ASCP Molecular Biology Certification Exam
0.5% to 1%
Agarose concentrations for resolving large fragments (2000 - 5000 bp)
2% to 3%
Agarose concentrations for resolving small fragments (50-500 bp)
Precision
Agreement between independent test results; freedom from variation
What are the advantages of dye primer and dye terminator sequencing (fluorescent dyes) ?
All reaction can be performed in one tube Automated Can read sequences 400-500 bases Most common sequencing applications
Different versions of a gene
Allele
What does the incubation step in hbridization do?
Allows formation of double-stranded molecules
What does the incubation step in hybridization do?
Allows formation of ds molecules
Lagging DNA Pol
Alpha
VHL
Alterations in this gene lead to a syndrome, which predisposes to renal cell carcinoma
What several biomarkers of disease that can be used for diagnosis?
Alzheimer's disease elevation in beta secretase creates amyloid/beta-protein Heart disease CVD include interleukin-6, interleukin-8, serum amyloid A protein, fibrinogen, and troponins Renal cell carcinoma identification of urinary polypeptides
Secondary protein structure
Amino acids are linked by H bonds to form sub structures; eg a helixes, B sheets
Name three ways to test for viral load?
Amplicor HIV monitor kit (RT-PCR) branched DNA (bDNA) NASBA
What are the values of internal controls in amplification in the reliability of PCR results?
Amplification controls that monitor particular steps of an amplification method
The Joint Commission
An independent, not-for-profit organization, The Joint Commission accredits and certifies more than 20,000 health care organizations and programs in the United States. Joint Commission accreditation and certification is recognized nationwide as a symbol of quality that reflects an organization's commitment to meeting certain performance standards.
Sickle cell anemia
An inherited blood disorder where RBCs form a rigid disc or crescent shape HbS: β6Glu>Val HbSS: sickle cell anemia
Thalassemias
An inherited blood disorder where the body makes an abnormal form of Hb, the protein in RBCs that carries O. The disorder results in excessive destruction of RBCs --> anemia. Mutations or del of the α or β genes
Denaturing High-performance Liquid Chromatography (HPLC)
Analysis for PCR products 150-450 bp. The heteroduplexes elute ahead of the homoduplexes as the conditions intensify. The migrating homoduplexes are detected by absorbance at 260nm or fluorescence.
Change in assay response with corresponding analyte change
Analytical sensitivity
Which has a single gene mutation, PWS or Angelman?
Angelman
Hallmark feature of TNR disorders
Anticipation
Warfarin (Coumadin)
Anticoagulant, prevents thrombosis thromboembolism VCORC1: -Group 1: fast metabolizers/high dose -Group 2: slow metabolizers/low dose CYP2C9: SNPs cause slow metabolism/low dose
Clopidogrel (Plavix)
Antiplatelet agent Activated by CYP2C19 CYP2C19 poor metabolizers at high risk of treatment failure, death, heart attack, and stroke
What are the causes and association of the soft tissue sarcoma like Ewing Sarcoma.
Arising from primitive neuroectodermal tissue (PNET); Family of childhood neoplasms Diagnosis aided by detection of HBA7 cell surface marker by IHC t(11;22)(q24;q12) RT-PCR
What are the causes and symptoms for the Hemochromatosis disease?
Autosomal recessive Causes over-absorption iron Causes pancreas, liver and skin damage, heart disease and diabetes Dysfunction of hemochromatosis type I gene, HFE or HLA-H (6p21.3) In absence of HFE function, intestinal cells do not sense iron stores & iron absorption continues Other mutations: H63D & S65C & C282Y frequently observed
What cells are affected by lymphomas?
B cells T cells
What are some ways molecular genetics can diagnose lymphomas?
B- and T-cell clonality chromosomal tranlocations detect viruses residual diseases
Post transplant lymphoproliferative disorder (PTLD)
B-cell proliferation due to therapeutic immunosuppression after organ transplantation following infection with Epstein Barr Virus. Patients may develop infectious mononucleosis-like lesions or polyclonal polymorphic B-cell hyperplasia.
Nephrotic kidney (Post-transplant virus)
BK virus
Which breast cancer gene is associated with ovarian cancer?
BRAC1
What the mechanism of breast cancer?
BRAC1 & BRAC2: BRAC1 located on 17q21 BRAC2 located on 13q12 60-80% lifetime risk of cancer Men BRAC2 high risk, breast, colon & prostate Tumor suppressor genes encoding for protein in DNA repair Detected by SSP-PcR Most mutation detect by direct sequencing
What are the two genes associated with breast cancer and what chromosome are they located on?
BRAC1 - chrom 17q BRAC2 - chrom 13q
DNA Polymerase β (Euk)
Base excision repair (BER)
What are examples and mechanisms of damage removal?
Base excision repair (responsible primarily for removing small, non-helix-distorting base lesions from the genome) Mismatch (system for recognizing and repairing erroneous insertion, deletion, and mis-incorporation of bases arise during DNA replication & recombination) Nucleotide excision repair (important excision mechanism that removes DNA damage induced by ultraviolet light (UV)
Single-strand conformation polymorphism (SSCP)
Based on the preference of DNA to exist as DS rather than SS; Forms 3D conformers - a SNP can cause the conformer to fold differently (kinks, loops, bubbles, and tails)
CG
Bases with highest mutation frequency
How does the Southern blot work?
Before transferring the DNA from gel to membrane, the DNA needs to undergo depurination to produce single-stranded DNA for hybridization. After the hybridization, the blot is washed to remove excess probe and reduce background.
Telomeric probes
Best for cryptic translocations or small abnormalities
What is bacterial cell division?
Binary fission: 1 diploid cell (2n) duplicates its DNA (in S-phase), then splits that DNA up into 2 genetically identical diploid cell (2n)
Break apart probes
Bind to the chr flanking the t breakpoint region WT will emit a combination signal (next to each other) and t will emit separated signals.
single-strand DNA binding proteins (SSBPs)
Binds ssDNA and prevents it from re-annealing during TXN, replication, repair, and recombination
What the difference between bioinformatics and computational biology?
Bioinformatics is concerned with the information while computational biology is concerned with the hypothesis
What are the controls of polymerase chain reaction?
Blank reaction: controls for contamination; no DNA template Negative control: controls for specificity of amplification reaction; lack target sequence DNA template Positive control: controls for sensitivity; known target sequence DNA template
24
Blood or bone marrow for RNA processing should occur within ______ hrs
What is blotting?
Blotting is the transfer of fractionated DNA from the gel to a solid support such as a nylon membrane for further hybridization.
Hazard label
Blue: Health hazard Red: Fire hazard Yellow: Reactivity White: specific hazard 0 no hazard - 4 severe hazard
Molecular-based testing was performed on a nasopharyngeal swab sample taken from a patient. Results are reported as positive for IS481 and negative for IS1000. These results indicate the patient's nasopharynx is colonized with
Boretella pertussis
What are several signal amplification methods?
Branched DNA amplification Hybrid capture Cleavage-based amplification Cycling probe amplification
What molecular methods are based on signal amplification?
Branched DNA technology, Hybrid Capture, Cleavase (cleavage-based amplification)
Helicase
Breaks H-bonds of double helix at the replication fork
DNA Polymerase IV (Prok)
Bypass replication SOS response
DNA Polymerase V (Prok)
Bypass replication SOS response Translesion synthesis DNA repair
What mutation is responsible for hemochromatosis?
C282Y
Viral load testing for HIV does not replace _______ counts.
CD4 cell
Crossmatching
CDC is used to crossmatch potential donor and recipient Recipient serum is the source of Ab tested against donor lymphocytes
cystic fibrosis
CFTR gene (7q31.2), AR - 1521_1523delCTT, F508del
Which nucleotide pair has a high frequency of mutation in human chromosomal DNA
CG
What are the causes and symptoms for the Fragile X disease?
CGG expansion noncoding region 5' to the fragile X mental retardation gene, FMR-1 Full fragile X; 2000 > CGG repeats Symptoms: Learning disorders, long face, long ears, large genitalia
cytochrome p450
CYP2A6 gene
CML
Cancer caused by t(9:22)
Ewing sarcoma
Cancer caused by translocations involving 22q12
What is the function of tRNA?
Carries aa to ribosome Anticodon pairs with codon on mRNA strand
What is the function of mRNA?
Carries genetic info out of nucleus Transcript translated to protein
APS and TEMED
Catalysts for polyacrylamide gels
DNA polymerase
Catalyzes phosphodiester bond between nt's Uses ssDNA as a template to determine which nt's to add
BK virus nephritis (BKVN)
Caused by BK virus (BKV) in renal transplant recipients Use of immunosupressent drugs allows BKV to replicate w/i graft, causing BKVN resulting in graft failure for many
Genome mutations
Change in the number of chr's
Multilocus sequence typing (MLST)
Characterizes bacterial isolates by using sequences of internal fragments of housekeeping genes (6-7, 450-500 bp)
Which pathogens can LCR be used to detect?
Chlamydia Gonorrhea Listeria HPV
What are the HLA alleles?
Class 1: HLA-A, HLA-B & HLA-C Class 2: HLA-D & HL-DRB
Invader Assay enzyme
Cleavase
Endonucleases (Euk)
Cleaves phoshpodiester bonds w/i poly-nt chain DNase I: induces DSBs AP endonuclease: BER
CLSI
Clinical Laboratory and Standards Institute; A not-for-profit membership organization, the Clinical and Laboratory Standards Institute (CLSI) brings together the global laboratory community for a common cause: fostering excellence in laboratory medicine. We do so by facilitating a unique process of developing clinical laboratory testing standards based on input from and consensus among industry, government, and health care professionals.
Ability of test result to predict clinical condition
Clinical sensitivity
How can Southern blots help diagnose lymphomas?
Clonal rearrangement has to show 2 novel bands
Lavender
Collection tubes containing EDTA are __________ in colored tops
Red
Collection tubes with no additives are colored _______ and will collect serum.
Nucleic Acid labeling
Common labels used to generate nucleic acid probes include radioactive phosphates, biotin, fluorophores and enzymes. In addition, the bioconjugation methods used for nucleic acid probe generation may be adapted for attaching nucleic acids to other molecules or surfaces to facilitate targeted delivery or immobilization, respectively.
What are the causes and association of the soft tissue sarcoma like Rhabomyosarcoma.
Common soft tissue of childhood; 10% Three forms: Alveolar " " (ARMS), embryonal (RMS-E) & primitive (RM-P) ARMS worse prognosis Translocation forkhead rhabomyosarcoma gene (FKHR or FOXO1A) and the paired box gene (PAX3 & PAX7) common ARMS
t(15;17)
Common translocation in acute promyelocytic leukemia
t(14;18)
Common translocation in follicular lymphoma
What are the steps involved in biochip/microarray technology?
Comparing gene transcription in different cells mRNA into labeled cDNA Labeled cDNA hybridizes Laser to see hybridization Visualization of genes
What is the role of these antigens in tissue engraftment?
Compatibility of the HLA of the organ donor and recipent increases the chance for a sucessful
HLA class III
Complement C2, C4, B Expressed on plasma proteins
Splicesomes
Complex of snRNPs Removes introns from pre-mRNA and splices exons together
What the barriers of pharmacogenomics?
Complexity of finding gene variation that affect drug response Limited drug alternates Disincentives for drug companies to make multiple pharmacogenomic products Educating healthcare providers
0.1 to 0.5 mM
Concentration range of dNTP in PCR mixture
CLIA
Congress passed the Clinical Laboratory Improvement Amendments (CLIA) in 1988 establishing quality standards for all laboratory testing to ensure the accuracy, reliability and timeliness of patient test results regardless of where the test was performed.
Reproducibility
Consistency of test results produced from the same test procedure
What are the reasons of false positive in amplification in the reliability of PCR results?
Contamination Dead or dying organisms Detection of less than clinically significant levels
What are the disadvantages of commercial extraction kits?
Cost - major factor Can not achieve high yields DNA may not be as clean
Which is the starting template for PCR?
DNA
After an extraction/isolation, what should you elute with?
DNA - TE or water RNA - DEPC water
After an extraction/ isolation, what should you elute with?
DNA - TE or water RNA - DEPC water
PCR DNA Array
DNA array is a collection of spots attached to a solid support (such as a microscope slide) where each spot contains one or more ssDNA oligo fragments. Arrays make it possible to put down large quantities of very small spots on a single slide. Each spot has a DNA fragment that is complementary to a single DNA sequence.
RNA polymerase
DNA dependent RNApol Transcribes DNA template to RNA (3'-->5'; anti-parallel)
Southern Blotting
DNA is isolated and cut with REs. This allows investigators to determine the molecular weight of a restriction fragment and to measure relative amount in different samples.
southern blot
DNA isolated, cut with REs, separated by gel electrophoresis, denatured, transferred to solid support (nitrocellulose), exposed to labeled probe, signal detected
Illumina sequencing (NextGen)
DNA molecules and primers are attached on a slide and amplified with polymerase to form DNA clusters. Four types of reversible terminator bases (RT-bases) are added an the non-incorporated nucleotides are washed away. Images are taken of the fluorescently labeled nucleotides as the sequence extends, then the dye, along with the terminal 3' blocker allowing for the next cycle to begin.
Silent mutation
DNA mutation that do not result in a change of the amino acid sequence of a protein
Sanger Sequencing method
DNA obtained by res enzymes divided into 4 samples (A, T, G, C) label with radioactive oligo at 3' end mix with taq, dNTPs, ddNTPs and incubate run on gel --> 3' ends will differ by one base
What is unique to all mycobacteria?
DNA of 16S subunit of RNA
What techniques can diagnose Chlamydia?
DNA probe in-vitro amplification LCx
DNA Polymerase II (Prokaryotic)
DNA repair
DNA Polymerase beta (Eukaryotic)
DNA repair
DNA Polymerase II (Prok)
DNA repair, exonuclease activity
Define leading strand
DNA replication proceeds in a continuous manner on the 3' to 5' strand
What are the steps involved in DNA replication and mitosis?
DNA replication takes place in the synthetic phase or S-phase (separate by two gap or G-phase) Mitosis: Disassembly of the nucleus of mother cell (Propase) Division of the chromosomes (Metaphase) Partition of the chromosomes between daughter cells (Metaphase) Division of the mother cell (Anaphase) Building a new nucleus around the chromosomes in each daughter cell (Telophase)
Mutation
DNA sequence change that is present in a relatively small proportion of the population <1%, somatic changes
Define promoter
DNA sequences that bind RNA polymerase and associated factors
cis factors
DNA sequences that mark places on DNA involved in initiation and control of RNA synthesis
Components of PCR
DNA template Two primers that are complementary to the 3' Taq polymerase dNTPs Buffer solution Mg2+ (divalent cations) - higher Mn2+ concentration can increase the error rate during DNA synthesis
What is the difference between DNA and RNA?
DNA-double stranded; RNA-single stranded DNA-deoxyribose sugars; RNA ribose sugars DNA- thymine; RNA-uracil
What is considered good quality DNA/RNA from spectrophotometry?
DNA: 1.7-2.0 RNA: 2.0-2.3
Blotting: southern technique is used for what type of nucleic acid?
DNA; cut with restriction enzymes- probes with radioactive DNA, molecular weight measure in base-pairs or bp
Terminal transferase
DNApol synthesizes poly-nt chain at 3' end w/o a template
What are types of repair mechanisms do our cells have?
Damage reversal, Damage removal & Damage tolerance
Exonuclease I
Degrades ssDNA from 3'-->5'
Exonuclease VII
Degrades ssDNA from either the 5' or 3' ends One of the few enzymes with 5' exonuclease activity.
What is the genetic abnormality of: 46, XX, del(22q11.2)
Deletion in region 1, band 1, sub-band 2 of the long arm of chr 22 (diGeorge's syndrome)
What is the genetic abnormality of: 46,XY,del(16p14)
Deletion in region 1, band 4 of the short arm of chr 16
Leading DNA Pol
Delta
What are the steps of polymerase chain reaction?
Denaturation: dsDNA separate by heat 90-96 degree Annealing: complementary primers hybridizes 40-68 degree Extension: taq make compementary strands 70-75 degrees
What are the 3 steps of PCR and their temperatures?
Denature 90-96C Anneal 50-70C Extension 68-75C
What are the 3 main steps of PCR and their tempuratures?
Denature 92* Anneal 50* Extenstion 72*
5'-A-T-G-C-C-A-G-T-A-3'
Derive DNA sequence from raw sequencing data.
5'-A-T-G-G-A-C-C-A-G-T-T-G-3'
Derive DNA sequence from raw sequencing data.
What is the short tandem repeat structure and nomenclature?
Designated by D#S# system D is the DNA first # designates the chromosome where the STR is located S refers to a unique segment last # is the registration in the international genome database (GDB)
HLA Screening
Detection of antihuman antibodies in serum that match known HLA alleles
Mixed leukocyte culture (MLC)
Determines T-cell cross-reactivity donor and recipient lymphocytes are mixed in culture; the degree of incompatibility is indicated by the number of cells that have undergone transformation and mitosis, or by the uptake of radioactive isotope-labeled thymidine.
What are some facts that identify single nucleotide repeats (SNP)?
Differences between DNA sequence Detected by sequencing, melt curve analysis, or other methods 99% have no biological effect; 60,000 within genes
Maxam-Gilbert Sequencing
Differing concentrations of salt are used in four different tubes - A, T, C, G - Usually DMS (dimethylsulphate), FA (formic acid), H (hydrazine), and H+S (hydrazine + salt) --> read on a gel
What does DNA sequence analysis do?
Direct determination of the order, or sequence, of nucleotides in a DNA polymer.
Hemachromatosis
Disease caused by over absorption of iron
Clinical specificity
Disease-associated results only in patients who actually have the disease condition
Coagulopathies
Disorder of blood coag caused by inherited or acquired defects in coag proteins, platelets, or vasculature e.g. Von Willebrand's dz, hemophilia, Factor V Leiden
Sanger sequencing method
Divided into 4 samples (ddA, T, G, C) Label with radioactive/dye oligo at 3' end Mix with taq, dNTPs, ddNTP and incubate run on gel --> frags will terminate at different lengths
What is one way you can increase the yield/quality of DNA/RNA after running gel?
Do an EtOH ppt
What is one way you can increase the yeild / quality of DNA or RNA after running on a gel?
Do an EtOH precip
What are the advantages of commercial extraction kits?
Do not need to use caustic solvents such as phenol More rapid Can easily estimate DNA concentration based on amount of cells used
Fluorescent in situ Hybridization (FISH)
Does not require actively dividing cells known gene seq, unknown mut
Base Excision repair (BER)
Done by DNA glycosylase, AP endonuclease Cleaves glycosidic bond of a single base base, leaving apurinic/apyrimidinc site
Nucleotide Excision repair (NER)
Done by endonucleases Removes a span of nt's by cleaving phosphodiester bond
Graft versus host disease (GVHD)
Donor cells recognize host (recipient) cells as foreign and attack and destroy
A robertsonian translocation may be associated with which genetic disorder
Down syndrome
What types of probes are used for FISH?
Dual fusion: 2 probes flank the breakpoint at both t locations CEN probes: centromeric probes bind to repetitive alpha satellite sequences Telomeric probes Whole chr paints
Muscular Dystrophy is associated with what other disorder?
Duchenne & Becker
What are several examples of X-linked Dominant Disorder inherited disease?
Duchenne/Becker muscular dystrophy & fragile x syndrome
What is going on in an HPV infection?
E6 and E7 proteins inhibit p53 and pRB
Which specimen tubes are the best for use with molecular assay?
EDTA (purple) can also use ACD (yellow)
Breast cancer, Her1/ErbB1
EGFR, estrogen receptor (ER), is overexpressed Estrogen binds, ER dimerizes -> TXN of genes that promote proliferation Dx: IHC, FISH, qPCR Treatment: Tamoxifen, raloxifene, faslodex
What genes are affected by Ewing's tumor?
EWS gene - chrom 22 FL1-1 gene - chrom 11
What molecular methods can be used to validate the PCR products ?
Electrophoresis and Sequencing
What are the components of agarose gel electrophoresis?
Electrophoresis chamber, power supply, gel casting tray, sample combs, electrophoroesis buffer, loading buffer, ethidium bromide & transilluminator
What are the various techniques used to visualize nucleic acids in the molecular lab?
Electrophoresis: Agarose, Pulsed field, Alkaline agarose gel, Polyacrylamide, Polyacrylamide SDS, 2-dimensional gel & Capillary gel Blotting: Dots, Northern, Southern & Western
Negative template control
Ensures non-specific targets are not being amplified by the primers
What is interspersed repetitive elements that is used to type bacterial strains in epidemiological investigation?
Enterobacterial repetitive intergenic consensus (ERIC) sequences are 126 bp long genomic sequences found some bacterial species that are conserved flanked by inverted repeats that could form stem-loop or cruciform structures in DNA found only in gram-negative bacterial PCR amplification priming outward from repetitive element generates stain-specific products
Stoffel
Enzyme recommended for allele specific PCR and for regions with high GC content
Primase
Enzyme that lays down RNA primers for DNA replication
Repair DNA Pol
Epsilon
For long term storage, what should you store DNA in?
EtOH
What are molecular targets that useful for diagnosis and the monitoring of solid tumor?
Ewing Sarcoma (t(11:22) (q24;q12)) Synovial sarcoma (t(X,18), SS18 or SYT & SSX1 or SSX2) Rhabdomyosarcoma (FKHR/FOXO1A, PAX3 & PAX7)
Reference range
Expected analyte frequency or levels from a population of individuals
fertility factor
F+, carries info cell to cell during conjugation; extrachromosomal circle of ds DNA; duplicated then transferred
What is conjugation?
F- and F- cells conjugate through a bridge then cell F- become F+ after mating
factor v leiden
F5 gene (1q23) - 1691A->G, R506Q
Analyte specific reagent (ASR)
FDA defines analyte specific reagents (ASRs) in 21 CFR 864.4020 as "antibodies, both polyclonal and monoclonal, specific receptor proteins,ligands, nucleic acid sequences, and similar reagents which, through specific binding or chemical reaction with substances in a specimen, are intended to use in a diagnostic application for identification and quantification of an individual chemical substance or ligand in biological specimens.
FDA
FDA is responsible for protecting the public health by assuring the safety, efficacy and security of human and veterinary drugs, biological products, medical devices, our nation's food supply, cosmetics, and products that emit radiation. also responsible for advancing the public health by helping to speed innovations that make medicines more effective, safer, and more affordable and by helping the public get the accurate, science-based information they need to use medicines and foods to maintain and improve their health.
fragile x syndrome
FMR1 gene, CGG expansion; >2000 repeats in full syndrome; results in methylation of DNA in region and shutdown of transcription
Probes are often used during real time PCR to quantitate the formation of specific amplicons during the reaction. Which system involves the use of 2 distinct probes to generate a fluorescent signal
FRET
DNA pol γ (gamma)
Family A DNA pol; in mitochondria; replication, repair, 3' --> 5' exonuclease
DNA pol ε (epsilon)
Family B DNA pol; extends leading strand, repair; 3' --> 5' and 5' --> 3' exonuclease
DNA pol α (alpha)
Family B DNA pol; initiates replication by elongating primer
DNA pol δ (delta)
Family B DNA pol; main DNA synthesis enzyme; takes over leading/lagging strand synthesis from Pol α; 3' --> 5' exonuclease
DNA pol β (beta)
Family X DNA pol; short-patch base excision repair
FRET probes
Fluorescence Resonance energy transfer - Distance dependent interaction between the electronic excited states of two dye molecules in which excitation is transferred from a donor molecule to an acceptor molecule without emission of a photon.
DNA Polymerase alpha (Eukaryotic)
For lagging strand synthesis
[TP/(TP + FN)]*100
Formula for clinical sensitivity
[(TN + TP)/(TN + TP + FN + FP)]*100
Formula for clinical specificity
Calculate the Tm of the following primers: Forward: GGAGCTTTGTTTCAACCAAG Reverse: ATTAAATGCGGAATTGCCCA
Forward: Tm=(4C x 9GC)+(2C x 11AT) = 58C Reverse Tm=(4C x 8GC)+(2C x 12AT) = 56C
Dye primer
Four different fluorescent dyes are added to the primers. Cycling is done to attach the primer and that is what the instrument sees. Each nucleotide is amplified a different color.
What disease is the triple repeat for "CGG"
Fragile X
What are non-mendelian inheritance examples of Nucleotide repeat expansion?
Fragile X Huntington's Disease
<200
Fragile X carrier has ____ CGC repeats
What disease is non-Mendelian inhertance pattern?
Fragile X syndrome and other tri-nucleotide repeat disorders
Okazaki
Fragments on the lagging strand of a replicating DNA molecule
Deoxyribonuclease I
From bovine pancrease, digests ss and dsDNA at pyrimidines. Typically used to remove DNA from RNA preparations.
Cell cycle entry
G1 to S
Prothrombin
G20210A A bleeding disorder that slows the blood clotting process. Mutations in the FII gene cause prothrombin deficiency.
Mitochondrial DNA Pol
Gamma
What is the general theory involved in blotting.
Gel electrophoresis Transfer to solid support; after DNA, RNA or protein has been separated by molecular weight, must be transferred to solid support (nitrocellulose paper) before hybridization the process is blotting Blocking; surface of filter has the separated molecules as well spaces where molecules have yet bound, filters art soaked in blocking solution which prevent probes from sticking to filter Preparing Probe; label copy of double-stranded DNA fragment/ radioactivity, fluorescence, chemiluminescence Hybridization Washing Detection of probe-target hyrid
ATM
Gene mutated in Ataxia Telangiectasia
FKHR (FOXO1A)
Gene on chromosome 13 that is involved in translocations in rhabdomyosarcoma
EWS-FLI1
Genes involved in cancer caused by t(11;22)
BCR-ABL
Genes involved in cancer caused by t(9;22)
What are the examples of and interpret laboratory methods designed to detect single-gene disorder?
Genetic lesions in single-gene disorders are deyected by various hybridization/ amplification methods and nucleotide sequencing
What are the areas where bioinformatics is currently in use?
Genome annotation Computational evolutionary biology Analysis of gene expression Analysis of protein expression Analysis of mutations in cancer Prediction of protein structure Comparative genomics Modeling biological systems High-throughout image analysis
HCV Genotypes
Genotype 1 - 75% Genotype 2 and 3 - 20-25%
What are some facts that identify restriction fragment length polymorphisms (RFLP)?
Genotypes are inherited for each locus, one allele is inherited by each parent each Chromosome carries its own polymorphisms so offspring Inherits combination of parental Unique set Observed by Southern Blot
What are the molecular methods that are used to type bacterial strains in epidemiological investigation?
Genotypic analysis targeting genomic or plasmid DNA like pulsed field gel electrophoresis, plasmid analysis (plasmid fingerprinting) and ribotyping species, strain, or type -specific DNA sequences are the sources of genotype information
What are the non-mendelian inheritance?
Gonad mosacicism Genomic imprinting Nucleotide repeat expansion Mitochondrial inheritance
What is the role of these antigens in rejection?
Graft verse host disease (GVHD) occurs when a immunocompetent cells in the donor organ recognize recipient cells as foreign and attack and destroy the recipient cells
50
Greater than ___% PRA (panel reactive antibodies) indicates a difficulty in finding a matched donor
Heparin
Green and brown collection tubes contain _______ and should be avoided for molecular biology based tests
Major histocompatibility complex (MHC)
Group of genes located on 6p MHC gene products are called human leukocyte antigens (HLA)
huntington disease
HD/HTT gene, CAG expansion; 9-37 repeats normal; 38-86 repeats abnormal; protein aggregates in plaques, esp. in nervous tissue; screen with standard PCR
HERceptin Therapy
HER2+/neu Overexpression of HER2 receptors causing cancer cells to grow
hemachromatosis
HFE gene, AR - C282Y
Kidney Failure
HIV
What is bDNA used to detect?
HIV Hepatitis
What pathogens can you detect using NASBA?
HIV hepatitis HTLV CMV
100,000 copies/mL
HIV viral load in bad range
10,000 copies/mL
HIV viral load in ok range
<50 copies/ml
HIV viral load, goal of antiretroviral therapy
Carbamazepine Resistance
HLA B1502
Serological Analysis of the MHC
HLA Typing - known anti sera + recipient's lymphocytes Cytotoxicity reading > 6 ( 51 - 80% dead cells), recipient has an Ag matching the panel antibody Screening - recipient Ab + ref lymphocytes % PRA >50% = recipient highly sensitized Cross matching - recipient Ab + donor lymphocytes If donor cells are killed by recipient's sera, it's a positive cross match and donor cannot be used
GVHD; graft versus host disease
HLA or tissue typing prevents _____________.
Complement-dependent cytotoxicity
HLA typing test that uses anitbody panels
HLA class I
HLA-A, HLA-B, HLA-C Expressed on all nucleated cells Composed of an α and β-2 chain (Domains:α1, α2, α3) Polymorphisms located on chr 6, exon 2 and 3
HLA class II
HLA-DP, HLA-DQ, HLA-DR Expressed on Ag presenting cells Composed of an α (α1 & α2) and β (β1 & β2) Polymorphisms located on chr 6, exon 2
What are the HLA allele nonmenclature?
HLA-DRB1*2503 HLA-gene region D-gene locus R- sub-region B1- alpha & beta-chain polypeptide *25- allele family 25 03- third allele
Set of alleles on the same chromosome and inherited together
Haplotype
4
Hazards are ranked from 0 to _______, with increasing severity.
KCL in PCR
Helps short DNA fragments range 100bp to 1000bp at 70mM to 100mM
Which specimen tubes are not good for use with molecular assays?
Heparin (green) inhibits several enzymes used in molecular assays
What the role of HER2/neu mechanism in breast cancer?
Her2: Located on 17q21.1 Frequently amplified in breast cancer cells, resulting in increased amounts of Her2 cell surface protein Her2/meu overexpression is a predictor of a more aggressive growth and metastasis of the tumor cells Her/neu detected by FISH
If fragments are dissolved in 50% formamide will the stringency be higher or lower?
Higher
Five
How many repeat loci are analyzed to determine MSI?
What disease is the triple repeat for "CAG"
Huntington Disease
What are several examples of Autosomal Dominant inherited disease?
Huntington's disease, Neurofibromatosis (type 2) & familial hypercholesterolemia
What is the molecualr technique that is used to detect HPV?
Hybrid Capture II HPV test (DNA)
What are the molecular methods used to detect Epstein Barr Virus (EBV)?
ISH Southerns PCR (direct qualitative)
How do you diagnose Herpes 1 & 2?
ISH or Southern PCR
What are two biological exceptions to positive identification by autosomal STR?
Identical twins and clones have identical nuclear DNA profiles
Two
If a test is discontinued, all related SOP's must be kept for ______ yrs.
What are the some causes of false negative in amplification in the reliability of PCR results?
Improper collection, specimen handling Inhibitors are present Extraction/amplification failure Technical difficulties with chemistry or instrumentation
Donor
In CDC cossmatching the source of lymphocytes is from the __________.
Recipient
In CDC crossmatching the source of antibodies is from the ___________.
High
In MSI testing 2 of 5 loci must show instability to classify it to this degree (MSH-H or MSH-L)
Amplification
In SSP-PCR for donor matching, _________ controls must be used.
3'
In sequence specific PCR, the __' end of a PCR primer must be complementary to the the template
RNA, DNA
In transcription-based amplification systems (TAS), _____ is the target instead of ______.
Aneuploid
Increased number of chr's (eg. Down's syndrome)
Topoisomerase I
Induces ss breaks Remove DNA supercoils during TXN and DNA replication; for strand breakage during recombination; for chr condensation; and to disentangle intertwined DNA during mitosis
Give an example of microbial identity testing of an infectious disease.
Influenzia testing (subtyping) done at the state
TP53
Inherited mutations in this gene cause Li-Fraumeni syndrome
HLA Typing
Initial identification of HLA alleles in a specimen
What are the steps involved in translation?
Initiation Elongation Termination
What is gene therapy?
Insertion of genes into an individual's cells to treat disease Hereditary disease which deleterious mutant allele is replaced with functional one Focus has been one diseases caused by single-gene defects; cystic fibrosis Changed expression of person's genes
What are the recommendations for preparation and use of reagents in the molecular laboratory?
Instruction on the preparation of reagents are included in the written laboratory protocol Seqences of primers and probes, primer binding sites and probes are ducomented Analyte-specific reagents (ASR) are probes primers, antibodies, or other test components that detect a specific target
How does EtBr cause DNA to fluoresce?
Intercalates into the double helix Absorbs UV ~300 nm, emits ~600 nm
Cleavase/Invader
Invader & signal probe added to target Cleavable substrate is formed if mutation is present Signal probe is cleaved to form invader in the next step FRET probe is added; if invader hybridizes, cleavase cuts flap, separating R and Q
Histones
Ionic; (+) charged Arginine and Lysine
What inhibits topoisomerase?
Irinotecan
What is the genetic abnormality of: iso(X)(q10)
Isochormosome comprised of the long arms of the X chr
Loop-mediated isothermal amplification (LAMP)
Isothermal, single tube technique for the amplification of DNA Uses 4 different primers that recognize 6 regions on target gene Stem-loop structure forms which is used as a template for lamp cycling (SDA)
What does it mean when you have dye blobs running the sequencing?
It means that you fail to clean the sequencing ladder properly which can result in bright flashes of fluorescence that obliterate parts of the sequence read.
Common oncogene
K-Ras Protein involved in cell division
What are non-mendelian inheritance examples of Mitochondrial inheritance?
Kearnes Sayre syndrome (KSS), chronic progressive external ophtalmoplegia (CPEO), Leber hereditary optic neuropathy (LHON)
Sanger Sequencing
Known as deoxy chain terminating sequencing; A primer complementary to the 5' region of DNA is used. The primer is typically labeled with P32 (internal labeling) or a fluorescent dye. Here, modified ddNTPs derivatives are added which lack the OH group found on the 3' carbon of the dNTPs. DNA synthesis will stop upon incorporation of a ddNTP because the bond between the phosphodiester bond cannot be established.
(peak ht normal allele N/peak ht normal allele T)/(peak ht mutant allele T/peak ht mutant allele N)
LOH; if ratio is <.5 or >2
What is the components that occur in chain termination sequencing?
Labeled primer Template Dideoxynucleotides (ddNTPS) 1:1/ four tubes DNA polymerase Stop buffer (20mM EDTA)
DNA Polymerase I (Prokaryotic)
Lagging strand synthesis
DNA Polymerase δ (Euk)
Lagging strand synthesis DNA repair, exonuclease, replaces primers as it encounters Okazaki fragments
Klenow fragment
Large subunit from E.coli with polymerase activity, but not exonuclease activity
DNA Polymerase ε (Euk)
Leading strand synthesis exonuclease
What are several examples of Mitochondrial inheritance?
Leber's hereditary optic neuropathy & Kearns-Sayre syndrome
Z-DNA conformation
Left-handed caused by stress or torsion (e.g. during transcription)
What are the causes and symptoms for the Factor V Leiden disease?
Leiden mutation in coagulation factor V gene F5 (1q23) 1691 A->G; R506Q) Causes hypercoagulation phenotype Deep venous thrombosis Treated with anticoagulants
Line Probe Assay
LiPA reverse hybridization assay using sequence-specific oligonucleotide probes (reverse SSOP) multi-parameter testing --> single strip
What are several probe amplification methods?
Ligase chain reaction (LCR) Strand displacement amplification (SDA) QB replicase
Restriction Enzyme IV
Like Type I, cut at recognition site that is asymmetrical amd 10bp away
Restriction Enzyme III
Like Type I, cut at recognition site that is asymmetrical amd 24-26bp away
What are the uses for DNA forensic identification?
Link a suspect to the evidence or eliminate a suspect (use as fingerprint) Identify a victim through DNA from relatives Link evidence found at one crime scene to evidence from another Link crime scene to the same perpetrator locally, statewide and nationwide
Graft vs Host Disease
Linked w CMV replication (Cytomegalovirus)
What are the two types of isolation/extraction methods?
Liquid phase (organic & inorganic) Solid phase (Qiagen)
Plasma
Liquid portion of blood with no cells.
Serum
Liquid that separates out when blood coagulates.
LINES
Long interspersed nucleotide sequences 6 to 8 kbp
What is the best temperature to store DNA?
Long term = -70* short term = -20*
What is the best temperature to store RNA?
Long term = -70* short term = -20*
What are the Mendelian patterns of inheritance as exhibited by pedigree diagrams?
Loss of function mutation; Displayed phenotype recessive & Phenotype depends on type of protein affected Gain of function mutation: Less common , Displays dominant phenotype Dominant negative patterns observed with loss of function in multimeric proteins Automsomal Recessive;Most frequently, Not observed in heterozygous state & Must be homozygous
If fragments are dissolved in a high concentration of NaCl will the stringency be higher or lower?
Lower
Touchdown PCR
Lower annealing temp 1 degree until optimal temp is reached
Detection Limit
Lower limit of detection of the analyte
Southern blot
Lymphocyte clonality is detected by this method
MSH2 & MLH1
Lynch syndrome; hereditary colon carcinoma (HNPCC)
Histone methylation
Lysine (K) and arginine (R) can be methylated Common on K residues of H3 and H4 tails Methylated = silenced Heterochromatin
Histone acetylation and deacetylation
Lysine (K) residue on N-termini Acetylation = active, removes + charge Deacetylation = inactive Euchromatin
What is the organic phase approach for isolating nucleic acids of DNA?
Lysis (NaOH SDS) Acidification (acetic acid salt) Extraction (phenol, chloroform) DNA precipitation (ethanol)
What is the organic phase approach for isolating nucleic acids of RNA?
Lysis (guanidine isothiocyanate {GITC}) Extraction (phenol, chloroform) Precipitation (ethanol)
What is the solid phase approach for isolating nucleic acids of RNA?
Lysis (supplied reagent) Adsorption (low pH) Wash (supplied reagent) Elute (low salt)
What is the solid phase approach for isolating nucleic acids of DNA?
Lysis (supplied reagents) Acidification (supplied reagent) Adsorption (low pH) Wash (supplied reagent) Elute (low salt)
KRAS (also NRAS, HRAS) (kirsten rat sarcoma viral oncogene homolog)
MAPK (mitogen-activated protein kinase) pathway; most common oncogene mutations in human cancers; usually in codons 12, 13, 22, 61
HLA; human leukocyte antigens
MHC gene products in humans are called __________.
Hereditary nonpolyposis colorectal cancer (HNPCC) aka Lynch syndrome
MSI is often associated (90%) with this type of inherited cancer
methylenetetrahydrofolate reductase
MTHFR - 677C>T & 1298A>C
DNA pol III
Main polymerase in bacteria also with 3'-5' exonuclease activity
Acid citrate dextrose
Make-up of ACD collection tubes
What are instrument maintenance, repair, and calibration?
Manufacturers recommendations of routine maintenance Laboratory maintains schedule and instructions for routine maintenance Be aware of limits of user-recommendation repairs and when service calls indicated Regular calibration or fitting an instrument or test system output with the actual concentration of reference analyte is required
What are the uses for recombinant DNA technology?
Manufacturing hormones and chemotherapeutic agents Gene therapy
What are manual two methods of sequence DNA?
Maxam/Gilbert chemical sequencing Sanger chain termination sequencing
Molecular beacons
Measures accumulation of product at the annealing step Contains target specific seq and inverted repeat that forms stem-loop At annealing step probe hyb's to target, separating R and Q
Spectrophotometer
Measures amount of light absorbed Quantitative measurement of [DNA/RNA]
In-vitro diagnostics (IVD)
Medical devices intended to perform diagnoses from assays in a test tube, or more generally in a controlled environment outside a living organism.
Southern blot
Method can be used for RFLP analysis
IHC, rtPCR, FISH
Methods used to assess overexpression of common oncogenes
What is eukaryotic cell division?
Metosis: 1 diploid cell (2n) duplicates its DNA (in S-phase), then splits that DNA up into 4 genetically unique haploid cell (n)
1 - 4mM
MgCl2 concentration for PCR
What are the mechanisms that chemical mutagens use to alter DNA?
Mimic the correct nucleotide bases in a DNA molecule, but fail to base pair correctly during DNA replication Remove parts of the nucleotide, again causing improper base pairing during DNA replication Add hydrocarbon groups to various nucleotides, also causing incorrect base pairing during DNA replication
DNA Polymerase gamma (Eukaryotic)
Mitochondrial replication only
What are the steps in meiosis?
Mitosis follow by first stage of meiosis Prophase of meiosis I homologous chromosomes crossing over Pair and swap and separated Second stage meiosis sister chromatids pulled apart-ed resulting in 4 cells (1 copy- 23 chromosomes)
Retrotransposons
Mobile genetic elements which can increase genome size and insert itself within coding/noncoding regions
What is the theory behind the Sanger (dideoxy) sequencing method?
Modification of the DNA replication process A primer complementary to sequences 5' to DNA region to be sequenced is used
What is the tissue-specific molecular targets?
Molecular characteristics of the type of tissue from which a tumor arose Presence of DNA or RNA from these targets in abnormal amounts or locations is used to detect and monitor Antigens, gene rearrangements Although useful these markers are expressed by normal cells so they do not always prove the presence of cancer
What is the genetic abnormality of: 45, X
Monosomy X, Turner's syndrome
What are the advantages of chain termination (Sanger) sequencing method?
More effecient than Maxam/Gilbert and can read sequences 300-400 bases
What the benefits of pharmacogenomics?
More powerful medicines Better, safer drugs the first time More accurate methods of determining appropriate drug dosages Advanced screening for disease Better vaccines Improvements in the drug discovery and approval process Decrease in the overall cost of health care
What are the disadvantages of using molecular-based methods as compared to traditional culture-based methods?
More rigorous lysis procedures depending on microorganism Inactivate inhibitors Inactivate RNAses if RNA is going to be analyzed Contamination Preserve viability
KRAS
Most common oncogene in human cancer, which activates MAPK pathway
t(11,22)(q24,q12)
Most common translocation in 85% of Ewing's sarcoma
DNA Polymerase epsilon (Eukaryotic)
Mostly for DNA repair, can substitute for delta
What are the disadvantages of polymerase chain reaction?
Must know sequence of DNA of interest Highly susceptible to contamination or false amplification Amplification not 100% specific Specificity of amplification dependent on temp. & Mg concentration Analysis & product detection longer than PCR reaction itself
BRCA1
Mutations in this gene increase lifetime risk of developing breast or ovarian cancer to 60-80%
What is SDA used to detect?
Mycobacterium tuberculosis Chlamydia trachomatis
Monitoring the load of HIV circulating in a patient's plasma would best be accomplished using which method
NABSA
What viral load method need the smallest sample volume? The largest?
NASBA bDNA
Should you freeze blood or bone marrow if you are going to use it in a molecular assay?
NO
Can viral load testing for HIV be used as a diagnostic test?
NO But it can predict progression to AIDS
Signal amplification
No change in the number of target or probes
Is 47;XXY a normal karyotype?
No, this is XXY syndrome
Will dads with an x-link dominant disorder have sons that have it?
No. Dad will have only given his good Y to have a boy
Can you use Southern Blot and PCR for diagnosis of Hodgkin's Disease?
No. They don't work well for this.
SyBr green
Non-specific intercalation into the minor groove of dsDNA, can be used in qPCR
9 to 37
Normal number of CAG repeats in Huntington gene
<60
Normal number of CGC repeats in FMR-1 gene
What is Northern blot?
Northern blot is an extension of Southern blot that uses RNA instead of DNA for testing.
What is the tumor-specific molecular targets?
Not expressed in normal cells Translocations, point mutations, polymorphisms in tumor suppressor or oncogenes
NASBA
Nucleic acid sequenced based amplification
2
Number of rings in a purine
Primer dimers
Occur when there are 3 or more complementary 3' bases
How can genomic imprinting (epigenetics) affect disease phenotype?
Occurs during production of egg and sperm Revealed in diseases in which the maternal or paternal allele is lost ( uniparental disomy/ deletion) Gene silencing due of methylation C residues and other modifications
health, flammability, reactivity
On the diamond hazard symbol, blue is for _________, red is for ___________, and yellow is for ______________.
Pyrimidine
One carbon ring Cytosine, Thymine, Uracil
What is the chemical (Maxam/Gilbert) sequencing method?
One end of DNA region is radioactively labeled Labeled fragment is aliquoted into four tubes Each aliquot treated with a different chemical Addition of 10% piperline (reducing agent) will break ssDNA at specific nucleotides Contents of each tube separated on a denaturing polyacrylamide gel Fragments run according to their size; smallest represent base closest labeled ed fragment & sequence read bottom of gel to top
Define peptide site
P site; peptidyl site, location of charged tRNA binding in the ribosome complex
t(1;13) & (t2;13) - t(2;13) most common
PAX3-FKHR & PAX7-FKHR (paired box-forkhead in rhabdomyosarcoma)
What are some methods that can detect hemochromatosis?
PCR RFLP
What are some methods that can be used to detect CF?
PCR RFLP sequencing dot blot/ reverse dot blot
How can you get simultaneous detection and speciation of a bacteria?
PCR + probe (hybrid) PCR + restrictoin digest (southern) PCR + sequence
Real-Time PCR/qPCR
PCR based method which is used to amplify and quantify a targeted DNA molecule. Enables both detection and quantification. The quantity can be either an absolute number of copies or a relative amount when noramalized to the DNA input.
Scorpion probes
PCR prod is covalently bound to dye; primer is bound to molc beacon type seq After extension, target specific seq will unfold w/ the newly synthesized target seq, separating R and Q
What molecular methods are based on target amplification?
PCR, PCR variations, TMA (Transcription-mediated technology), NASBA
What are some molecular methods used for identifying infectious diseases?
PCR/ RFLP probes (RT-PCR) sequencing
idiopathic congenital central hypoventilation syndrome (cchs)
PHOX2B gene, GCn expansion; disease severity increases with increasing # of repeats
likelihood of biological parent (parternity index)
PI = X/Y
Which statement is true concerning molecular-based paternity testing
Paternity index is calculated for the alleged father using all loci tested, even if one of the loci does not directly match the child
What are the enzymes and reagents utilized to isolate nucleic acids.
Phenol/chloroform, spin columns/glass beads, detergent, ficoll, crude lysate, enzymatic microorganisms, proteinase K, RNAse, & DNAase
What are examples and mechanisms of damage reversal?
Photoreactivation (is the recovery from biological damage caused by UV-C radiation) Ligation of single strand breaks (DNA ligase)
What are steps used for cloning?
Plasmid Restriction Endonuclease treatment Ligation of foreign DNA Transformation of Bacteria Growth of bacteria Isolation of cloned DNA
RET
Point mutations in this gene cause multiple endocrine neoplasia
What are several target amplification methods?
Polymerase chain reaction: basic multiplex nested real-timed arbitrarily primed Transcription based amplification systems: nucleic acid sequence-based amplification (NASBA) transcription-mediated amplification (TMA) self-sustaining sequence replication (3SR)
Alterations shared in DNA by at least 2% of the population
Polymorphism
What are the basic components of molecular controls?
Positive, negative and sensitivity controls are required, high-positive and negatives maybe included in testing sets. For amplification procedures an amplification control is required also internal controls are ran simultaneous PCR methods require standard curve or dilution series of the positive control
EBV - Epstein-Barr virus aka "Herpes"
Post-transplant Lymphoproliferative patients
FISH
Prade-Willi
What are the translocations associated with hematological malignanies that can be used for molecular testing
PreB ALL t(1;19) B-cell leukemia t(2;8), t(8;14), t(8;22) CML t(9;22), t(11;22) ALL t(9;22), t(12;21), t(8;14), t(2;8), t(8;22), t(11q) Follicular t(14;18), t(8;14)
Irinotecan
Prevents DNA from unwinding by inhibition of topoisomerase 1 Inactivated by glucuronidation to uridine diphosphate glucoronosyltransferase 1A1 (UGT1A1)
Hot-start PCR
Prevents mispriming and can be done by pre-warming thermocycler, wax, or sequestered polymerases
CMS
Previously known as the Health Care Financing Administration (HCFA), is a federal agency within the United States Department of Health and Human Services (DHHS) that administers the Medicare program and works in partnership with state governments to administer Medicaid, the State Children's Health Insurance Program (SCHIP), and health insurance portability standards. In addition to these programs, CMS has other responsibilities, including the administrative simplification standards from the Health Insurance Portability and Accountability Act of 1996 (HIPAA), quality standards in long-term care facilities (more commonly referred to as nursing homes) through its survey and certification process, and clinical laboratory quality standards under the Clinical Laboratory Improvement Amendments.
DNA Polymerase III (Prok)
Primary enzyme involved in replication Exonuclease activity
DNA Polymerase α (Euk)
Primase DNA dependent DNA & RNA pol
Scorpion-type primers
Primers tailed with molecular beacon-type sequences
Qβ replicase
Probe amplification Target (ssDNA/RNA) and to tube w/ reporter probe (has QB reporter Target:reporter hyb to capture probes > complex is hyb to capture probe with magnetic bead > complex is bound to well and washed Target:reporter released > QBpol is added > probe is amplified and detected via colorimetric or flurogenic methods Detects: mycobacteria, Chlamydia, HIV, CMV
Multiplex Ligation-dependent Probe Amplification (MLPA)
Probe amplification; multiple targets amplified in a single rxn 2 oligos: both contain sequence specific probe and universal primer Oligos hybridize adjacent to each other > ligase closes gap > PCR with primers that are specific to universal primer sites on the oligos
Analyte-specific reagent (ASR)
Probes, primers, antibodies or anything else used to detect a specific target
DNA Polymerase I (Prok)
Processes Okazaki fragments Replaces RNA primers with DNA (exonuclease activity) Excision repair & proof reading
Feedback inhibition
Product of pathway is noncompetitive inhibitor Binds to allosteric site to slow down rxn b/c too much product
Analytic accuracy
Production of correct results - how close test result is to true value; freedom from error
What are the difference between Prokaryotic and Eukaryotic transcription?
Prokaryotic: occurs in the cytoplasm alongside translation mRNA is usually not modified Eukaryotic: Localized in nucleus. Transcription is transported to the cytoplasm where translation occurs DNA wound around histones form nucleosomes. Chromatin influence the accessibility of DNA transcription factors mRNA modified RNA splicing 5' end capping and addition of polyA tail
Exonuclease II
Proofreading function of the pol Degrades ssDNA from 3'-->5'
A260/A280
Protein < 1.8-2.0 < RNA
DNA
Purified ______ can be stored for 1 year at 4 degrees
What are alternative two methods of sequence DNA?
Pyrosequencing Bisulfite sequencing
Linearity
Quantitative correlation between test result and actual amount of analyte
Mutation Nomenclature for protein sequence
R197G R-original amino acid 197-base position G-replacement amino acid
What method can you use to detect Sickle Cell anemia?
RFLP
What some indirect analysis methods?
RFLP linkage analysis
What is Mtb genotyping that is used to type bacterial strains in epidemiological investigation?
RFLP-IS110 sequence MIRU- mycobacterial interspersed repeat units & repeats that vary in length and sequence spoligotyping
Which is the starting template for RT-PCR?
RNA
RT-PCR
RNA ---> cDNA first strand synthesis primer dependant polymerase dependant rxn
2.0 - 2.3
RNA 260/280
DNA 260/280 > 2.0
RNA contamination
RNA pol I
RNA pol that synthesizes 28S, 18S, and 5.8S rRNA
RNA pol II
RNA pol that synthesizes mRNAs, snRNA, and microRNAs
RNA pol III
RNA pol that synthesizes tRNAs, 5S rRNA, and other small RNAs
What are the enzymes and structures necessary for transcription?
RNA polymerase, promoter, DNA regions, consensus sequence, mRNA, global regulation, operon, ATP and antisense RNA
micro RNA (miRNA)
RNA that controls gene expression by pairing with complementary seq. of mRNA, inhibiting translation
small nuclear RNA (snRNA)
RNA that functions in splicing in eukaryotes; stays in nucleus after transcription by RNA pol I or III
Define antisense RNA
RNA that is complementary in sequence to the mRNA and therefore base pairs with it; prevents the mRNA from binding to the ribosome-blocking translation
Reverse transcriptase would best be described as a
RNA-dependent DNA polymerase.
The three biochemical activities of reverse transcription
RNA-dependent DNApol, Ribonuclease H, and DNA-dependent DNApol --> all used to create ds cDNA from RNA
Blotting: northern technique is used for what type of nucleic acid?
RNA; probed with radioactive DNA or RNA, molecular weight measure in nucleotides or nt
Early diagnosis of EBV
RT-qPCR
38 to 86
Range of CAG repeats in affected Huntington disease patient
1 to 4 mM
Range of MgCl2 for PCR
50,000 to 250,000 bp
Range of fragments sizes resolved by PFGE
What are the advantages of using molecular-based methods as compared to traditional culture-based methods?
Rapid or high throughput identification of microorganism Genotyping Classification Discovery of new microorganisms
What are the causes and symptoms for the Huntington's disease?
Rare inherited neurological disorder Caused by trinucleotide repeat expansion in Huntington (Htt) gene (4p16.3), Sequence CAG expands from 9-37 repeats to 38-86 Normal -5-55 (10-26), carrier- 56-200 (27-41) & affected- 200-2000 (36-121) Autosomal dominant Symptoms: Abnormal body movement, chorea Lack of coordination Affects # of mental abilities Noticed in forties but occur any age
What are the causes and association of the soft tissue sarcoma like Synovial sarcoma.
Rare type: 8-10% sarcomas; Young adults t(X;18) reciprocal translocation fuses SS18 or SYT with X (SSX1 or SSX2) detected by FISH or RT-PCR
What are documentation and reporting of results?
Raw data is retained with the final report and clinical interpretation of the test results Must convey the method or manufactured kit used, the loci, mutation or organism tested, the analytical interpretation of the raw data, and the clinical interpretation of the analytical result
Complement-dependent cytotoxicity test (CDC)
Receipient alleles determined by using a panel of Ab against known HLA types Cross-reactive: leukocyte being tested has Ag matching Ab in well
HER2(ERBB2) - 17q21.1
Receptor tyrosine kinase commonly overexpressed in breast cancer
A small portion of chr 2 has been found on the end of chr 15 and a small portion of chr 15 was found on the end of chr 2. This mutation is called a:
Reciprocal translocation
What are examples and mechanisms of damage tolerance?
Recombination repair Mutagenic repair
Exonuclease III
Removes 5' mono-nt's from the 3' end of the dsDNA in the presence of Mg2+ and Mn2+. Removes nucleotides from blunt ends, recessed ends, and nicks, but NOT overhangs!
What indicates normal, a premutation and disease in an individual with Huntington's Disease?
Repeat ranges for Huntington's disease Normal - 10-26 Premutation - 27-41 Affected - 36-121
Telomeres
Repeat sequence (TTAGGG) at the ends of chr, protect chr from degradation
How does PFGE separate larger fragments more efficiently than standard electrophoresis?
Repeated reorientation forces larger fragments through the gel matrix more efficiently
Endonucleases (Prok)
Restriction enzymes Cleaves phoshpodiester bonds w/i poly-nt chain Recognition site is palindromic sequence Types I-V
RFLP
Restriction fragment length polymorphism
What method would you use if you knew the gene sequence and the mutation?
Reverse Dot Blot
Telomerase
Reverse transcriptase
A-DNA conformation
Right-handed Deep narrow major groove, wide shallow minor groove Dehydrated DNA takes this form
B-DNA conformation
Right-handed Wide major groove, narrow minor groove Common form found in cells
Viral
Room temperature storage of whole blood is recommended for _______ RNA
Electrophoresis: capillary technique is used for what type of nucleic acid?
SDS-gel molecular weight of protein & sizing of DNA sequencing and genotyping; replaceable physical gel allows similar charge-to-mass ratios separate by size
The fluorescent dye that exhibits the greatest sensitivity for quantization of DNA is
SYBR green
HLA Crossmatching
Screen recipient sera for antibodies against potential donors
Amplification control
Second set of primers to unrelated target
What is mitochondrial DNA typing?
Sequence differences in the hypervariable regions (HV1 and HV2) of the mitochondrial It can be used for legal exclusion of individuals or confirmation of maternal lineage
Name 3 assays by which Factor V Leiden R506Q mutation can be detected:
Sequence specific PCR, PCR-RFLP, Invader Assay
SSOP
Sequence specific probe hybridization
What is the DNA-based testing methods that are used for the identification of HLA antigens?
Sequence-specific oligonucleotide probe hybridization dot blot SSP-PCR allele-specific primers Sequence-based typing polymorphic region amplified by PCR & then sequenced
SOLiD Sequencing (NextGen)
Sequencing by ligation. A pool of all possible oligonucleotides of a fixed length are labeled according to the sequenced position. The oligonucleotides are annealed and ligated, the preferential ligation by DNA ligase for matching sequences results in a signal informative of the nucleotide at that position. Before sequencing, the DNA is amplified by emulsion PCR and the resulting beads (each containing single copies of the same DNA) are deposited on the glass slide for sequencing.
Drug metabolism
Several genes are responsible for variances in drug metabolism and response, CYP450 is the most well known CYP metabolism phenotypes: extensive metabolizer (EM), intermediate, ultra-rapid, and poor
SINES
Short interspersed nucleotide sequences 0.3 kbp
Enhancers
Short regions of DNA that bind proteins (TXN factors) that enhance TXN of a gene
STR
Short tandem repeats - 1 to 10 bases
What are some facts that identify short tandem repeats (STR)?
Shorter blocks of repeated sequences Smaller repeat units of 1-7 bp Sometimes contain repeat units with altered sequences or microvariants (repeat unit missing one or more bases of the repeat) Repeats of nucleotide sequences (mono, di, tri, tetra, & penta) Different alleles contain different # of repeats Can undergo expansion or shrinkage through generation
The disease that we have covered that is caused by one gene and one mutation (an A to a T) is:
Sickle Cell Anemia
Hybrid capture assays (HCA)
Signal amplification Target DNA is released from the cell, denatured, and binds RNA probe DNA:RNA is recognized and binds Ab on solid support DNA:RNA are detected by adding Abs that bind w/ AP, substrate is added
What are the advantages of polymerase chain reaction?
Simple, rapid, relatively inexpensive Minute amount of DNA or RNA amplified from clinical samples High sensitivity and specificity High-yield amplification achieve Many usages of PCR DNA sequence up to 30 kb can be amplified
Haploid
Single copy of each chr (humans have 23)
What are the mechanisms that spontaneous mutations use to alter DNA?
Sometimes DNA nucleotides shift without warning to a different chemical form; isomer isomer will form a different series of hydrogen bonds with it's partner leads to mistakes at the time of DNA replication
What method can you use to detect Fragile X?
Southern blot
How can you detect a Non-Hodgkin's lymphoma?
Southerns PCR FISH
What is the optimal conditions for holding and storage of specimens and nuclei acid?
Specimen: Blood, bone marrow, fluids <1 day, 23 degree; 3 days, 4 C, WBC > 1 year -20 C or -70C Tissue 23 C, not recommeded, < 1 day 4 C, > 2 wks -20 C, > 2 yrs -70 C Isolated: < 26 wks 2-25 C, 1-3 yrs 4 C (one yrs southern blot) & <7 yrs -20 C, -70 C (not frost-free)
What is the optimal conditions for holding and storage of specimens and ribonuclei acid?
Specimen: Blood, bone marrow, fluids <2 hrs, 23 C or 4 C; 5 days, 23 C; 7 days 4 C in denaturant, 1-2 wks -70 C in denaturant; WBC 2-4 weeks -20 C > 6 mths -70 C Tissue < 2 hrs 4 C; snap frozen, -70 C > 2 yrs; nitrogen -140-150 C > 2 years Isolated: 2-25 C (not recommended), 30 days -20 C in DEPC-treated water, 30 days -70 C in DEPC-treated water, >6 mnths -70 C in ethanol
Why is the lectin, phytohemagglutinin (PHA), added to a cell culture when preparing cells for karyotyping?
Stimulates mitosis in the cells
Most cancerous HPV
Strain 16 - 70% of all cases
SDA
Strand displacement amplification
What molecular methods are based on probe/primer amplification?
Strand displacement amplification and Ligase chain reaction
RNA Polymerase II
Synthesize mRNA, snRNA
RNA Polymerase I
Synthesize rRNA
-10 box
TATA box (TATAAT) located 10 bases away from transcription start site promoter RNA pol binding site
Mycobacterium
TB ID can take up to several months Opportunistic Multiple co-infections
What is the short tandem repeat within gene name?
TH01 intron 1 of human tyrosine hydroxylase gene on chromosome 11 THOX intron of human thyroid peroxidase gene on chromosome 2
Common tumor suppressor
TP53
-35 box
TTGACA located 35 bases away from transcription start site promoter
What are the various methods used to amplify nucleic acid?
Target amplification Probe amplification Signal amplification
-70C
Temperature for DNA to be stored for >6 months
50-72
Temperature range for annealing step of PCR
90-96
Temperature range for denaturation step of PCR
68-75
Temperature range for extension step of PCR
Why are thalassemias found in areas like Africa, India SE Asia and the Caribbean?
Thalassemias offer some resistance to malaria, which is why they have not been weeded out of malaria endemic populations
CAP
The College of American Pathologists (CAP), is a medical society serving more than 18,000 physician members and the global laboratory community. It is the world's largest association composed exclusively of board-certified pathologists and pathologists in training and is the worldwide leader in laboratory quality assurance. The College advocates accountable, high-quality, and cost-effective patient care.
What is gender identification using the amelogenin locus?
The amelogenin locus gene is NOT an STR Amplification and resolution reveals two bands or peaks for males (XY) and one for females (XX) Located at Xp22.1-22.3 and Y (218 bp) Y allele of gene is 6 bp larger than X allele (212 bp) often analyzed with STR
Describe the growth of the nucleic acid chain
The chain grows by the attachment of the 5' phosphate group of an incoming nucleotide to the 3' hydroxyl group of the last nucleotide on the growing chain
What is the proper specimen accession for molecular testing?
The condition of the specimen and, if necessary the chain of custody is reviewed upon receipt in the laboratory No specimen is accepted without proper labeling and identification
What is the difference between the leading strand and lagging strand during DNA replication?
The leading strand is made continuously lagging strand made in short segments & join together
What are the least three uses for proteomics in molecular diagnostics?
The level of transcription of a gene gives only a rough estimate of its level of expression into a protein Many proteins experience post-translational modification that profoundly affect their activities; some proteins are not active until they become phosphorylated Many transcripts give rise to more than one protein, through alternative splicing or alternative post-translational modifications
6
The major histocompatability complex (MHC) is found on this chromosome
A PCR-based assay is performed to determine the clonality of B cells in a patient using a forward primer specific for the innermost framework region and a reverse primer complimentary to the joining region (of the immunoglobulin heavy chain). When run on an agarose gel containing ethidium bromide, the patient sample exhibits a smear of staining over a wide range in the patient sample lane along with one distinct band approximately a third of the way down from the sample loading well. Assuming all controls worked properly for the assay, what if your interpretation of the results for this patient
The patient has a monolonal population of B cells
Pleiotrophy
The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as:
Analyte measurement range
The range within which a specimen may be measured directly (without dilution of concentration)
Reportable range
The range within which test results are considered valid (with or without dilution)
Low, intermdeiate
The resolution of SSOP is ____ to ________.
Pharmocogenomics
The study of genetic factors that influence how a drug works. The goal is to understand how a person's genotype affects an individual's response to drugs. It deals with the influence of genetic variation on drug response in patients by correlating gene expression or snp's with a drug's efficacy or toxicity
What are the basic components of molecular quality assurance?
The test should have defined dynamic range, sensitivity level, and accuracy Assay levels should show distinguish positive from negative with cut-out values being understandable and verifying at regular intervals
Long DNA can retard the mobility of fragment, so how does the pulsed-field electrophoresis overcome this?
The voltage gradient is periodically re-oriented which helps overcome this.
BCL2
This gene is often involved in translocations in follicular lymphoma
t(9;22)
This translocation is also known as the Philadelphia chromosome
Colon cancer
This type of cancer is associated with a defective mismatch repair system (MMR)
What is the calculation of melting temperature?
Tm= 4(# of G&C) + 2(# of A&T) G/C content of 20-80%
What if you have too many ddNTP in a DNA sequencing run? too low of ddNTP?
Too many ddNTPs will result in a short read. Too low will result in loss of sequence data close to the primer but give a longer read.
RET
Translocations involving this gene commonly cause papillary carcinoma
Carbemazepine (Tegretol)
Treat bipolar disorder, seizures, neuropathic pain Dangerous/fatel skin rxns w/ HLA alleles: HLA-B*1502 HLA-B58
Gefitinib (Iressa)
Treats EGFR+ (Her1, Her2) breast cancer Tyr kinase antagonist Metabolized by CYP3A4 to its active form
Tamoxifen
Treats ER+ breast cancer ER antagonist Metabolized by CYP2D6 and 3A4 to its active form
Trastuzumab (Herceptin)
Treats Her2/Neu/ErbB2+ (17q12 over expression) breast cancer. mAb binds extracellular domain of EGFR receptors, blocking mitogen binding
What is the genetic abnormality of: 47,XY,+18
Trisomy 18: Edwards Syndrome
Downs
Trisomy 21, 47,XY+21
A CEN probe is used to visualize chr 21. Three fluorescent signals are observed in the patient's cells when they are stained. These results are consistent with what chr disorder?
Trisomy 21, Down's syndrome
What are several examples of Abnormal sex chromosome inheritance?
Turner syndrome & Klinefelter syndrome
Diploid
Two copies of each chr (humans have 46)
MSH2 and MLH1
Two gene associated with the cancer, HNPCC
PML/RARA
Two genes commonly translocated in acute promyelocytic leukemia
Human papillomavirus (HPV)
Types 16 and 18 cause most cervical cancers
20 to 30 bases
Typical size range of a PCR primer
What are the mechanisms that sunlight use to alter DNA?
UV light absorb by DNA, it causes a cross link to form between certain adjacent bases occasionally unrepaired dimers develop and cause the replicating system to skip over the mistake leaving a gap
Gyrase (topoisomerase II)
Unwinds supercoiling caused by unwinding at the rep fork by introducing DSBs
Melt Curve Analysis
Used for SNPs; Specimens with identical sequences should yield the same peak at the expected Tm and specimens containing different sequences will yield two or more peaks. (FRET Probes - dissociation curves)
Single-Stranded Conformational Polymorphism Ananlysis (SSCP)
Used for known gene, unknown mut Mutation screening Short PCR products form 3D conformation when cooled --> muts have different conformation than WT Non-denaturing PAGE, muts migrate different than WT
Microarrays
Used for unknown gene and mutation cDNA libraries can be used for gene expression, tumors, genetic mapping, mutations and polymorphism large scale, high throughput analysis
Sequence Based Nucleic Acid Amplification (NASBA)
Used to amplify RNA sequences; Primer-dependent technology that can be used for the continuous amplification of nucleic acids in a single mixture at one temperature; works at 41 C
Reverse Transcriptase PCR
Used to detect RNA expression levels. RT-PCR is used to qualitatively detect gene expression through creation cDNA transcripts from RNA.
In-situ hybridization
Used to detect protein, RNA, and DNA within the cell. Probes bind to the DNA and can be visualized under the microscope. Depending on the mutation, different signals can be seen - deletions and duplications. Sensitivity can be increased by using dual fusion probes, break apart probes, centromeric probes, and telomeric probes.
Restriction fragment length polymorphism (RFLP)
Used to detect sequence alteration in retriction enzyme fragments; The region surrounding the mutation is amplified and the mutation is detected by cutting the amplicon with the correct restriction enzyme
Interphase FISH
Used to study prenatal samples, tumors, and hematological malignancies Cells do not have to be cultured Fix cells Hyb to probe (dual fusion, break-apart, CEN, telomere)
Metaphase FISH
Used to study smaller abnormalities Culture cells for 72 hrs Add colcemid to arrest cells in metaphase Fix Hyb to probe (chr paint)
Psoralens
Used with UV light after PCR to control contamination
HLA serological analysis
Uses antigen-antibody recognition
Ligase chain reaction
Uses biotin-strepavidin system and does not amplify target, so probe amplification
Fluorescent in situ hybridization (FISH)
Uses fluorescent probes to detect DNA sequences on chr
IonTorrent sequencing (NextGen)
Uses standard sequencing chemistry, but a semiconductor based detection system. Based on the detection of hydrogen ions that are released during the polymerization of DNA as opposed to the optical methods. A microwell containing a template DNA is flooded with a single type of nucleotide (A,T,G,C) and if the nucleotide is complementary to the template it is incorporated into the growing strand of DNA. This causes the release of hydrogen ions that triggers the sensor.
Dual fusion probes
Uses two pairs of probes with different fluor dye Bind regions that span the breakpoint of both t partners If t is present, signal from both dyes should be present
VNTR
Variable number tandem repeats - 10 to 50 bases
What are the theory of the steps used for cloning?
Vector containing a gene for antibiotic resistance (DNA of interest) Restriction Endonucleases cut the DNA of interest Plasmid Insert the DNA of interest into plasmid (ligation) Recombinant DNA inserted into bacteria Plate on medium with antibiotic Growth of bacteria with recombinant DNA
Cutaneous T-Cell Lymphoma (CTCL)
Vorinostat - 1st FDA approved drug (also treats Sezary syndrome)
Monoclonal
When over 1% of cells make the same gene rearrangement, the cell population is called ________.
5-10% bleach
Which of reagent will successfully decontaminate a bench top that has been exposed to DNA amplification products?
Haemophilia
X, XR Blood does not clot due to a deficiency in a coag factor Haemophilia A: most common, factor VIII deficiency
What kind of disorder is Fragile X?
X-linked dominant trinucleotide repeat disorder (CGG repeat expanded)
Muscular dystrophy (DMD/BMD)
Xp21, dystrophin gene; XR Causes muscle weakness and muscle loss DMD: non-functional protein made BMD: some function of protein is retained
Fragile X syndrome
Xq27 FMR1, CGG repeat 5' UTR causes methylation Mental retardation WT repeats 5-55, carrier 56-200, mutation 200-2000+ Dx: PCR, S. blot for full mutation
one mutation every 20 generations (per locus)
Y chromosome mutation rate
Should you lyse RBCs before freezing?
YES
An RNA preparation has the following readings: 260=0.208 280=0.096 Is this RNA suitable for use?
Yes, 2.17 is suitable for RNA analysis A260/A280 = 0.208/0.096
Do you have to know the gene sequence in order to do DNA sequencing?
Yes, in order to design primers You do NOT need to know the mutation
Low
_____ Mg2+ will increase fidelity of PCR
TaqMan
________ probe is displaced by polymerase and degraded by exonuclease activity, thereby activating the probe's fluorophore
Waived
________ tests do not require proficiency testing.
Yellow
_________ colored ACD collection tubes are commonly used in molecular biology
Cystic fibrosis
_________ is caused by a 3 bp deletion in a chloride channel gene
Molecular Beacon
_________ probes fluoresce only after they have hybridized to target
Hemoglobin and anticoagulants
______________ and ____________ will interfere with molecular biology based tests
Define polypeptide chain
a chain of amino acids; a protein
Polymorphism
a change in the DNA sequence that is present in at least 1-2% of the population (ex. Sickle cell anemia)
Cri-du-chat syndrome
a characteristic cry gives the syndrome its name; 5p-
Solenoid
a coil of six nucleosomes wound into a tightly packed helix
What's the purpose of the ethidium bromide of agarose gel electrophoroesis?
a fluorescent dye used for staining nucleic acids; hazardous: mutagen
Define Mutations
a harmful alteration in the nucleotide sequence of a gene
Define carrier
a heterozygous individual who has no apparent abnormality but can pass on an allele for a recessively inherited genetic disorder
Define recombination
a natural process in eukaryotes and prokaryotes to produce offspring with a new genetic combinations (recombinants)
Define codiminance
a pattern on inheritance in which both alleles of gene are expressed
What is the theory of polymerase chain reaction?
a primer-directed in vitro enzymatic reaction for the production of a specific DNA fragmented. To amplify small target sequences from DNA (or RNA) using a thermostable DNA polymerase (taq polymerase).
gene
a segment DNA codes for protein turn codes for trait
Alpha - Thalassemia
a series of alpha-globin mutations normal = 4 functional a-globin genes silent carrier = 3 good, 1 mut mild anemia, carrier = 2 good, 2 mut symtomatic= 1 good, 3 mut fatal = 4 deletions
Pleiotrophy
a single gene controls the expression of many phenotypic traits ie Sickle Cell Anemia
polysome
a single mRNA usually has many ribosomes traveling along it,in various stages of synthesizing the polypeptide
Missense mutation
a single nucleotide is changed to cause a substitution of a different amino acid
lab developed tests (LDT)
a term used to refer to a certain class of in vitro diagnostics (IVDs). In the United States, the Food and Drug Administration has determined that while such tests qualify as medical devices, FDA will allow these products to enter the market without prior approval from the Agency.
Define bacteriophage
a virus that parasitizes a bacterium by infecting it and reproducing inside it
What are the values of homologous intrinsic of internal controls in amplification in the reliability of PCR results?
a wild-type derived control with a non-target-derived amplification sequence insert
Define Chromosomal aberrations
absence of a chromosome or large portions of one; presence of one or more "extra" chromosomes
dna = 50, rna = 40
absorptivity constants
[(TN+TP)/(TN+TP+FN+FP)] x 100
accuracy
increases
acetylation of nucleosome __________ expression
Define helicase
activity in the replisome unwinds and untangles the DNA for replication by disrupting hydrogen bond between the strands
Define ligase
acts like glue to seal all of the nicks
Define genotype
actual genetic makeup; genetic DNA composition of an organism
What are the two types of Hepatitis infections?
acute - complete recovery chronic - liver damage
What are the four types of lymphomas?
acute lymphocytic leukemia chronic lympoid leukemias non-hodgkin's lymphomas Hodgkin's Disease
Define transfer RNA
adapters that links codons in messenger RNA with amino acid
Define methylase
add methyl groups to new DNA at the same positions as original
5' cap
added to 5' end of finished mRNA let's cell know it's ready for translation ribosomal binding site
Define acceptor site
adjacent site, location of incoming charged tRNA binding in the ribosome complex for acceptance of the growing peptide
Gene mutations
affect single genes and are often small changes in the DNA sequence
Wolf-Hirschhorn syndrome
affected individuals have a "greek helmet" face; 4p-
Klinefelter syndrome
affected males tend to be tall with long arms and legs with small testes & infertile; 47XXY
.5 - 1%
agarose gel % for large DNA fragments (2,000 - 50,000bp)
2 - 3%
agarose gel % for small DNA fragments (50-500bp)
bDNA enzyme
alakaline phosphatase
X-Linked Dominant
all female offspring of affected male will have disorder (because they are only getting dad's bad X) no carriers = affected parent, affected kid
What makes DNA negatively charged?
all the phosphate groups
HLA-B*1502
allele causes hypersensitivity reaction to carbamazepine; drug used for acute manic and mixed episodes of bipolar I disorder, neuropathic pain, partial and generalized seizures, trigeminal neuralgia, and other indications
Which probe is most often used to detect trisomy 21 by interphase FISH
alpha satellite DNA probe
field inversion gel electrophoresis (FIGE)
alternating (+) and (-) electrodes during electrophoresis
Which locus is used to identify the gender of the individual from whom a DNA sample is obtained
amelogenin
Proteins are:
amino acids that are made as a linear polypeptide chain that then folds into the appropriate structure.
The enzyme that attaches amino acids to transfer RNA is called:
aminoacyl-tRNA-synthetase
Ligase Chain Reaction (LCR)
amplification of copy number good for specific mutations uses DNA ligase two primers directed against target sequence
Q-beta replicase
amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present
PCR
amplifies the target and uses DNA polymerase
LCR
amplifies the target using DNA Ligase
NASBA
amplifies the target using a combination of a three-enzyme system
TMA
amplifies the target using reverse transcriptase
Derivative
an abnormal chromosome formed from portions of 2 or more chromosomes
Point mutations
an alteration of one nucleotide
What is use for pharmacogenomics such as herceptin?
an antibody that was developed that latches onto the her-2/neu proteins on the surface of a cancer cell demonstrated that cancer growth slowed or stopped altogether when combined with cytotoxic chemotherapy
What can cause primer dimers?
annealing temp too low too much primer
50 - 70°C
annealing temp.
What is the most critical step in determining the specificity of a PCR reaction
annealing temperature
Which statement concerning the resolution of DNA on an agarose gel is true
as concentration of agarose in the gel increases, the smaller the size of DNA that can be resolved on the gel
What does DNA polymerase III (POIIII) do?
attaches new deoxynucleotides (dNTPs) 3' OH end of the leading strand which elongates toward the replication fork
The methodology of performing a reverse dot blot is best described as
attaching multiple probes to a nitrocellulose membrane and then hyrbridizing a single labeled patient sample to the multiple probes
Charcot-Marie Disease is what kind of disorder?
autosomal dominant
Hereditary cancers usually have a __________ pattern.
autosomal dominant
Martan's disease is what kind of disorder?
autosomal dominant
Huntington's Disease is what kind of disorder?
autosomal dominant tinucleotide repeat
Tay-Sachs is what kind of disorder?
autosomal recessive
Sickle cell anemia is what kind of disorder?
autosomal recessive homozygous one gene, one mutation (single gene disorder)
Gaucher is what kind of disorder?
autosomal recessive located on Chromosome 1
Galactosemia is what kind of disorder?
autosomal recessive metabolic disorder heterozygotes are carriers (one normal gene, one mut)
Cystic Fibrosis is what kind of disorder?
autosomal recessive one gene, one mutation (sigle gene disorder)
Hemochromatosis is what kind of disorder?
autosomal recessive single gene disorder G to A transition (Cys to Tyr)
Define start codon
"AUG"
Stop codon
"UAA, UAG and UGA"
Smith-Magenis syndrome
(-17p) infants tend to be lethargic and may have minor morphological anomalies
# of amplification products
(1+E)^n
probability of paternity
(PI/ (PI+1) x 100
primase
(RNA pol) primers, small RNA, serves as starting points for copying DNA helper enzyme for DNA pol III
CPP (cumulative probablilty of paternity)
...
Viral load change HCV
.3log10
Viral load change HIV
.5log10
Calculate the concentration and yield of DNA from a given nucleic acid preparation. A DNA preparation diluted 1:100 yields an absorbance of 0.200 at 260 nm. If DNA was eluted in 0.5 mL.
0.200 X 50 ug/mL X 100= 1000 ug/mL 1000 ug/mL X .5= .500 ug DNA constant= 50 ug/mL
Calculate the concentration and yield of RNA from a given nucleic acid preparation. A RNA preparation diluted 1:10 yields an absorbance 260 nm at 0.500. If RNA was eluted in 0.2 mL.
0.500 X 40 ug/mL X 10= 200 ug/mL 200 ug/mL X .2= .400 ug RNA constant= 40 ug/mL
Optimization of PCR methods
1. Check the Tm 2. Mg2+ concentration - too little can result in no PCR product, and too much may produce noise 3. PCR cycles 4. Add, extend, or increase the temp of the initial template denaturation step 5. Concentrations of other buffer components 6. GC Content 7. Taq concentration
Pre-transplant evaluation
1. Determine HLA type: Serology 2. Determine serum Ab status: CDC, sequencing 3. Crossmatch: MLC, CDC, ELISA, flow cytometery
NASBA steps
1. Hybridize oligo-T7P primer to target seq 2. RT/RNase H 3. Hybridize with target-specific oligo primer (P2) 4. RNA transcript of T7 RNA pol
NASBA Steps
1. Hybridize oligo-T7P primer to target seq 2. RT 3. Digest with RNase H 4. Hybridize with target-specific oligo primer (P2) 5. RNA transcript of T7 RNA pol
Thermal Cycling steps in conventional PCR
1. Initialization (94-96 C) 2. Denaturation (94-98 C) 3. Annealing (50-65 C) 4. Extension (70-80 C) 5. Repeat 2-4 ~30x 6. Final Elongation (70-74 C) 6. Final hold
What are the steps in DNA replication?
1. Initiate 2. Elongate 3. Terminate
Line Probe Assay steps
1. Isolate nucleic acid (RNA) 2. Amplify 3. Hybridization 4. Strigent wash 5. Conjugate incubation 6. Substrate detection
Solid phase isolation
1. Lyse 2. Acidify (low pH) 3. Transfer to column (adsorption) 4. Wash 5. Elute
Inorganic isolation
1. Lyse 2. Add low pH/high salt soln (NaOAc ppt's proteins) > vortex/spin 3. Transfer soln to new tube 4. EtOH ppt 5. Resuspend
Organic isolation method
1. Lyse 2. Add phenol/ chloroform > vortex/spin 3. Transfer aqueous layer (top) to new tube 4. Add chloroform:IAA (removes phenol) > vortex/spin 5. Transfer aqueous layer to new tube 6. Add NaOAc and EtOH > vortex/spin 7. Decant 8. Resuspend
Steps in liquid phase DNA isolation
1. Lyse 2. Separate out contaminates (by spinning) 3. Add phenol/ chloroform. Mix and separate. Remove and keep upper layer 4. Precipitate out DNA w COLD EtOH 5. Treat to remove RNA 6. Inactivate treatment 7. Deproteinization with phenol 8. Re-precip DNA with EtOH
PCR process
1. Mix: taq, primers, dNTPs, DNA 2. Separate dsDNA (Denature) 3. Cool. Allow primers to bind, taq to add nt to 3' end of primers (Anneal) 4. Denature dsDNA again (new copy and original) 5. Cool 6. Repeat steps 4-5
Heterduplex Analysis steps
1. PCR 2. Mix sample and CTR DNA together 3. Denature PCR using heat 4. Cool slowly to rt 5. Add denaturing loading buffer 6. Run on MDE gel
Bisulfite DNA sequencing/Methylation specific
1. RE digest 2. Electrophorese and purify fragment of interest 3. Denature and incubate w/ sodium bisulfate (turns C>U, methylated C is unchanged) 4. clean, ppt, and resuspend 5. PCR --> sequence 6. Compare treated vs untreated, note where CG are not changed to TA
Southern Blotting Procedure
1. RE digest DNA 2. Gel electrophoresis 3. Soak in HCl (depurinates, weakens H-bonds) 4. Soak in NaOH (denatures) 5. DNA transferred to a membrane 6. Immobilize (UV or bake) 7. Pre hyb to block 8. Hyb with probe
Hybrid Capture II HPV test Steps
1. Release and denature nucleic acids 2. Hybridize RNA probe with DNA target 3. Capture RNA:DNA hybrid (tube or plate) 4. Add multiple AB conjugates 5. Detect by chemiluminescense
Southern Blot steps
1. Restriction enzymes cut DNA into fragments 2. Run on gel to separate 3. Soak gel in alkali to denature dsDNA 4. Transfer ssDNA fragments to positively charged membrane (blot) 5. Fix to filter by heat (80*) or UV crosslink 6. Incubate (hybridize) blot w/ radioactively labeled ssDNA comp probe 7. Autoradiograph
What are three types of nucleic acid amplification?
1. Target 2. Probe/Primer 3. Signal Amplification
[HLA Typing] Advantage of molecular testing over seriological phenotyping?
1. Viable cells are NOT needed 2. Null alleles can be detected
Methylated Sensitive PCR steps
1. convert DNA w/ sodium bisulfate 2. clean DNA 3. Mutiplex PCR 4. analyze size of fragments on gel (size dependant on methylation
Pulse Field Gel Electrophoresis steps
1. culture 2. embed pellet in agarose plug 3. treat w/ lysozyme (cell lysis) 4. proteinase K 5. gel
Pulse Field Gel Electrophoresis steps
1. culture 2. embed pellet in agarose plug 3. treat w/ lysozyme (cell lysis) 4. proteinase K 5. restriction enzyme digest 6. gel
Microarray steps
1. get mRNA from cells 2. RT to get labeled cDNA copies of mRNA 3. cDNA washed over slide. cDNA sticks to comp sequence 4. use lser to read fluorescent tags
What are the steps of DNA replication?
1. hydrogen bonds break 2. two strands separate 3. new complementary brought by cell paired up each two strand 4. forms two new, identical dsDNA
Steps in solid phase DNA isolation
1. lyse cells (lysis buffer) 2. denature/ digest proteins (proteinase K) 3. separate DNA from junk 4. precipitate DNA (wash 1 & 2) 5. elute off filter (elution buffer)
What are functions of the nucleus?
1. storage of genetic information 2. synthesis of ribosomes
Describe the steps of reverse transctiption
1. tRNA acts as a primer and hybridizes to virus genome 2. Complementary DNA then binds to the U5 (non-coding region) and R region 3. RNAse H degrades the 5' end of the RNA which removes the U5 and R region. 4. The primer then "jumps" to the 3' end of the viral genome and the newly synthesized DNA strands hybrid
What is considered good quality DNA/ RNA from a mass spec?
1.7 - 2.0
How much restriction enzyme do you use for a DNA digest?
10 U of enzyme per ug of DNA
RET (rearranged during transfection gene)
10q11 - membrane tyrosine kinase; translocations cause thyroid papillary carcinomas; point mutations cause inherited multiple endocrine neoplasia syndromes
ATM (ataxia telangiectasia mutated gene)
11q22 - protein helps pause cell at G1 or G2 phase to allow completion of DNA repair
Calculate the RNA concentration from the following: 260=0.307 (DF 1:100)
1228 ug/mL = 0.307 abs * 40 ug/mL * 100 DF
Von Willebrand dz (vWD)
12p13, Von Willebrand's factor (vWF) vWF promotes platelet clumping Mutations effect bloods ability to clot
Breast cancer, Brca2
13q 6174delT TS; interacts w/ RAD51
FLT3 (FMS-related tyrosine kinase 3)
13q12; poor prognosis in AML
Nucleosome
147 bp of DNA wrapped around histone octamer plus a H1 linker
Tay Sachs disease
15q, HEXA gene; AR 1278insTATC, exon 11 Insufficient hexoaminidase A activity; GM2-gangliosides cannot be broken down and accumulate in the brain; causes cerbral degeneration and blindness
The molecular-based diagnostic test for Mycobacterium tuberculosis uses ribosomal RNA as the target. Primers are made to be specific for which RNA subunit
16S
Both Prader-Willi and Angelman have 2 PCR products. What are the sizes?
174 bp 100 bp
Which of the 2 PCR products (alleles) in PWS/Angelman method are methylated?
174 is methylated 100 is unmethylated
TP53 (tumor protein 53)
17p13 - 50% of all cancers have mutations in this gene; when not functional, replication proceeds on damaged templates
Breast cancer, Brca1
17q 185delAG/187delAG 5382insC/5385insC TS; interacts w/ RAD51 (DNA damage repair)
Breast cancer, Her2/Neu/ErbB2
17q, ErbB2; proto-oncogene, Tyr kinase Mutations cause overexpression -> proliferation Dx: IHC, FISH, qPCR Treatment: Transtuzumab (Herceptin), gefitinib (Iressa)
CEBPA (CCAAT/enhancer binding protein, alpha)
19q13.1; 15-18% of cytogenetically normal AML, favorable prognosis
HCV most virulent
1b
Methylenetetrahydrofolate reductase
1p36.3, MTHFR gene; C677T (A222V), A1298C (E429A) Methylenetetrahydrofolate reductase catalyzes conversion of MTHF--> 5-MTHF which is converted to Met Thromboembolism, homocysteine builds up, Met is depleted
Gaucher's disease
1q21 GBA; AR N370S or L444P Lipid, glucosylceramide, accumulates in WBCs, liver, spleen, lungs, bone marrow and, less commonly, brain, caused by a deficiency of the enzyme glucocerebrosidase, which helps the body process the fatty substance glucocerebroside. Dx: PCR ->seq coding region
Factor V Leiden
1q25, F5 gene 1691G>A, R506Q Causes deep vein thrombosis Treated with anticoagulants (warfarin/Coumadin)
How many hydrogen bonds form between A & T
2
How many volumes of ethanol are added to 1 volume of a DNA:salt solution to cause the DNA to precipitate
2 2 volumes are to precipitate DNA while 2.5 is used to precipitate RNA
chimerism
2 or more genetically distinct populations of cells from different zygotes in an individual
mosaicism
2 or more genetically distinct populations of cells from one zygote in an individual
nested pcr
2 sets of primers used to amplify single target in 2 separate pcr runs
Hybridization
2 single-stranded DNA molecules of comp base sequence can form a double-stranded hybrid (duplex)
fluorescent resonance energy transfer (FRET) probes
2 specific probes - one with 3' fluorophore (acceptor) and other with 5' catalyst for fluorescence (donor); when brought close together by specific DNA binding, energy transfers donor to acceptor causing fluorescense
What are some methods used to identify and separate proteins?
2-D gel electrophoresis, usually separates proteins first by isoelectric point and then by molecular weight; visualized variety chemical stains or fluorescent markers & quantified by intensity of their stain individual spots cut out of gel and cleaved into peptides identified by mass spectrometry, specificallly matrix assisted laser desorption-ionization time-of-flight (MALDI_TOF mass spectrometry
Human genome
2.9 billion bp ~30k - 40k genes 46 chr, diploid
What is oligonucleotide or peptide nucleic acid microarray technology?
20-80 - mer oligo (primers 20 to 80 nucleotides long) peptide nucleic acid (PNA) sample DNA added, hybridized, complementary sequences determine
How do you inactivate RNases?
200 degrees for 2hrs 30 min in 1M NaOH or quanidinum isothiocyanate
A RNA sample is isolated from peripheral blood cells of a patient. When performing spectrophotometric analysis to determine the yield of RNA in the sample you find the 1:40 dilution of the 0.5 mL sample gives an OD 260 reading of 0.03125 and an OD 280 reading of 0.01760. What is the total amount of RNA contained in the 0.5 mL sample.
25 ug/mL (OD 260 x 40[RNA] x DF)/2.......... if it was DNA it would be x 50 x DF (0.03125 x 40 x 40)/2= 50/2= 25
Autosomal recessive
25% risk of getting affected individuals have unaffected parents
At what wavelength does DNA and RNA absorb?
260 nm
What is the wavelength of RNA or DNA in mass spec?
260 nm
2.0 to 2.3
260/280 range for RNA
RNA
260/280 reading for DNA greater than 2.0 has high concentration of _________
Protein
260/280 reading for DNA less than 1.6 may have high concentration of __________.
At what wavelength does protein absorb?
280 nm
What is the wavelength of protein in mass spec?
280 nm
amplification control
2nd set of primers and unrelated target, demonstrates that reaction is working even if test sample not amplified
Semi-nested PCR
2nd set of primers are same as first set
Nested PCR
2nd set of primers used just inside of first set
MYCN (v-myc avian myelocytomatosis viral-related oncogene)
2p24 - amplified in cases of neuroblastoma & retinoblastoma
IDH1 & IDH2
2q33.3 & 15q26.1 - R132 mutations -> >70% grade II & III astrocytomas & oligodendrogliomas, glioblastomas
How many hydrogen bonds form between G & C
3
When genotyping strains of bacteria by PFGE, what is the minimum number of genetic differences that must be observed between a reference strain and a test strain before it can be determined that the test strain is unrelated to the reference strain
3
leading strand
3' --> 5', continuous replication
Why primer dimers
3' complementarity
Haploid Genome
3.3 billion bp
What is the wavelength for background in spectrophotometery?
320 nm
What is the wavelength for background on a mass spec?
320 nm
[DNA] = 767.5 ug/mL. You have 0.5 mL What is the total yield.
383.75 ug = 767.5 ug/mL * 0.5 mL
Quaternary protein structure
3D structure of a multi sub unit protein
Tertiary protein structure
3D structure of a single protein
Bart's hydrops fetalis
4 α genes deleted, --/-- γ4 present, fatal in utero
[DNA] = 860 ug/mL. You have 0.5 mL. What is the total yield.
430 ug = 860 ug/mL * 0.5mL
turner syndrome
45, X
Turner
45,X
What is the normal karyotype of a female?
46, XX
What is the normal karyotype of a male?
46, XY
klinefelter syndrome
47, XXY
patau syndrome
47, xy, +13
edward syndrome
47, xy, +18
down syndrome
47, xy, +21
Klinefelter
47,XXY
Melting temp question
48
Huntington disease (HD)
4p16.3 HD/HTT; CAG repeat CAG repeat in HD/HTT causes multiple Q's at 5' of Huntingtin protein. Protein aggregates in plaques (especially in nervous tissue) slowing down brain function; symptoms appear at 30+ yo; impaired judgement, slurred speech, difficulty swallowing, intoxicated appearance WT repeats 9-37, HD 38-86 repeats Dx: PCR, S.blot to resolve full mut
lagging strand
5' --> 3', discontinuous replication
HCV most conserved
5' UTR
Taq polymerase
5'-3' exonuclease
The 2 alleles for a sex-linked recessive disease are X and x. The mutant allele is x. What is the percentage of male offspring that would be expected to be affected by the disease from parent who have the following genotypes Mother Xx Father xY
50
When quantifying the amount of genomic DNA in a sample by spectrophotometry, an OD 260 of 1.0 corresponds to what concentration of DNA
50 DNA is 50 RNA is 40
If mom has an x-linked dominant disorder, what are the chances the kids will get it?
50%
What is probe cDNA microarray technology?
500-5000 bases long immobilized on a solid surface by robotics grids of cDNA each with unique sequence determines level of mRNA expression produced by collection of cells
DNA A260
50ug/ml/1OD (answer on ascp is .560)
Mutation Nomenclature for DNA sequence
5162G->A 5162-base position G-original base A-replacement base
NPM1 (nucleophosmin/nucleoplasmin family, member 1)
5q35; 46-60% cytogenetically normal AML
What is the genotypic cause of TB?
6110 insertion sequence
Hereditary hemochromatosis
6p21.3 HFE; C282Y, G>A; AR a genetic disease that causes the body to absorb and store too much iron Treatment: phlebotomy
[DNA] = 1535 ug/mL. You have 0.5 mL. What is the total yield.
767.5 ug = 1535 ug/mL * 0.5mL
Cystic fibrosis (CF)
7q31.2 CFTR gene; F508del; AR Cl channel membrane protein Affects cells that produce mucus, sweat, saliva, and digestive juices; causes thick secretions Dx: RFLP, PCR-RFLP, HD, Invader, SSP-PCR
What are some facts that identify variable number tandem repeats (VNTR)?
8 to >50 base pairs Can undergo expansion or shrinkage through generation
Synovial sarcoma
80% of this type of cancer is caused by t(X;18)
Calculate the DNA concentration from the following: 260=0.172 (D.F. 1:100)
860 ug/mL = .172 abs * 50 ug/mL * 100 DF
A translocation in which chromosome pair creates a BCR/ABL1 fusion gene product asociated with CML
9;22
JAK2 (janus kinase 2)
9p24; polycythemia vera, essential thrombocythemia, idiopathic myelofibrosis; AD V617F
What is considered poor quality RNA/ DNA from a mass spec?
<1.7
What is considered poor quality RNA/DNA from spectrophotometry?
<1.7 Protein contamination
Fragile X Syndrome
>200 CGG repeats 5'UTR of chr.X
Huntington's Disease
>40 CAG repeats ex1 chr.4
What are the different types of Hepatitis viruses and their routes of transmission?
A - fecal/ oral B - sex, serum (most common) C - sex, serum
What is the path of a tRNA in a ribosome?
A ---> P ------> E
Six
A CDC score >___ is positive for HLA allele
3
A __fold change in HIV load is significant
Acrocentric
A chr where the with a centromere not in the middle, but closer to one end or the other
Hemoglobinopathies
A group of inherited disorders in which there is abnormal production or structure of the Hb molecule. Such disorders include hemoglobin C disease, hemoglobin S-C disease, sickle cell anemia, and various types of thalassemia.
Phosphate
A nucleoside lacks a _________ group
0.5 and 2
A ratio of less than ____ and greater than ____ indicates of loss of heterozygosity (LOH)
What is the chain termination (Sanger) sequencing method?
A sequencing reaction mix includes labeled primer and template Dideoxynucleotides are added separately to each of the four tubes
Histocompatibility
A state or condition in which the absence of immunological interference permits the grafting of tissue or the transfusion of blood without rejection.
Bisulfate DNA sequencing
A type of chain termination sequencing designed to detect methylated nucleotides. Methylation of cytosine residues in DNA is an important part of gene regulation and expression - this is important for detecting different types of cancer. During the incubation C is converted to U and 5-methylated C is unchanged. A PCR reaction is then performed using normal chain termination methods.
How do you determine quality of DNA/ RNA using a mass spec?
A260 - A320 A280- A320
How do you determine quality of DNA/RNA using a spectrophotometer?
A260/A280
The results of str typing of a child. the child's mother and 3 alleged fathers (AF) of the child are listed in the table below Locus name; child; mother; AF1; AF2; AF3 CSF1PO; 10,12; 12,12; 11,12; 10,12; 12,13 TPOX; 9,9; 9,11; 8,9; 9,11; 9,11 TH01; 7,9; 7,9.3; 7,8; 7,9; 7,9.3 F13A01; 6,9; 9,9; 6,9; 6,6; 9,9 FESFPS; 14,18; 18,19; 13,18; 13,14; 15,18 Which of the statements below is correct concerning the alleged fathers
AF2 is most likely the father of the child
What are the causes and symptoms for the Cystic Fibrosis's disease?
AR -autosomal recessive; cause severe lung damage Affects cells produce mucus, sweat, saliva and digestive juices Causes thick & sticky secretions Respiratory failure Loss of function CF transmembrane conductance regulator, CFTR, gene (7q31.2) Frequently 3-bp deletion phenylalanine position 508 (F508del)
Analytic specificity
Ability to detect only the analyte and not nonspecific targets
FRET Probes
Acceptor/reporter only fluoresce when both probes are bound next to each other on target sequence
research use only (RUO)
According to FDA, manufacturer-initiated studies of RUO products are typically intended to evaluate design, limited-scale performance, and issues such as usability of the test. The agency acknowledges that RUO products may be used for non-clinical laboratory research for goals other than developing a commercial IVD product. According to FDA, these uses may include developing novel and fundamental medical knowledge related to human disease and conditions.
What are the appropriate ways to use DNA in a criminal investigation?
Accumulating bits of linking evidence in a chain to argue that suspect really is the right person Look for matches (based on sequence or on number or small repeating units of DNA sequence) at a number of different locations on the person's genome one or two aren't enough to be confident that the suspect is the right one but four or five enough to prove reasonable doubt that the right person is accused
What are the nucleotides that are pair together?
Adenine - Thymine Guanine - Cytosine
What are the nucleotides that make up DNA and RNA?
Adenine, Guanine, Cytosine, Thymine, and Uracil
Chromosome mutations
Affects the structures of the entire chr, requires the movement of large chr regions
What is the most sensitve viral load method?
bDNA (100 copies)
Nucleic acids
backbone attached to nucleotide base
What is transduction?
bacterial viruses (bacteriophages) infect bacterial cells and transfer genetic information
What are the most common cancers?
basal cell and squamous carcinomas of the skin
Define phenotype
based on genotype and how each gene is expressed; biological properties of an organism
What are the gene associated with Non-Hodgkin's lymphomas?
bcl-1 mantle cell lymphoma bcl-2 follicular lymphoma (chrom 18)
HLA want to PCR HLA-D
beta exon 2
Single- gene disorders are _______and ________.
biochemical defects metabolic disorders
Define Computational biology
bioinformatics; life science based on mathematical and statistical applications
Methylation of cytosine residues is involved in the alteration of gene expression in a number of cancers. Which sequencing technique is best suited to determine if methylation of cytosine residues has taken place in the promoter region of a given gene
bisulfate sequencing
What are some uses for identity testing?
bone marrow transplants paternity court cases specimen ID
Define Uniparental disomy
both copies of a chromosome, part of a chromosome, or gene come from just one one parent
Sequencing gels are read from?
bottom to top (5' to 3')
List some specific characteristic for in Interphase FISH
bound probe visualize under florescence microscope probes specific particular chromosome or regions image correlate with state of chromosome or region
Which technique employs the amplification of the signal resulting from probe:target hybridization rather than by amplifying the target or the probe
branched DNA analysis
What is the functions of detergent (sodium dodecyl) and strong base (NaOH)?
break open cell walls polymers
helicase
breaks H-bonds of double helix
topoisomerase
breaks/ reseals DNA backbone to release tension caused by twisting (DNA gyrase)
BRCA1 & BRCA2
breast cancer genes; 1 increases risk 60-80%; 1 = 187delAG, 5382insC; 2 = 617delT
Electrophoresis: agarose (alkaline) technique is used for what type of nucleic acid?
buffers containing sodium hydroxide & useful for single-strand DNA
t(8;14)
burkitt lymphoma; breakpoint within c-myc gene
How do you diagnose Hodgkin's Disease?
by the presence of Reed-Sternburg (RS) cells
Southern Blot
can detect a specific DNA fragment among many
What is the use of uracil-N-glycosylase (UNG) in PCR?
can help with contamination by deestroying dUTP (hich is used for RNA and not DNA
How does galactosemia affect the body?
can't degrade galactose correctly build up of toxic levels of galactose 1-phophosphate ---> tissue damage
Telomers
cap ends of chromosome during replication to preserve DNA
What does mRNA do?
carries code out of cell. code for protein structure. DNA to ribosomes end of transcription start of translation
APS & TEMED
catalysts used for polyacrylamide gels
amino acid charging
catalyzed by aminoacyl tRNA synthetase; Mg++ dependent
t(12;21)
cause acute lymphoblastic leukemia (ALL); ETV6/RUNX1
What do thalassemias do to the body?
cause an imbalance in globin chain synthesis not enough a-globin, too much b-globin and vice versa b-globin can't deleiver O2 efficiently ---> premature RBC destruction
Change in protein amount
cause too much or too little of a normal protein to be made (development of mutations)
Angelman syndrome
caused by a deletion of the same bank affecting the maternally derived chromosome 15q-; inappropriate laughter (15q11.2)
Y chromosome microdeletion (YCMD)
caused by microscopic deletions in the Y chromosome, specifically within Yq11(the azoosperma factor (AZF) region); spermatogenic failure
VHL (van hippel-lindau gene)
causes abnormal growth of blood vessels; predisposition for renal cell carcinoma & other cancers
dystrophin (DMD)
causes duchenne/becker muscular dystrophy; Xp21
What are some POS mediators?
cell cycle control genes metastasis promoting genes growth factors and their receptors proto-oncogenes celluar homeostasis promoters
conjugation
cells in contact, transfer of nuclear information; F- to F+, but may revert back
polymorphism
change in dna sequence present in at least 1 - 2% of population
Conservative mutation
change the amino acid sequence, but the amino acid change similar biochemical properties; function may not be significance affected
Hypochondroplasia
characterized by short stature with disproportionately short arms and legs, broad, whortened hands and feet and macrocephaly; results of FGFR3 mutation -C1620A &C1620G lysine for asparagine subs.
metacentric
chromosomal arms equal in length
What is a Non-Hodgkin's lymphoma?
chromosome tranlocation
List some specific characteristic for in Metaphase FISH
chromosomes visualize under a phase contrast microscope chromosomes appear well separated with sharp borders cytoplasm should not be visible whole-chromosome painting
Endonucleases
cleaves phoshpodiester bonds w/in chain recognition site is palindromic sequence cleaves unevenly, leaves sticky ends (restriction enzymes)
[TP/(TP+FN)] x 100
clinical sensitivity
[TN/(TN+FP)] x 100
clinical specificity
How does PCR detect latent infections?
closed circle DNA no repeats
Ligase
closes gaps in DNA forms covalent bonds b/w nucleotides, 3' end of new DNA to 5' end of growing chain
HER2 (human epidermal growth factor receptor 2), ERBB2
codes for transmembrane protein w/ tyrosine kinase activity; overexpressed in 25-30% of breast cancer
Deoxynucleosides
combination of deoxyribose and base
Deoxynucleotides
combination of phosphate, deoxyribose, and base
What are the methods used to detect HLA antigens by serology testing?
complement-dependent cytotoxicity (CDC) test
Define ribosome
complex of RNA and proteins that catalyzes formation of peptide bonds
How are nucleotides joined together?
condensation
Stringency
conditions of hybridization that control the specificity of binding b/w the probe and target sequence
tertiary structure
configuration of folded proteins; if denatured, loses function
polygenic disorders manifest as...
congenital malformations diabetes mellitus cancer
What are some cellular controls to help inhibit cancer?
contact inhibition ----> to many cells signal transduction gene expresion checkpoints in celly cycle DNA repair
DNA polymerase III
copies DNA by reading existing strand, builds new comp. strand always adds to 3' end can't start new strand on its own (ORI sites)
Ataxia telangiectasia results in what change in DNA?
cultured cells do not show a defect in repair of X-ray damage to their DNA, continue to replicate their DNA even when it has been damage by X-rays leads to uncontrolled cell growth
Restriction Enzyme II
cut is palindromic and at near recognition site
topoisomerase II
cuts both strands of one DNA double helix, passes another unbroken DNA helix through it, and then reanneals the cut strands
What are several examples of Autosomal Recessive inherited disease?
cystic fibrosis, hemachromatosis, sickle cell anemia & phenylketonuria
0.1 - 0.5mM
dNTP concentration for PCR
dUTP-UNG system
dUTP add to PCR reaction and in subsequent PCR the enzyme, UNG, will degrade any template with UTP
Dye terminator
ddNTPs are used and fluorescently labeled instead of the primer. All four reactions are performed in the same tube. Terminated nucleotides are amplified.
What does tRNA do?
decodes mRNA. Matches amino acids to mRNA code. Protein synthesis
Methylation of cytosine bases 5' to the gene will increase or decrease expression?
decrease
siRNAs complementary to the gene transcript will increase or decrease expression?
decrease
What is thrombophilia?
defective proteins associated with coagulation APC resistance - blocks activated protein C so coagulation is always on
What is the functions of DNAase?
degrades DNA; to remove all non-RNA nucleic acids
What is the functions of RNAase?
degrades RNA; to remove all non-DNA nucleic acids
Exonucleases
degrades nucleic acids by removing one terminal nucleotide at a time cleaves phosphodiester bond at end of chain 5' ---> 3' and 3' ---> 5'
What does smearing on a gel indicate?
degredation loaded too much
contiguous gene syndrome
del(11p)
Angelman syndrome
del(15)(q11q13) maternal; paternal is imprinted Ataxia, seizures, inappropriate laughter
Prader-Will syndrome
del(15)(q11q13) paternal; maternal is imprinted Congenital dz, mental retardation, short stature, obesity, hypogonadism
prader-willi syndrom (paternal) or angelman syndrome (maternal)
del(15q11-13)
Chronic lymphoid leukemia (CLL)
del(17)(p913) TP53 del(11)(q22) ATM del(13q) long arm clonal b-call malignancy, progressive accumulation of mature lymphocytes Most common leukemia Dx: Flow cytometry; 'basket' or 'smudge' lymphocytes Treatment: chemo., BM transplant
digeorges & velocardiofacial
del(22q)
cri du chat
del(5p)
What does the p53 gene do?
delays G1/S phase which allows for DNA repair induces apoptosis
Define loss of heterozygosity
deletion or inactivation of a functional allele, leaving a mutated allele
What cause Angelman syndrome?
deletion or mutation on maternal 15 (UBE3A gene)
What causes Prader-Willi Syndrome (PWS)?
deletion or mutation on paternal 15 (SNRPN gene)
What is the most common cause of thalassemias?
deletions
What can Southern Blots be used to detect?
deletions/ insertions point mutations polymorphisms structural rearrangements
What is the most commom mutation mutation that causes cystic fibrosis?
delta F508
Cystic Fibrosis mutation
delta F508, 3bp deletion
94 - 96°C
denaturation temp.
Formamide acts as a __________ in a hybridization.
denaturing agent
Formanide acts as a __________ in a hybridization.
denaturing agent
What do dideoxynucleotides and what are they?
deoxythymidine triphosphate synthetic; lacks OH at 3' carbon and once added, elongation stops
t(17;22)
dermatofibrosarcoma
Centromeric probes (CEN)
designed to hybridize to the high alpha satellite sequences surrounding centromeres. Region specific to detect aneuploidy of chromosomes
DNA sequencing of hypervariable regions I and II is used to
detection of polymorphisms in human mitrochondrial DNA
gel mobility shift assay
detects specific peptides by changes in electrophoretic migration speed upon binding to specific antibodies; ie, identifying trans factors that bind to cis acting elements
What can inhibit PCR amplification?
detergent (SDS) phenol (left over from DNA isolation) herapin (specimen tube) heme dyes CSF, urine, sputum, parafilm
ddNTP
dideoxyribonucleoside triphosphate lack a hydroxyl group (OH) at 2' and 3'
Imprinting
different expression of gene depending on mom or dad
What is one molecular method for detecting breast cancer?
differential restriction digest PCR
What is the functions of proteinase K
digest protein
What is the functions of enzymatic; lysozyme, zymolase & lysostaphin?
digestion of cell wall polymers
proteinase k
digests proteins, lyses cells, inactivates enzymes
How to you detect parvovirus?
direct qualitative PCR (nested or single) follow by probe hybridization
How is microsatellite instability is detected
direct sequencing and by comparing PCR amplicons of the microsatellite loci. Unstable loci appear as extra products in tumor tissue compared to normal tissue
Chaotropic agents
disrupts the structure and denatures the DNA by increasing the entropy and non-covalent forces like hydrogen bonds (ex. chemicals like - sodium iodide, or sodium perchlorate)
[H+][A-]/[HA]
dissociation constant Ka =
Benign tumors
does not metastisize local effects slow growth
Autosomal Dominant
dominnant gene on autosome affected person has affected parent - 50% they get it unaffected people don't give to kids
What are some of the benifits of FISH?
don't need mitotic cells ---> shorter TAT large number of cells may be scored dual color ---> mutiple targets many sample types
Base Excision repair
done by DNA glycosylase, AP endonuclease, exonuclease
Nucleotide Excision repair
done by endonucleases and exonucleases
purines
double ring; guanine & adenine
denaturing gradient gel electrophoresis (DGGE)
dsDNA fragments separated on PAGE with gradient conc. of urea & formamide
What are the steps involved in transcription?
dsDNA must be pulled apart a ssRNA molecule is made The strand of RNA a base sequence that is complementary to the DNA (thymine replace by uracil) RNA is synthesized in the 5' to 3' direction
Define allele
each gene exists in alternative forms; different version of the same sequence, gene or locus
What does DNA polymerase I do?
editing enzyme; replaces all RNA nucleotides to deoxynucleotides (dNTPs)
What is DNA ladder read on?
electropherogram
68 - 75°C
elongation temp.
Feedback Inhibition
end product of pathway is noncompetitive inhibitor binds to allosteric site to slow down rxn b/c too much product
Restriction enzymes
endonucleases that recognize specific sequences and break the phosphodiester bond of dsDNA
adjuvants
enhance antibody titer by slowing degradation of protein
positive control
ensures enzyme is active, buffer is optimal, primers are priming right sequences, thermocycler is cycling properly
negative control (contamination control, reagent blank)
ensures reaction mix isn't contaminated with template DNA or amplicons
What are the values of heterologous extrinsic of internal controls in amplification in the reliability of PCR results?
ensures that extraction and amplification procedures were acceptable
reverse transcriptase
enzyme that allows RNA to go to DNA mRNA --> ssDNA --> cDNA --> dsDNA
endonuclease
enzyme that breaks sugar-phosphate backbone
Define RNA polymerase
enzyme that catalyzes the template-dependent formation of phosphodiester bonds between ribonucleotides forming ribonucleic acid
primase
enzyme that lays down 6-11bp RNA primers for DNA replication to begin
exonuclease
enzyme that removes nucleotides from either end of linear DNA/RNA molecule
Reverse transcriptase
enzyme that transcribes RNA to cDNA (lacks introns) RNA --> RNA:DNA --> cDNA (dsDNA)
A common use for pulsed-field gel electrophoresis is
epidemioloical typing of bacterial strains
How many sites of origin of replication are in eukaryotes and bacterial cells?
eukaryotes cells have many bacterial cells have one
t(11;22)
ewing sarcoma (EWS); translocations with FLI1 gene
How does the mutation cuase muscular dystrophy?
exons deletions ---> proteins are missing or truncated
What are the affects on DNA?
exposure to UV light can cause adjacent thymines to covalently link distorts the DNA molecule and breaks the hydrogen bond with adenine
HLA class II (D)
expressed on 'pro antigen-presenting cells" - b lymphocytes, dendritic cells, macrophages
HLA class I (A, B, C)
expressed on all nucleated cells
Chelex 100 resin is used to
extract DNA from cells
Nondisjunction
failure of chromosomes to separate
DNA pol I
family A DNA pol; repair & replication; 3' --> 5' and 5' --> 3' exonuclease activity; processes okazaki fragments
DNA pol II
family B DNA pol; repair; 3' --> 5' exonuclease
DNA pol III
family C DNA pol; primary replication; holoenzyme
DNA pol IV, V
family Y DNA pol; bypass replication
What is use for pharmacogenomics such as cytochrome p450?
family of liver enzyme responsible for breaking down more than 30 different different classes of drugs
enhancers
far from promoter maintain a tissue-specific or cell-specific level of gene expression
Patau syndrome
features at birth include polydactyly, microcephaly, sloping forehead, cleft lip and/ or palate, retinal anomalies, abnormal ears cardia defects, genitourinary malformations; trisomy 13
Thanatophoric dysplasia
features include bent femurs and cloverleaf skull deformity; mutation various of FGFR3 gene
northern blot
for detecting RNA structure & quantity, gene expression, splicing abnormalities; run RNA on gel with denaturing conditions, rinse to remove denaturant before transfer
pulsed field gel electrophoresis (PFGE)
for resolving very large DNA (50k-250k+ bp); pulses of current applied to gel in alternating dimensions
polyacrylamide gels (PAGE)
for very small DNA fragments and ssDNA; polymerization requires catalyst
Denaturing agents
formamide, urea, mercaptoethanol
What is the functions of phenol/chloroform?
forms a bisphasic emulsion settling lipids at the bottom & DNA upper aqueous phase
Sequencing ladder
four-lane gel electrophoresis pattern of the products of the four sequencing reactions
Which of the following is the most common inherited cause of mental retardation?
fragile X
Define okazaki fragments
fragments converted into larger pieces with time, showing they were covalently linked together shortly after synthesis
product rule
frequency of a set of alleles or genotype in a population is product of the frequency of each allele separately
quaternary structure
functional association of separate proteins
Aneuploidy
gain or loss of one or more chromosomes, such that the total number is not a multiple of 23
t(11;18)
gastric MALT lymphomas; BIRC3/MALT1
What is a solution hybridization method for the detection of nucleic acid: protein interactions
gel mobility shift assay
Define allelic replacement
gene rearrangement on only one of two homologous chromosomes
CYP2C19
gene that affects response to plavix (clopidogrel); used to prevent atherothrombotic events and cardiac stent thrombosis when given along with aspirin
What are the mechanisms that radiation use to alter DNA?
generates free radicals (highly dangerous & reactive molecule that attacks the DNA & alters many ways) radiation can also cause double strand breaks in the DNA molecule
gonadal mosaicism
generation of new mutations in germ line cells; seen as AD phenotype in child from unaffected parents
Cancer effects _______.
genes
Define chromosome
genes belonging to each cell are arrangement; DNA double helix that carries genes
VKORC1 & CYP2C9
genes that affect response to warfarin
Define housekeeping genes
genes that are always constitutively expressed because they code for proteins that are constantly required by the cell, hence, they are essential to a cell and always present under any conditions.
What are oncogenes?
genes that trigger cell cycle
What is use for pharmacogenomics such as HER-2?
genes were producing many copies of a protein that appeared to be driving the growth of the cancer cells
Define Polymorphism
genetic alteration that is harmless; slight difference account for variations in phenotype
How does Gaucher disease affect the body?
glucocerebrosidase enzyme doesn't work correctly, which breaks down fatty substance in lysosome causes cell to bloat
How can you increase sensitivity/ specificity of PCR?
go for repeat sequences nested PCR PCR + probe hybrid (southern, dot blot, liquid hybridization)
How can you tell if you have good RNA using gel electrophoresis?
good RNA will have a 2:1 intensity (28S : 18S) if 18S is more, RNA degradation is possible
Turner syndrome
half of those born, have a complete loss of one X chromosome, the remainder have 45, X mosacism; monosomy X;45,X
How does Tay-Sachs disease affect the body?
harmful amounts of cell membrane components known as gangliosides acculmulate in the brain's nerve cells insufficient activity of the enzyme hexosaminidase A --> breaks down fatty acid derivatives of gangliosides
type 3 restriction enzyme
has nuclease and methylase activity; asymmetrical recognition site; cleavage occurs ~25bp to 3' of binding site
type 1 restriction enzyme
has nuclease and methylase activity; binds to sites of 4-6bp separated by 6-8bp & containing methylated A's; can cleave >1000bp from binding site
Type I restriction enzymes
have both nuclease and methylase activity in a single enzyme. Bind to host-specific DNA that contains methylated adenines
Polyploidy
having more than two complete sets of chromosomes
Define heterozygous
having two different alleles; presence of only one of two possible allele in a diploid genetype
Define homozygous
having two identical alleles; the same allele on both homologous chromosomes
Separates DNA
helicase
Rho
helicase enzyme that inactivates elongation complex at cytosine-rich termination site (prokaryotes)
Vector
helps carry DNA into cell ie plasmids, virus
The term that best describes males regarding x-linked genes is
hemizygous
A human actin gene may be used as an amplification control when performing PCR testing for Mycoplasma pneumonia in a bronchoalveolar lavage taken from a human patient. The type of amplification control is described as
heterologous intrinsic
Intervening sequences are found in
heteronuclear RNA
>100,000 copies/ml
high HIV viral load
A useful polymorphic locus must have:
high degree of heterozygosity low rate of recombination no selective advantage inherited codominantly
high temp, low salt, high denaturant
high stringency conditions
Which condition has the highest stringency for washing a southern blot after hybridization has been completed
high temperature; low salt concentration
How does agarose concentration effect different sizes of DNA fragments?
higher concentrations of agarose facilitate separation of small DNA fragments, while low agarose concentrations allow resolution of larger pieces of DNA
What is the functions of ficoll?
highly branched sucrose polymers; separate different portions of blood
alpha satellite
highly repetitive sequences at centromere, interfere with chromosome compaction, causes constriction at centromere
chromosome
highly-ordered structure single dsDNA (double strand) wound tightly
single-strand DNA-binding proteins (SSBPs)
hold DNA open during replication
Autosomal recessive disorders have what kind of inheritance?
horizontal
What is the gene found in ALL mycobacteria? How to you detect it?
hsp65 restriction digest
What is the bonds that exist between nucleotide bases?
hydrogen bonds
Denaturation of DNA during a PCR reaction refers to breaking
hydrogen bonds between nitrogenous bases in base-paired nucleotides
What is direct analysis?
identifying a specific gene or mutation that caues disease. gene must be known, might need to know mut
microsatellite instability
if replication errors around microsatellites remain, new alleles will arise, increasing # of alleles for a locus; 90% of HNPCC cases
How does DNA repair work in replication?
if the damage is post replication, skips over damage, leaves gap and repair later
graft versus host disease (GVHD)
immunocompetent cells in donor organ recognize recipient cells as foreign, attack and destroy cells
How are tumors made?
inactivation of tumor suppressor genes multiple mutations ---> clonal expansion driven mutation defects in growth control defects in cellular differentiation activation of protooncogenes
Histone acetylation close to the gene will increase or decrease expression?
increase
How can you increase strigency in a hybridization?
increase temp decrease salt conc.
bk virus
infection in kidney transplant recipients increases risk of developing donor-specific antibodies
Mitochondrial Inheritance
inheritated only from mother all offspring affected if mother is affected
What is indirect analysis?
inherited marker near gene associated with disease unknown gene and /or mut
Variant
inherited sequence alterations
Transcription
initiation --> elongation --> termination
How does EtBr cause DNA to fluorese?
intercalates into the double helix
In primer design what should you avoid?
interstrand homologies: primers ain't similar ( bind to each other) intrastrand homologies: long primers fold over longer than GGGG
cDNA
intron free complementary DNA (mRNA already spliced it) can be inserted into a plamid
Maligent tumors
invasive to adjacent tissue local or distant effects rapid growth
What is target amplification?
involves making copies of a target sequence to a level that can be detected in vitro
What is hemochromatosis?
iron overload syndrome high gastrointestinal iron absorption
Define primase
is a ribonucleic acid (RNA) synthesizing enzyme that lays down short (6-11 bp) primers required for priming DNA synthesis
What is recombinant DNA?
is created by combining DNA sequences that would not normally occur together
Define Sequencing
is the ability to determine nucleotide sequences of DNA molecules
Define Pharmacogenomics
is the study of how an individual's genetics inheritance affects the body's response to drugs
What is plasmid analysis/ plasmid fingerprinting that is used to type bacterial strains in epidemiological investigation?
isolation and restriction mapping of bacterial plasmids same strain can carry different plasmids which have different phenotypes plasmids distinguished based fragment pattern after cutting with appropriate restriction enzymes
NASBA (nucleic acid sequence based amplification)
isothermal amplification method; RNA input -> create DNA -> transcribe more RNA -> repeat
Nucleic Acid Sequence Based Amplification (NASBA)
isothermal rxn --> no thermocycler great sensitivity enzymatic rxns take place concurrently
t(11;14)
joins IgH chain gene region w/ cyclin D1 gene (CCND1) or BCL1; mantle cell lymphoma (MCL)
Mycobacterium tuberculosis
katG, inhA
Poly-A tail
keeps mRNA from being destroyed in cytoplasm at 3' end piece of 100-250 A's
BRAF (v-Raf murine sarcoma viral oncogene homolog B)
kinase that tranduces signals for KRAS; V600E; tumors in proximal colon & with promoter hypermethylation of MLH1
What is the molecular reactions that occur in chain termination sequencing?
lack of the hydroxyl group found on the 3' ribose carbon of the deoxynucleotides (dNTPs) DNA synthesis will stop when ddNTP is incorporated into the growing DNA chain causing chain termination newly synthesized chain stop or terminate with the ddNTP
negative template control
lacks target sequence, ensures primers not annealing to nontarget sequence
Okazaki fragments
lagging strand 3' ---> 5' away from fork DNA pol III adds, DNA ligase closes gaps
What causes most of the cases of PWS and Angelman?
large interstitial deletions low copy repeat sequences
klenow fragment
large protein fragment of DNA pol I with 5' --> 3' polymerase activity, loses exonuclease activity
How does voltage application to gel effect the different sizes of DNA fragments?
larger fragments migrate proportionally faster that small fragments
Molecualr techniques can be used to determine a ______ v. ______ infection.
latent v. lytic
tris-edta
lavender tube
DNA Polymerase III (Prokaryotic)
leading strand synthesis
DNA Polymerase delta (Eukaryotic)
leading strand synthesis
Define antiparallel replication
leading strand; strand is made continuously lagging strand; short segment and joined together
Z form
left handed double helix, stress & torsion
20 - 30bp
length of pcr primers
Diagnostic specificity
likelihood of negatives
Diagnostic sensitivity
likelihood of positives
Analytical sensitivity is based on _____ and specificity is based on _______.
limit of detection target specificity
How does PCR detect lytic infections?
linear DNA terminal repeats
what are the to types of isolation/ extraction methods?
liquid phase (phenol/ choroform) solid phase (qiagen)
amelogenin
locus for gender identification; Y allele 6bp larger than X allele; 2 bands/peaks for males, 1 band/peak for females
low temp, high salt, low denaturant
low stringency conditions
What is the functions of crude lysate?
lysis material after breaking cell membranes; not clean & used for amplification
What are the applications for microarray technology?
mRNA or gene expression profiling: monitoring expression levels of biology, medicine , studying treatments, disease & development stages Comparative genomic hybridization: large genomic rearrangement SNP detection arrays: single nucleotide polymorphism genome of populations Chromatin immunoprecipitation: studies determining protein binding site occupancy throughout genome
constitutive transcription
mRNA transcribed constantly and abundantly
inducible (regulatory) transcription
mRNA transcribed only during certain times or conditions
RNA POL II
mRNA, snRNA
splicesomes
made up of snRPs remove ntrons during transcription cut out intron and reform bonds b/w exons
The mode of inheritance of mitochondrial DNA is
maternal
molecular beacons
measures product at annealing step; stem and loop probe with dye at 5' end and quencher at 3' end; probe binds to template during annealing and fluoresces
MRSA (resistant staph)
mec A
DNA-based testing for the presence of MRSA uses PCR with primers specific for which gene
mecA
4°C x #G/C + 2°C x #A/T
melting temp (Tm) for short probes (14-20bp)
Pyrosequencing
method designed to determine a DNA sequence without having to make a sequencing ladder. relies on generation of light (luminescence) when nucleotide are added to growing strand of DNA.
For PWS PCR detection, which allele is detected?
methylated allele 174 bp
Which is considered an epigenetic modification of DNA
methylation of CpG islands in the promoter region of a gene
decreases
methylation of histones _________ expression
What method do you use to detect Angelman Syndrome?
methylation sensitive PCR w/ mutiplex PCR Southern
What method do you use to detect Prader Willi Syndrome?
methylation sensitive PCR w/ mutiplex PCR Southern
Bisulfite sequencing
methylation-specific sequencing, is a modification of chain termination sequencing designed to detect methylated nucleotides
What are the genetic abnormalities associated with various cancers?
microsatellite instability
Blocking Proteins (Hybridization)
minimize nonspecific binding of probe to membrane ie casein (milk), Denhardt's sol
Blocking DNA (Hybridization)
minimizes probe binding to nonspecific sequence ie salmon sperm DNA, Human LINE-1
RNA POL IV
mitochondrial RNA
Splicing
modification of the nascent pre-messenger RNA (pre-mRNA) transcript in which introns are removed and exons are joined.
Which reagent generates a signal during the annealing stage of a quantitative real time PCR reaction
molecular beacon
What is the structure of the MHC locus that encodes the HLA antigens class 1 molecules?
molecules consist of a long (heavy) chain of 346 amino acids associated with a smaller peptide, beta-2 micro-globulin displays short branched-chain sugars, glycoprotein trans-membrane polypeptide that anchors complex to cell surface
What is the structure of the MHC locus that encodes the HLA antigens class 2 molecules?
molecules consist of two trans-membrane polypeptides, alpha chain with three domains, alpha 1, alpha 2, alpha 3 & beta 1 & 2 two polypeptides associate, forming a grove between the alpha and beta domains hold the fragments of antigen that have been engulfed and process by the cell
How can viral load testing be helpful for patients with HIV?
monitor anti-retroviral therapy
herceptin (Trastuzumab)
monoclonal antibody used to treat breast cancer that is HER2 receptor positive
How clonality is detected using antibody and T-cell receptor gene rearrangement
monoclonal populations are detected by rearranged bands unique to the tumor cell population by southern blot
What is pulsed field gel electrophoresis that is used to type bacterial strains in epidemiological investigation?
most common can distinguish organisms with larger genomes or multiple chromosomes national database stored at CDC labor intensive procedure
ras point mutation
most common oncogene abnormality gets stuck on --->triggers cell division
type 2 restriction enzyme
most frequently used in lab; no methylation activity; binds to palindromic symmetrical sites; prokaryotes only; can leave blunt or sticky ends
robertsonian translocation
movement of most of one entire chromosome to centromere of another
DNA Polymerase γ (Euk)
mtDNA replication and repair Exonuclease activity
complement dependent cytotoxicity (CDC) test
multiple alleles determined using panel of antibodies against known HLA types
Chromosomal disorders cause:
multiple birth defects
A PCR reaction in which 4 different sets of primers are used to simultaneously amplify 4 distinct loci in the same reaction tube is known as
multiplex PCR reaction
combined paternity index (CPI)
multiply paternity index for each locus
What are some disadvantages of PCR?
must know the sequence first highly contamiable may not be 100% specific specificity dependant on temp and Mg++ conc
What some causes of DNA damage?
mutagens carcinogens cell death age-related decreases in DNA repair genetic disease
Define oncogene
mutated gene that promotes proliferation and survival of cancer cells
Transition
mutation A to G or C to T (similar shape) silent sustitutions as SNPs, "wobble"
Transversion
mutation purine to pyrimidine
What are the clinical uses for DNA sequencing?
mutation detection confirm mutation by other method resistance testing HLA genotyping
What is MIRU that is used to type bacterial strains in epidemiological investigation?
mycobacterial interspersed repeat units repeats that vary in length and sequence involves PCR amplification and gel electrophoresis to categorize # and size of repeats in 12 independent loci each loci has a unique repeated sequence sizes of loci A, B, C, and D in three different strains
When genotyping a virus, you can look at _____ and ______.
natural sequence diversity drug selected/ induced resistance
Autosomal Recessive
need two copies to see affect; both parents pass on
X-Linked recessive disorders have what kind of inheritance?
neither vertical or horizantial
A variation of a standard PCR reaction that can increase the sensitivity and specificity of a low copy number target in a patient sample is known as
nested PCR
heteronuclear RNA (hnRNA)
newly transcribed mRNA
nucleoside
nitrogen base bound to unphosphorylated sugar
Define amino acid
nitrogen-containing molecules with specific biochemical properties that are the building blocks of protein
What would the autoradiogram show if the stringency was to high?
no bands
Can an x-linked recessive male have an affected male child? Why?
no. the mutation is only on the X. the man would have given his Y to have a boy. If mom is carrier, then there is a possiblity
UAA, UAG, UGA
nonsense/termination codons
Eupliod
normal complement of chromosomes
ORI sites
nt sequence where replication is initiated
Restriction Enzyme I
nuclease and methylase, cut 1000 bp away from recognition site
What is the spectrophotometric method used to determine the quantity and quality of nucleic acid preparations.
nucleic acids absorbs light at 260 nm through the adenine residues: concentration determined from adsorpivity constants, quantity most need diluted so they fall within linear reading range including dilution factor & quality protein absorbs light at 260 nm through tryptophan residues: absorbance of NA should be 1.6-2 times more than absorbance at 280 nm, if less 1.6 it is not pure
What is the functions of spin columns and glass beads?
nucleic acids binding to silica beads; basis many automated extraction systems
Define karyotype
number and structure of chromosomes; complete set of chromosomes of cell
What is signal amplification?
number of target sequences does not change but large amounts of signal are bound to the target sequence present in the sample
Define incomplete dominance
offspring show traits intermediate between two parental phenotypes
Name a few of various mutation effects?
once gene been damaged or changed the mRNA transcribed from that gene will carry an altered messege polypeptide made by translating the altered mRNA will contained a different sequence of amino acids the function of the protein made by folding this polypeptide may be changed or lost the phenotype of the organism carrying the mutation will be changed
DNA sequence polymorphism
one base difference
Define single nucleotide polymorphisms
one base-pair variation from reference DNA sequence
acrocentric
one chromosome arm extremely small
sub-metacentric
one chromosome arm longer than other
semi-nested pcr
one of 2nd round primers is same as 1st round
Define reading frame
one of three possible ways to read off the bases of mRNA in groups of three to give codons; always begins with start codon "AUG"
Frameshift mutation
one or more bases are inserted or deleted, altering mRNA sequence which will alter protein
telocentric
only 1 chromosome arm
Blotting: dot technique is used for what type of nucleic acid?
only confirm the presence or absence of a biomolecule
Autosomal Dominant
only one parent has to pass on the altered gene in order for that trait to be expressed
RNA Polymerase
opens double helix reads one strand to make RNA, 3' --> 5' (antiparallel) DNA-dependant catalyzes formation of covalent bonds b/w nucleotide and growing chain
Clinical sensitivity and specificity is based on _________.
outcome
pKa + log ([basic form]/[acidic form])
pH =
-logKa
pKa =
What is Ewing's Tumor?
pPNET tumor caused by chromosomal translocation
What kind of probes are used for FISH?
painting (all or part of chromosome) alpha satellite (centromeres) single copy (specific regions on chromosome)
What is the function of rRNA?
part of ribosome structure most abundant RNA coordinated coupling of tRNA to mRNA codons
What does rRNA do?
part of ribosome structure most abundant RNA coordinated coupling of tRNA to mRNA codons
After performing interphase FISH with X chromosome-specific and Y chromosome-specific alpha satellite probes, it is determined that nuclei in cells from your phenotypic female exhibit only 1 bright fluorescent spot with the X chromosome-specific probe and do not react at all with the Y-specific probe. Assuming all controls have worked correctly, what is the most likely diagnosis for this patient
patient is a female with Turner syndrome
Refer to the figure. An amplicon for gene X is 176 base pairs in size. A variant allele x, gives the same size amplicon but has an Alwl restriction enzyme recognition site that is not present in the amplicon arising from allele X. A PCR reaction is run on a DNA sample isolated from 3 patients. The sample is digested with Alwl after the PCR is complete and products of the digestion are resolved ona 4.0% agarose gel (- = no Alwl digestion, + = Alwl digestion) Assuming all appropriate controls have worked correctly, what is the interpretation for the genotype of patient #3 with regards to alleles X and x?
patient is heterozygous for X and x
R (unshared)/(R (unshared) + D (unshared))
percent recipient cells
What is the bonds that exist between nucleic acids?
phosphodiester bonds
What is use for pharmacogenomics such as TPMT?
plays a important role in the chemotherapy treatment of a common childhood leukemia breaking down thiopurines
Thrombophilia is what kind of mutation?
point mutation Factor V gene
What are the differences between agarose gel electrophoresis from polyacrylamide electrophoresis.
polyacrylamide electrophoresis is used vertically agarose gel electrophoresis is used horizontally polyacrylamide electrophoresi is flexibility & sharper defining bands than agarose.
Define protein
polymer of amino acids with structural or functional capabilities
DNA
polymer of nucleotides; basic building blocks
size exclusion columns
porous beads that exclude larger molecules and retain smaller molecules
Cancer genes encode for _______.
positive and negative neoplastic development
What are some methods that can detect thrombophilia?
pre-mediated RFLP of Factor V leidan
Lack of protein
prevent the protein from being made (hemophilia)
X-Linked Recessive
primarily effects males females are carriers
sequence specific primer pcr (SSP-PCR)
primer 3' end falls on nucleotide to be analyzed; 3' end must match template to extend by Taq; presence/absence of product = presence/absence of mutation
How does PCR work with methylated DNA?
primers are designed to recognize methylated and unmethylated sense strands at gene promoter the methylated bases inhibit enzyme activity at recognition sites
ligase chain reaction (LCR)
primers bind immediately adjacent to each other, ligated together; ligated primers become template; used to detect point mutation as 1 mismatch will not allow ligation
What are some causes of too many bands on a gel after PCR?
primers not specific enough annealing temp too low too many cycles too much Mg++
CPI * prior odds/((CPI * prior odds) + (1-prior odds))
probability of paternity; prior odds = .50
What are the two types probes of microarray technology?
probe cDNA - Format 1 Oligonucleotides or peptide nucleic acid - format 2
taqman probes
probe with dye at 5' end and quencher at 3' end; exonuclease activity of taq degrades probe, separating dye and quencher allowing fluorescence
analyte-specific reagents (ASR)
probes, primers, antibodies, etc. that detect a specific target
What is basic summary of Reverse transcription - PCR?
process which a ssRNA molecule gives rise to a complementary DNA (cDNA) molecule through a primer-dependent polymerase-dependent reaction
polyclonal antibodies
products of a generalized response to a specific antigen
How can genotyping be helpful in treating Hepatitis?
progression response to therapy severity of disease
Define wild type
properly functioning gene;
homologous chismata formation
prophase I
Define penetrance
proportion of individuals with a gene mutation who actually express the disease condition
Altered function
protein cannot carryout its normal function or cannot function very well (sickle cell anemia)
DNA 260/280 < 1.6
protein contamination
Exons
protein info this is what is translated separated by introns
Blotting: western technique is used for what type of nucleic acid?
protein; probed with radioactive or enzymatically-tagged antibodies, molecular weight measure in Dalton (gram per mole) or Da
Electrophoresis: 2-dimensional technique is used for what type of nucleic acid?
protein; separates analytes in direction 90 degrees, spread out across 2-d surface having different properties
trans factors
proteins that bind to cis factors and direct assembly of transcription complexes at proper gene
Direct Insertion repair
purine insertase
Mass Spec
quantitate measures amount of light passing thru
RNA POL I
rRNA
Does heating a solution from 65C to 75C during hybridization raise or lower stringency?
raises
Are thalassemias dominant or recessive?
recessive
crossmatching
recipient serum is source of antibodies tested against donor lymphocytes
monoclonal antibodies
recognize defined antigen or epitope
Describe the basic microarray readout base on intensity?
red: strongly increased activity in treated cells green: strongly decreased activity in treated cells light blue: gene equally active in treated and untreated black: gene inactive in both groups
Define Biomarkers
refers to a measurable indicator of some biological state or condition
Define Pharmacogenetics
refers to the study of inherited differences (variation) in drug metabolism and response
Define open reading frame
region of DNA comprised of codons coding for an amino acid sequence (ORF)
Subtelometric rearrangements
regions near the ends of chromosomes ( subtelometric regions) are the frequent site of small deletions and duplications
Define genetic code
relationship between DNA and amino acid sequence
DNA polymerase I
removes RNA nucleotides form RNA primers and replaces with DNA (makes sure primers that start replication are removed)
Xerodema pigmantosum results in what change in DNA?
repair mechanisms doesn't work, sunlight-sensitive high risk of skin cancers & required for nucleotide excision repair
Define origin of replication (ori)
replication begins by opening the helix
Type III restriction enzymes
resemble type I enzymes in their ability to methylate and restrict (cut) DNA. - adenine methylation occurs on only one strand.
Achondroplasia
resembles hypochondroplasia
Colicinogenic factors
resistance to bacteriocins, toxic proteins manufactured by bacteria.
R-factors
resistance transfer factors. Carry antibiotic resistance to common antibiotics.
peptide nucleic acids & locked nucleic acid probes
resistant to nucleases (don't have phosphodiester backbone) & hybridize more effectively (don't have (-) charge)
Define gyrase
restores negative supercoils
Electrophoresis: polyacrylamide (PAGE) technique is used for what type of nucleic acid?
restrain larger molecules from migrating as fast as smaller molecules, better to separate (tiny/smaller) & visualize fragments.
What is the use of restriction endonucleases in recombinant DNA technology?
restriction enzymes cut dsDNA, depending on where the enzyme cuts, it will either make "sticky ends" or "blunt ends" used to generate appropriate ends on the vector and the DNA insert so that you can use the enzyme ligase to "stick" them together to make a recombinant DNA
primer dimers
result from binding of primers onto each other through short (2-3 base) homologies at 3' ends & copying of each primer sequence
Inversion
results from 2 breaks within a single chromosome
Nonsense mutation
results in a premature stop codon, or a nonsense codon in the transcribed mRNA
Line Probe Assay (LiPA)
reverse hybridization assay using sequence-specific oligonucleotide probes (reverse SSOP) multi-parameter testing --> single strip
Define messenger RNA
ribonucleic acid that carries information from DNA in the cell nucleus to ribosomes in the cytoplasm
RNA
ribonucleic acid; single-stranded molecules transcribed from DNA in the cell nucleus or in the mitochondrion or chloroplast, containing along the strand a linear sequence from which it is transcribed
3'
ribose carbon bound to hydroxyl group for forming phosphodiester bond
1'
ribose carbon bound to nitrogen base
5'
ribose carbon bound to phosphate functional group
Define shine delgamo sequence
ribosome binding site at the 5' end of the mRNA
What the enzymes and structures necessary for translation in prokaryotes?
ribosome, A-site, P site, fMet, tRNA, AUG, elongation factors, UGA_UAG_UAA,
A form
right handed double helix, dehydrated
B form
right handed double helix, hydrated (standard form)
anticipation
rising phenotypic severity through generations of a family
What gene mutations confer rifampin resistance?
rpoB katG
Open Reading Frame (ORF)
sections of DNA that begin with start codons and end with stop codons DNA: 5' --> 3' transcription: 3' --> 5' DNA --> RNA (promoter) translation: 5' --> 3' mRNA
Open Reading Frame
sections of DNA that begin with start codons and end with stop codons DNA: 5' --> 3' transcription: 3' --> 5' DNA --> RNA (promoter) translation: 5' --> 3' mRNA
What is the basic components of molecular test performance?
sensitivity: TN/TN+FN*100 speciificity: TP/TP+FP*100 accuracy: TN+TP/TN+TP+FN+FP*100 proficiency testing
Electrophoresis: sodium dodecyl sulfate polyacrylamide (SDS-PAGE) technique is used for what type of nucleic acid?
separate protein under denaturing (confers negative charge) determined by intrinsic electrical charge of polypeptide by molecular weight
western blot
separate proteins on SDS-PAGE or IEF gels after denaturing, renature with mild buffers before transfer
What are the areas where bioinformatics is currently in use as well as example?
sequence analysis; computer programs are used to search the genome of thousands of organisms, containing billions of nucleotides compensate for mutations (exchanged, deleted or inserted bases) in the DNA sequence, in ordered to identify sequences that are related, but not identical
Primary protein structure
sequence of a chain of amino acids
primary structure
sequence of amino acids
restriction fragment length polymorphisms (RFLPs)
sequence variations that result in creating, destroying or moving a restriction site
Define restriction fragment length polymorphisms (RFLP)
sequence variations that result in creating, destroying, or moving a restriction site
A molecular-based test commonly used in testing donors and recipients prior to organ transplantations is
sequence-specific PCR
haplotype
series of linked alleles always inherited together
Define operon
series of structural genes transcribed together on one mRNA and subsequently separated into individual proteins
operon
series of structural genes transcribed together on one mRNA, separated into individual proteins
What are the values of heterologous intrinsic of internal controls in amplification in the reliability of PCR results?
serve to ensures that the human nucleic acid is present in the sample in addition to controlling for extraction and amplification
What are the sex chromosomes?
sex of diploid organism is determined by these chromosomes
What is (p)?
short arm
single strand conformation polymorphism (SSCP)
short ds PCR products denatured then rapidly cooled; fold into conformers; resolve on gel; mutations cause different conformation & migration pattern
STR
short tandem repeats
secondary structure
side chain interactions (ie, alpha helices and beta-pleated sheets)
Branched DNA
signal amplification test and uses alkaline phosphatase
Branched DNA (bDNA)
signal-dependant amplification instead of product-dependant no enzyme detection by signal from "capture probes" microtiter kinda like a hybridization
Strand Displacement Amplification (SDA)
simultaneous amplification and real-time detection high throughput high sensitivity done within a 96-well plate
What is basic summary of Real-time or quantitative PCR?
simultaneously quantify & amplify a specific part of DNA; determine whether or not specific sequence present
Hepatitis genome
single - stranded high mutation rate quasispecies six major genotypes, lots of subtypes
Define SNP
single nucleotide polymorphism; one base-pair variation from a reference DNA sequence
pyrimidines
single ring; thymine & cytosine
What does parental divorce mean and why is it necessary?
single strand binding protein, SSB, prevents the two strand from getting back together; prevented from re-binding
Define sense strand/coding strand
single strand of a DNA double helix that is not used as a template for messenger RNA synthesis
Define antisense strand/template strand
single strand of a DNA double helix that is used as template for messenger RNA synthesis
Which method is best suited to screen for mutations in a gene having multiple possible mutations
single-strand conformational polymerization
What are primer dimers?
size is sum of two primers taq extends one primer, which is annealed to another primer
2.9 billion bp
size of human genome
For electrophoresis, what are some factors that determine the mobility of molecules?
size of the molecule and its conformation, the net charge of molecule, temperature, and the pore size of matrix
haptens
small molecules attached to carrier molecule that generate antibody response
How is translation initiated?
small subunit binds to ribosomal binding site MET anticodon binds to start codon large subunit binds to small subunit
What is the theory behind DNA typing in forensic specifically CODIS?
software program that operates local, state, and national databases of DNA profiles from convicted offenders, unsolved crime scene evidence, and missing persons by 13 STR loci to compare profiles
What are some direct analysis methods?
southern PCR - ASO blot, restriction digest SSCP HA
An RFLP is most likely detected using which of the following methods
southern blot
What methods can be used to detect muscular dystrophy mutations?
southern blot mutiplex PCR
What is spoligotying that is used to type bacterial strains in epidemiological investigation?
spacer oligonucloetyping 10-50 copies of 36-bp direct repeat region separated by spacers spacers have differnet sequences strains differ in presence of absence of specific spacers spacer sequences conserved among strains
How can Tween 20 affect PCR?
stablizes Taq supress formation of 2* structures increase yeild increase non-specific amplification
AUG
start codon (methionine)
Define Metabolomics
stematic study of the unique chemical fingerprints that specific cellular processes leave behind
How is translation terminated?
stop codon is carried into small subunit by tRNA recognized by release factor, breaks bond b/w chain and tRNA released from ribosome and out into cell
Which statement is true concerning the analysis of short tandem repeats (str)
str alleles are determined by PCR product size
Define Proteomics
study of the proteome, usually through array or mass spectrometry analysis
A metaphase chromosome with primary constriction that gives the chromosome clearly defined short and long arms is considered
submetacentric
Nonconservative mutation
substitution of a biochemically different amino acid which changes the biochemical nature of the protein
t(x;18)
synovial sarcoma;SYT-SSX1 & SYT-SSX2
RNA Polymerase III
synthesize tRNA, some snRNA
Mantle Cell Lymphoma (MCL)
t(11:14) CCND1 / IgH genes overexpression of cyclin D1 (cell cycle gene)
MALT Lymphoma (a.k.a. Marginal Zone)
t(11:18) API2 / MLT genes "mucosa-associated lymphoid tissue"
Mantle cell lymphoma (MCL)
t(11;14)(q13;q32), Cyclin D1;IgH Cyclin D1: needed for cell cycle t causes overexpression of cyclin D1 > clonal expansion of B lymphocytes Dx: FISH, CT/PET scan for high glucose metabolism spots
Acute lymphoblastic leukemia (ALL)
t(12;21) TEL-AML1 fusion t(9;22)(q34;q11) BCR-ABL fusion (Philly chr) Abl is a Tyr kinase; t causes Abl to be constitutively expressed > unregulated lymphoblast proliferation Common in children Dx: karyotyping, IHC, S.blot, RT-PCR, q-PCR Treatment: Imatinib (Gleevec), Tyr kinase inhibitor
Follicular non-Hodkin's Lymphoma
t(14:18) IgH / BCL2 genes
Follicular lymphoma
t(14;18), IgH;Bcl-2 WT Bcl2 regulates apoptosis t causes overexpression of Bcl2 > immortal cell (clonal B cell expansion) Most common indolent N.H.L. Dx: PCR w/ primers for MBR/MCR & J regions
Acute Promylocity Leukemia (APL)
t(15:17) PML / RARa genes
Burkitt's non-Hodkin's Lymphoma
t(8:14) dysregulation of c-myc gene breakpoints on ch.8 spread over 190kbp region 5' to 3'
Burkitt's lymphoma
t(8;14)(q24;q32), c-myc;IgH t causes c-myc to be constitutively expressed > unregulated proliferation (clonal B cell expansion)
Acute myeloid leukemia (AML) Promyelocytic (APL)
t(8;21) RUNX1/RUNX1T1 Common in adults; myeloblasts 'freeze' in current state (don't differentiate) & proliferates forming a clonal population Dx: Flow cytometry, FISH Treatment: Chemo., BM transplant APL t(15;17) PML;RARα, Promyelocytic leukemia protein;Retinoic acid receptor alpha
Chronic Myelogenous Leukemia (CML)
t(9:22) a.k.a. Philadelphia chromosome ABL1 / BCR genes
Chronic myelogenous leukemias (CMLs)
t(9;22) Abl;Bcr (Philly chr) BCR-ABL constitutively active > activates Jak/Stat; inhibits apoptosis > unregulated proliferation of myeloid cells Clonal expansion of myeloid cells in BM Dx:Karyotype, FISH, RT-PCR Treatment: Imatinib (Gleevec)
RNA POL III
tRNA
aminoacyl tRNA
tRNAs that carry amino acids
QB replicase
target RNA goes through series of binding and washing steps; probe bound to template then amplified
branched dna amplification (bDNA)
target nucleic acid is denatured and binds to capture probes fixed to plate well; extender or preamplifier probes bind to captured target; binds multiple alkaline-phosphatase-labeled nucleotides; measure chemiluminescence
scorpion-type primers
target-specific primers tailed at 5' end with quencher, stem loop and fluorophore; after polymerization, secondary structure of primer overcome by hyb of primer to target, allowing fluorescence
What is the differences between target and signal amplification?
targets involves synthesis of new copies of target sequences and signal involves amplification of detection signals
Define transcription
template-guided synthesis of RNA by RNA polymerase
Rho-independent termination
termination that occurs at G:C rich region; G:Cs transcribed and fold into hairpin, slows elongation complex, dissociates at A:T rich area (prokaryotes)
During the G2 phase of the cell cycle, the DNA content of a cell is
tetraploid
Define lagging strand
the 5' to 3' strand copied in a discontinuous manner
Define dominant allele
the allele that expresses itself at the expense of an alternate allele
Define recessive allele
the allele whose expression is suppressed in the presence of a dominant allele
Define global regulation
the coordinated control of large groups of genes; protein involved
Prader-Willi syndrome
the deletion is in the paternally derived chromosome 15q-; small hands and feet, hypogonadism (15q11.2)
X-linked
the exception to the "everyone-has-two-copies-of-each-gene" rule are male sex chromosomes
Down syndrome
the extra chromosome 21 is usually maternally derived, resulting from meiotic disjunction in a karyotypically normal female; trisomy 21
Define Amino or N-terminus
the first amino acid in chain retains free amino (NH2) group
Trisomy
the gain of a complete chromosome
Why does Sanger sequencing use ddNTPs instead of dNTPs?
the lack of a 3' OH on the ddNTP makes it impossible for pol to add more nucleotides --> chain termination
Define Carboxy or C-terminus
the last aa is left with a free carboxy (COOH) group
Monosmy
the loss of a complete chromosome
Deletion
the loss of a portion of DNA
Microdeletion /microduplication
the loss or gain of a portion of chromosome that is small by cytogenic standards but large enough to affect multiple genes
Spontaneous abortus
the most common abnormalites are monosomy X (45, X), triploidy (69, XXY) and trisomy 16 (47, XX+16); trisomy 21 common finding
Translocation
the physical rearrangement of 2 chromosomes where material is transferred from one to the other
Duplication
the presence of an extra segment of DNA from the same chromosome
Isochromosome
the presence of only short or long arm material on either side of the centromere
Define Mosacism
the presence of two populations of cells with different genotypes in one individual who has developed from a single fertilized egg
Define semi-conservative replicate
the process of making copies of DNA; each of progeny converse half of the original DNA molecule; one daughter cell has the original "right" strand and the other has the original "left" strand
Define Transcriptomics
the study of the transcriptome, the complete set of RNA transcripts produced by the genome at any one time
What are tumor suppressor genes?
they down regulate cell division cancer-fighters p53 most common
Define codon
three nucleotide sequences that will guide the insertion of a specific amino acid into protein
3 fold
to be clinically relevant, changes in HIV viral load must be __________
What is the purpose of primers in PCR?
to intiate replication
The klenow fragment of E.coli DNA polymerase 1 is used
to label DNA probes by random primer labeling *klenow fragment lacks 5'-->3' exonuclease activity and is therefore used for random primer labeling
What is the purpose of the enzyme uracil-N-glycolase in a molecular diagnostics laboratory
to remove any previously generated amplicons containing dUTP from PCR reactions
Too many and too few ddNTPs result in:
too many ddNTPS will result in many short sequence reads, too little will result in loss of sequencing data but will give a longer read.
Unwinds DNA
topoisomerase
What are the enzymes required to replicate DNA?
topoisomerase (gyrase) , helicase, polymerase III, polymerase I, ligase, editing endonucleases, gyrase, and methylases
What is transfusion?
transfer of DNA from one organism to another
transformation
transfer of genetic material between bacteria without physical association; causes new phenotype
Methyltransferase repair
transfers methyl group to itself from guanine
TAE Buffer
tris-acetate w/ EDTA good for DNA recovery good for lg fragments low buffering capacity increases migration of DNA thru gel
TBE Buffer
tris-borate w/ EDTA good for small DNA fragments high buffering capacity decreases migration thru gel
What are the chromosome and gene mutations associated with specific cancers?
tumor protein 53 (TP53) Ataxia telangiectasia mutation gene (ATM) m(11q22) Breast cancer BRCA1 17q21 & BRCA2 13q12 Von Hippel-Lindau gene (VHL) 3p26 n-myc gene 2p24
What are some NEG mediators?
tumor suppressors metastasis repressors cell cycle controls differantiation promoters cellular homeostasis promoters
Cancer
tumors have ability to invade surrounding normal tissues (uncontrolled growth)
Purine
two carbon rings Adenine, Guanine
Transcription-Mediated Amplification (TMA)
two enzymes: RT and RNA pol isothermic RNA or DNA
Define linkage
two genes are linked when they are on the same chromosome
Define Chimerism
two or more genotypes arises from the fusion of more than one fertilized zygote in the early stages of embryonal development
Edward syndrome
typical features in neonate include clenched fists, intrauterine growth retardation, inguinal and/ or umbilical hernias, cardiac defects, low-set ears, rocker-bottom feet; trisomy 18
EGFR (epidermal growth factor receptor), ERBB1
tyrosine kinase activity, frequently overexpressed in solid tumors; exon 19 dels & exon 21 point mutations
Define gene
units of genetic information; order of sequence of nucleotide on chromosomes contain all genetic info. to make function protein or RNA product
For Angelman PCR detection, which allele is detected?
unmethylated 100bp
How does Fragile X break the first law of genetics?
unstable and can change from gene to gene non-mendelian inheritance
gyrase
unwinds DNA in front of fork
How can PCR be used to diagnose lymphomas?
use V and J segment primers. recognize shared DNA sequences
Heterduplex Analysis (HA)
use for known gene, unknown mutation mutation screening bands on gel --> retarded migration from WT due to seq differences
What is the best method to rule out the possibility of genomic DNA giving a false-positive result in an RT-PCR reaction
use of upstream and downstream primers that span an exon-intron-exon region of the target
Branched DNA Technololgy (bDNA)
used for DNA or RNA; short probes are used to capture the target nucleic acid and then to multiple reporter molecules, loading the target nucleic acid with signal.
SIngle-Stranded Conformational Polymorphism Ananlysis (SSCP)
used for known gene, unknown mut mutation screening short PCR products takes 3D shape when cooled --> muts have different shape than WT non-denaturing PAGE
Type II restriction enzymes
used most frequently in the laboratory - do not have inherent methylation activity in the same molecule as the nuclease activity
ethanol, isopropanol & salt
used to precipitate DNA
high salt, low pH
used to precipitate proteins
Transcription Mediated Technology (TMA)
uses RNase H which degrades RNA from the intermediate hybride so denaturing is no longer required; Isothermal process - negates the requirement for thermal cycling to drive rxns. Targeting RNA allows for the direct detection of RNA viruses (HCV, HIV).
What is IS110-based genotyping that is used to type bacterial strains in epidemiological investigation?
uses southern blotting technique DNA digested with restriction enzyme Pvul probe hybridized to DNA to right of the Pvul site size of fragment depends on distance to the next Pvul site
What is arbitrarily primed PCR that is used to type bacterial strains in epidemiological investigation?
using 10 base long oligonucleotides of random sequences of prime DNA amplification all over the genome two organisms have same pattern same type patterns differ organisms different type
Vancomycin Resistance (Enterococcus)
van A
VNTR
variable number of tandem repeats
Autosomal dominant disorders have what kind of inheritance?
vertical
Give an example of quantitative detection of an infectious disease.
viral load
transduction
viruses transfer genetic info between bacteria (bacteriophages)
Define crossing over
when two different strands of DNA are broken and are then joined to one another
Ribosomes
where mRNAs and tRNAs meet Large and small form packets (A, P and E) catalyzes peptide bond formation b/w amino acids by rRNA
Muscular Dystrophy is what kind of disorder?
x-linked recessive trinucleotide repeat disorder
What types of diseases occur when repair mechanisms do not work properly?
xerodera pigmantosum & ataxia telangiectasia
acid citrate dextrose
yellow tube
Do you have to know the gene sequence in orde to do DNA sequencing?
yes, but you do NOT need to know the mutation
nucleosome
~150bp wrapped around complex of 8 histone proteins (2x H2A, H2B, H3 and H4)
α thalassemia
α genes on chr 16, two from each parent, wt: αα/αα α thalassemia when 1+ of these genes are affected Severity increases with number of genes affected
β thalassemia
β genes on chr 11, one from each parent, wt: β/β β thalassemia when 1+ of these genes are affected Severity increases with number of genes affected
