7.3 Translation
(mRNA) AUG CCA GUG ACU UCA GGG ACG AAU GAC UUA
(DNA) TAC GGT CAC TGA AGT CCC TGC TTA CTG AAT
What direction does transcription and translation occur in?
5' → 3' direction
Primary (1º) Structure
The first level of structural organisation in a protein is the order / sequence of amino acids which comprise the polypeptide chain The primary structure is formed by covalent peptide bonds between the amine and carboxyl groups of adjacent amino acids Primary structure controls all subsequent levels of protein organisation because it determines the nature of the interactions between R groups of different amino acids
Initiation
The first stage of translation involves the assembly of the three components that carry out the process (mRNA, tRNA, ribosome) The small ribosomal subunit binds to the 5'-end of the mRNA and moves along it until it reaches the start codon (AUG) Next, the appropriate tRNA molecule bind to the codon via its anticodon (according to complementary base pairing) Finally, the large ribosomal subunit aligns itself to the tRNA molecule at the P site and forms a complex with the small subunit
Polysome diagram
The polysomes will appear as beads on a string (each 'bead' represents a ribosome ; the 'string' is the mRNA strand)
Quaternary (4º) Structure
- Multiple polypeptides or prosthetic groups may interact to form a single, larger, biologically active protein (quaternary structure) - A prosthetic group is an inorganic compound involved in protein structure or function (e.g. the heme group in haemoglobin) - A protein containing a prosthetic group is called a conjugated protein - Quaternary structures may be held together by a variety of bonds (similar to tertiary structure)
How do ribosomes read mRNA?
- The base sequence of an mRNA molecule encodes the production of a polypeptide - The mRNA sequence is read by the ribosome in triplets of bases called codons - Each codon codes for one amino acid with a polypeptide chain - The order of the codons in an mRNA sequence determines the order of amino acids in a polypeptide chain
Production of human insulin in bacteria
- The gene responsible for insulin production is extracted from a human cell - It is spliced into a plasmid vector (for autonomous replication and expression) before being inserted into a bacterial cell - The transgenic bacteria (typically E. coli) are then selected and cultured in a fermentation tank (to increase bacterial numbers) - The bacteria now produce human insulin, which is harvested, purified and packaged for human use (i.e. by diabetics)
How to find polypeptide from mRNA?
- The mRNA transcript is organised into triplets of bases called codons - An open reading frame starts with AUG and will continue in triplets to a termination codon
Elongation
A second tRNA molecule pairs with the next codon in the ribosomal A site The amino acid in the P site is covalently attached via a peptide bond (condensation reaction) to the amino acid in the A site The tRNA in the P site is now deacylated (no amino acid), while the tRNA in the A site carries the peptide chain
What is meant by the phrase 'the genetic code is universal'?
Almost every living organism uses the same code (there are a few rare and minor exceptions)
Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU
Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U Answer: (amino acid) Met His Val Thr Phe Leu Met Ser STOP
Use of universal genetic code
As the same codons code for the same amino acids in all living things, genetic information is transferrable between species
How to find DNA base sequence from mRNA strand
Cytosine (C) is replaced with Guanine (G) - and vice versa Uracil (U) is replaced by Adenine (A) Adenine (A) is replaced by Thymine (T)
Discuss the relationship between one gene and one polypeptide.
DNA codes for a specific sequence of amino acids/polypeptide; the DNA code for one polypeptide is a gene; DNA is transcribed into mRNA; mRNA moves to a ribosome; where mRNA is translated into a polypeptide; originally it was thought that one gene always codes for one polypeptide; some genes do not code for a polypeptide; some genes code for transfer RNA/tRNA/ribosomal RNA/rRNA; some sections of DNA code for regulators that are not polypeptides; antibody production does not follow this pattern (of simple transcription-translation); (allow other examples) change in the gene/mutation will affect the primary structure of the polypeptide;
Specificity of enzyme binding site
Each amino acid is recognised by a specific enzyme
How does the body determine whether it remains free or attached to the ER
If the protein is targeted for intracellular use within the cytosol, the ribosome remains free and unattached If the protein is targeted for secretion, membrane fixation or use in lysosomes, the ribosome becomes bound to the ER
In which, prokaryotes or eukaryote, can translation and transcription occur at the same time?
Prokaryote
Why don't RNA in prokaryotes need to be modified?
Prokaryotes lack compartmentalised structures (like the nucleus) and so transcription and translation need not be separated
What are ribosomes made of?
Ribosomes are made of protein (for stability) and ribosomal RNA (for catalytic activity)
Overview of translation
Ribosomes bind to mRNA in the cytoplasm and move along the molecule in a 5' - 3' direction until it reaches a start codon (AUG) Anticodons on tRNA molecules align opposite appropriate codons according to complementary base pairing (e.g. AUG = UAC) Each tRNA molecule carries a specific amino acid (according to the genetic code) Ribosomes catalyse the formation of peptide bonds between adjacent amino acids (via condensation reactions) The ribosome moves along the mRNA molecule synthesising a polypeptide chain until it reaches a stop codon At this point translation ceases and the polypeptide chain is released
Where can ribosomes be found?
Ribosomes can be found either freely floating in the cytosol or bound to the rough ER (in eukaryotes)
Transfer RNA (tRNA) regions
The acceptor stem (3'-CCA) carries an amino acid The anticodon associates with the mRNA codon (via complementary base pairing) The T arm associates with the ribosome (via the E, P and A binding sites) The D arm associates with the tRNA activating enzyme (responsible for adding the amino acid to the acceptor stem)
The binding of an amino acid to the tRNA acceptor stem occurs as a result of a two-step process:
The enzyme binds ATP to the amino acid to form an amino acid-AMP complex linked by a high energy bond (PP released) The amino acid is then coupled to tRNA and the AMP is released - the tRNA molecule is now "charged" and ready for use
Termination
The final stage of translation involves the disassembly of the components and the release of a polypeptide chain Elongation and translocation continue in a repeating cycle until the ribosome reaches a stop codon These codons do not recruit a tRNA molecule, but instead recruit a release factor that signals for translation to stop The polypeptide is released and the ribosome disassembles back into its two independent subunits
Translation
The ribosome moves along the mRNA strand by one codon position (in a 5' → 3' direction) The deacylated tRNA moves into the E site and is released, while the tRNA carrying the peptide chain moves to the P site Another tRNA molecules attaches to the next codon in the now unoccupied A site and the process is repeated
In eukaryotes, how does DNA get to the ribosome?
The ribosomes are separated from the genetic material (DNA and RNA) by the nucleus After transcription, the mRNA must be transported from the nucleus (via nuclear pores) prior to translation by the ribosome
Secondary (2º) Structure
The secondary structure is the way a polypeptide folds in a repeating arrangement to form α-helices and β-pleated sheets This folding is a result of hydrogen bonding between the amine and carboxyl groups of non-adjacent amino acids Sequences that do not form either an alpha helix or beta-pleated sheet will exist as a random coil Secondary structure provides the polypeptide chain with a level of mechanical stability (due to the presence of hydrogen bonds) In pictures, alpha helices are represented as spirals (purple ; left) and beta-pleated sheets as arrows (blue ; right)
Tertiary (3º) Structure
The tertiary structure is the way the polypeptide chain coils and turns to form a complex molecular shape (i.e. the 3D shape) It is caused by interactions between R groups; including H-bonds, disulfide bridges, ionic bonds and hydrophobic interactions Relative amino acid positions are important (e.g. non-polar amino acids usually avoid exposure to aqueous solutions) Tertiary structure may be important for the function of the protein (e.g. specificity of active site in enzymes)
Subunits of ribosomes
They consist of a large and small subunit: The small subunit contains an mRNA binding site The large subunit contains three tRNA binding sites - an aminoacyl (A) site, a peptidyl (P) site and an exit (E) site
What is required for the RNA before it can be translated?
This transport requires modification to the RNA construct (e.g. 5'-methyl capping and 3'-polyadenylation)
Describe the genetic code and its relationship to polypeptides and proteins.
a. (the genetic code is based on) sets of three nucleotides/triplets of bases called codons; b. bases include adenine, guanine, cytosine and thymine in DNA / adenine, guanine, cytosine and uracil in RNA; (do not accept ATCG) c. each codon is code for one amino acid; d. some codons are (start or) stop codons; e. DNA is transcribed into mRNA by base-pair matching/complementary base pairing; f. mRNA is translated into a sequence of amino acids/polypeptide; g. each gene codes for a polypeptide; h. polypeptides may be joined/modified to form proteins;
Outline how translation depends on complementary base pairing.
a. translation converts a sequence of mRNA nucleotides/codons to a sequence of amino acids/polypeptide/protein b. «triplets of» nucleotides/bases on «activated» tRNAs pair with complementary «triplets of» nucleotides/bases on mRNA / vice versa c. base pairing occurs when adenine/A pairs with uracil/U and guanine/G pairs with cytosine/C d. specific amino acids are attached to specific of tRNA e. mRNA has codons AND tRNA has anticodons
Explain the process of translation in cells.
a. translation is the conversion of base sequence on mRNA into an amino acid sequence / OWTTE; b. messenger/mRNA attaches to ribosome (small unit); c. many ribosome/polyribosomes bind to same mRNA; d. (mRNA) carries codons/triplet of bases each coding for one amino acid; e. transfer/tRNA each have specific anticodon; f. tRNA carries specific amino acid; g. tRNA anticodon binds to codon in the mRNA; h. to corresponding triplet base/codon by complementary base pairing / OWTTE; i. a second tRNA (anticodon) binds to next codon; j. two amino acids bind together / peptide linkage is formed; k. first tRNA detaches; l. ribosome moves along mRNA; m. another tRNA binds to next codon; n. continues until stop codon is reached; o. stop codon has no corresponding tRNA (anticodon)/amino acid/causes release of polypeptide;
Outline the role of ribosomes in translation.
a. translation is the production of polypeptides/proteins b. mRNA binds to the ribosome c. tRNA binds to the ribosome d. at the site where its anti-codon corresponds to the codon on the mRNA OWTTE e. amino acids of «consecutive tRNAs» bind by a peptide link «in the ribosomes» f. the ribosome moves along the mRNA OR continues with elongation of polypeptide chain Accept annotated diagrams of the process.
What determines protein destination?
by the presence or absence of an initial signal sequence on a nascent polypeptide chain
tRNA-activating enzyme
enzyme which binds specific amino acid to tRNA; activating the tRNA
A polysome (or a polyribosome)
is a group of two or more ribosomes translating an mRNA sequence simultaneously
Translation
is the process of protein synthesis in which the genetic information encoded in mRNA is translated into a sequence of amino acids on a polypeptide chain
The function of the ATP (phosphorylation)
is to create a high energy bond that is transferred to the tRNA molecule This stored energy will provide the majority of the energy required for peptide bond formation during translation
Explain the process of translation.
translation is the synthesis of proteins/polypeptide chain/specific sequence of amino acids; translation occurs in cytoplasm/ribosomes; uses information on the mRNA; mRNA carries the genetic information of DNA; mRNA binds to ribosome; mRNA contains series of codons/base triplets; tRNA binds with an amino acid and carries it to the ribosome; tRNA has the anticodon that is complementary to the codon on the mRNA; two tRNAs bind to a ribosome/mRNA at the same time; (peptide) bond forms between two amino acids (carried by tRNA molecules to the ribosome); the first tRNA detaches, ribosome moves along mRNA and another tRNA carrying an amino acid binds; process repeats forming chain of amino acids/polypeptides;