
1. Denaturing/ Strand seperation 2. Primer Annealing 3. Primer Extension 4. Chain Termination
Identify radiocarbon (C-14) dating and potassium-argon dating as types of absolute dating.
Absolute dating actual chronological age in years Based on events that occur at a constant rate or is repeated at regular intervals Examples 1. Radiocarbon (C-14) dating 2. Potassium-argon dating 3. Dendrochronology (tree ring dating) 4. AMS radiocarbon dating
Outline how a DNA profile can be obtained using gel electrophoresis.
After the restriction enzymes cut the DNA at specific cites 1. After the reaction is done, the fragments are run through a gel matrix in a process called gel electrophoresis. 2. Short fragments move quickly through the pores of the gel, while long fragments move more slowly. 3. As each fragment crosses the "finish line" at the end of the tube, it's illuminated by a laser, allowing the attached dye to be detected. 4. The smallest fragment (ending just one nucleotide after the primer) crosses the finish line first, followed by the next-smallest fragment (ending two nucleotides after the primer), and so forth.
Distinguish between fossils and artefacts
An artefact is an object that has been deliberately made by humans eg: stone tools, beads, carvings, charcoal from fires/hearths and cave paintings - Artefacts tell us about the lifestyles, practices and beliefs of ancient humans Fossils are the preserved remains or traces of organisms that once lived.
Radioisotopes commonly used for radiometric dating
By measuring the amount of the parent radioisotope present in a fossil or rock sample scientists can calculate the samples approximate age Half life of common radioisotopes - Carbon- 14 (5730) - Potassium-40 (1.3 billion years) - Rubidium- 86 (18.66 days) - Uranium-283 (4.5 billion years)
List some examples of ubiquitous proteins that illustrate how protein sequences provide evidence for evolution.
Cytochrome C - It is an enzyme used in cellular respiration - Its found in the mitochondria - Remains the same over millions of years of evolution Haemoglobin is another Ubiquitous Protein however not found in every individual
Half Life
Each isotope has a unique rate of decay described as its half life (i.e. the time taken for half of any given amount of the isotope to decay)
Uses of rDNA Proteins (2)
Factor VIII - A blood clotting factor lacking in sufferers of haemophilia A. - Cultured in mammalian cells - Is given to haemophiliac sufferers in concentrated injections Viruses - Hepatitis B vaccines are created using rDNA - Gene for the Hep B antigen protein is inserted into yeast cells. - The protein produced is injected to people wishing to gain immunity
Evidence for evolution can be obtained from many sources
For example: - Fossils - Comparative anatomy - Homologous structures - Embryology - Vestigial structures - Amino acid sequencing in proteins - Comparative studies of DNA
Define the term fossil.
Fossils are the preserved remains or traces of organisms that once lived. They may consist of bones or teeth
Explain the aim of gene therapy
Gene therapy is when in individual who has a gene defect has a normal gene inserted into affected cells using rDNA techniques
Explain what the human genome is.
Genome: The complete set of genetic information of an organism Human Genome Project has located faulty genes for over 4000 genetic disorders Replacement of those genes is now possible
Example of how the method used
Hereditary spastic paraplegia - inherited disorder that causes progressive limb weakness and stiffness, often resulting in paralysis. - Begin to show symptoms during mid 20s-mid 50s, growing more debilitating - Currently no cure-treatment is physical therapy identified on chromosome number 2
Distinguish between relative and absolute dating.
How do we know how old fossils are: There are a number of different methods used to date fossils and they are classified as either: - Absolute dating methods: Which give actual date in years for a fossil or artefact eg: 1.5 million years before present - Relative Dating Methods: Which tell whether one specimen is younger or older than another eg: fossil A is older than fossil B
Comparative Embryology (1)
In vertebrates (fish, amphibians, birds, reptiles and mammals) show a degree of similarity at early embryonic stages. Features of all vertebrates at some point of their development include: - Dorsal brain and spinal cord - Axial skeleton - Post anal tail - Gill or pharyngeal gill slits - Aortic arches
Explain what an index fossil is and how they are used in relative dating.
Index fossils are fossils of a species which have a distinctive appearance, only existed on the earth for a short time span and have a broad geographical distribution - If two rocks in different locations both contain the same index fossil it is likely that both areas are of the same age
Uses of rDNA Proteins (1)
Insulin - Produced using e. Coli or yeast. Is produced in large rats. - Is used to treat type I diabetes Human Growth Hormone - Also produced using E. Coli. - Can be used to treat children with growth retardation preventing dwarfism - Can also be used to enhance athletic performance, anti-ageing treatments and to increase milk production.
Explain what a phylogenetic tree (evolutionary tree) shows.
Is a diagram to represent an evolutionary timeline
Evidence that supports Evolution
Is there evidence - that things have changed over time - of common ancestry - of increasing complexity over time
Describe the role of DNA ligase in DNA recombinant technology.
Joins DNA fragments together
Sanger sequencing involves
Making many copies of a target DNA region. Its ingredients are similar to those needed for DNA replication in an organism, or for polymerase chain reaction (PCR), which copies DNA in vitro. They include: - A DNA polymerase enzyme - A primer, which is a short piece of single-stranded DNA that binds to the template DNA and acts as a "starter" for the polymerase - The four DNA nucleotides (dATP, dTTP, dCTP, dGTP) - The template DNA to be sequenced - Dideoxy, or chain-terminating, (lack OH) versions of all four nucleotides (ddATP, ddTTP, ddCTP, ddGTP), each labeled with a different colour of dye
PCR steps
Once a small amount of DNA has been extracted from a tissue sample the following steps are carried out 1. Denaturing (splitting DNA strand) 2. Primer annealing 3. Primer elongation Before this the DNA sample must be mixed with 2 primers, many molecules of each of the 4 nucleotides and DNA polymerase (extracted from thermophilic bacteria).
Primer Extension
Once the primer has bound, the temperature is raised again (72ºC) allowing DNA polymerase to synthesise new DNA starting from the primer.
Rapid burial
Organisms need to be buried rapidly by sediments, sand, mud or volcanic ash to prevent oxygen and scavengers from reaching the remains.For this reason, many fossils are found around lakes, rivers and volcanoes.
Outline why plasmids are useful in gene technology.
Plasmids transfer DNA from one organism to another
Four Techniques used in identifying genes and alleles
Polymerase chain reaction - DNA sequencing - Gene Probes - DNA profiling
Principle of Superposition
Principle of Superposition, which assumes that unless disturbed, the lower beds in a sedimentary sequence are older than the rocks above. Thus, any fossils found found in the top layers will be younger than fossils found in layers underneath them.
Identify stratigraphy and index fossils as types of relative dating.
Relative Dating When it is not possible to determine the actual age of a fossil or artefact, scientists may be able to determine whether it is older or younger than another. Examples include: - Stratigraphy (for a single outcrop) - Correlation of Rock Strata (for 2 or more outcrops) - Index fossil (for 2 or more outcrops)
Sticky ends & Blunt ends
Sticky ends can recombine to complementary bases - The overhanging ends produced by a staggered cut of a sequence of nucleotide bases Blunt ends cannot recombine to complementary bases The ends produced by a straight cut of a sequence of nucleotide bases
Describe what is studied in stratigraphy.
Stratigraphy: This method uses the Principle of Superposition, which assumes that unless disturbed, the lower beds in a sedimentary sequence are older than the rocks above. Thus, any fossils found found in the top layers will be younger than fossils found in layers underneath them.
Explain the relationship between restriction enzymes and recognition sites.
The restriction enzymes cut at specific recognition sites
Tree Ring Dating Limitations
Timber is rarely preserved for more than a few thousand years
Outline the role of bacteriophages and vectors in recombinant DNA technology.
Vector is something that is capable of transferring DNA from one organism to another Bacteriophages (phage): a virus capable of infecting a bacterial cell
Low Oxygen and Acidity
Wet, acidic soils dissolve bones and no fossils are produced. However, if these soils also contain NO OXYGEN (such as in peat) they can completely preserve soft tissue and bone. - Bones buried in alkaline soils are more likely to be fossilised. The minerals in the bone are replaced by rock preserving the details of the bone structure
Outline the conditions suitable for fossil formation.
When an organism dies the chance of it being fossil are very low as the remains are usually decomposed by bacteria or eaten by scavengers Conditions required for fossil formation - Rapid Burial - Low oxygen and Acidity - Covering with fine sediment - Absence of decay organisms - Presence of hard body parts
