Transcription

What will NOT be one of the products of translation: 5' GCUGCUGCUGCUGCUGCUGCUGCU 3' a. polyalanine b. polycysteine c. polyeucine d. polyaspartic acid

d

Explain redundant but not ambiguous

no codon specifies more than one amino acid, one amino acid can have many codons

Exons

sequences that stay in the RNA

The process of ending transcription is called termination, and it happens once the polymerase transcribes a sequence of DNA known as a

terminator

Many antibiotics interfere with the transfer of genetic information from RNA to protein, preventing bacteria from growing. Which process is affected by antibiotics?

translation

A new planet gas 9 amino acids (as opposed to 20 here). How many nucleotides in the genetic code? Minimum number of nucleotides in lunar codon?

2 4^n>AAs on earth, 4^3>20

How many possible AA sequences from this: CUUCUUCUUCUUCUU

3

RNA grows 5'-3'. What direction is this in the DNA template? Label directionality

3'-5'

The following RNA strand was produced: 5′ AAA AUG AGU AAG 3′ What could have been the template for this RNA?

3′ TTT TAC TCA TTC 5′

Imagine that you are an astronaut in the future and you are looking for life on other planets. Remarkably, you visit the planet "Boscoville" and find life that is quite similar to life on Earth in many ways. You discover that their genetic material is DNA, just like ours. However, proteins are much more complex on Boscoville than they are on Earth, in that they are composed of 98 different amino acids whereas we use only 20 amino acids on Earth. How many nucleotides would you hypothesize are in a codon in order to accommodate 98 amino acids?

4^n>98 x=4

spliceosome

A large complex made up of proteins and RNA molecules that splices RNA by interacting with the ends of an RNA intron, releasing the intron and joining the two adjacent exons.

Introns

A noncoding, intervening sequence within a eukaryotic gene.

Transcription

DNA sequence in a gene is copied into RNA

Elongation: Once RNA polymerase is in position at the promoter, the next step of transcription—elongation—can begin. What does this stage mean?

During elongation, RNA polymerase "walks" along one strand of DNA, known as the template strand, in the 3' to 5' direction. For each nucleotide in the template, RNA polymerase adds a matching (complementary) RNA nucleotide to the 3' end of the RNA strand.

Initiation: RNA polymerase binds to DNA of the gene at this region

Promoter. A promoter contains DNA sequences that let RNA polymerase or its helper proteins attach to the DNA. Once the transcription bubble has formed, the polymerase can start transcribing.

Given this sequence of DNA, show the resulting RNA sequence, then the AA sequence. IF this is the template strand, what is the coding strand? 3' CCGATACGGGTTCTAAATTGCGT 5'

RNA: 5' GGCUAUGCCCAAGAUUAACGCA 3' MET-PRO-LYS-ISL Coding strand: same as RNA but sub u and t

Match the following events with the correct stage of transcription. RNA polymerase stops transcribing RNA polymerase binds to promoter RNA polymerase adds complementary nucleotides to 3' end of RNA strand.

Stops: termination binds: initiation adds: elongation

Big picture: transcription and translation locations

The sites of translation are ribosomes, molecular complexes that facilitate the orderly linking of amino acids into polypeptide chains. In a bacterial cell, which lacks a nucleus, mRNA produced by transcription is immediately translated without additional processing. in eukaryotic cells, The nucleus provides a separate compartment for transcription. The original RNA transcript, called pre-mRNA, is processed in various ways before leaving the nucleus as mRNA.

A sequence of RNA is shown below: 5' ACG AAA GAU 3'. Using the codon chart provided, what is the sequence of amino acids that is produced when this gene is translated?

Thr - Lys - Asp

Template strand vs coding strand

Transcription uses one of the two exposed DNA strands as a template; this strand is called the template strand. The RNA product is complementary to the template strand and is almost identical to the other DNA strand, called the nontemplate (or coding) strand. all of the T nucleotides are replaced with U nucleotides.