bio 14

Which of the following is an overgrowth of cells that serves no useful purpose? tumor oncogene proto-oncogene growth callus

tumor

Germ-line cells

give rise to gametes( female and male sex organs) mutations can occur in a sperm or egg cell or in a cell that gives rise to eggs and sperm.

proto-oncogenes

good genes,but if mutated can become an oncogene 4 common genetic changes 1.missence mutaions 2. gene amplifications 3.chromosomal translocations 4.Retroviral insertions

a_____ can alter the structure of a protein (but not the total number of amino acids) so that it is abnormally high activity.

missense mutation

chromosomal translocation

two different chromosomes break, and the ends of the broken chromosome fuse with each other incorrectly.

Somatic cells

are all other body cells, mutations can occur late in development , genetic mosaic results from patches of mutated tissue,

_______ can convert proto-oncogenes into oncogenes. Gene amplifications Retroviral insertions Chromosomal translocations Missense mutations All of these choices are correct

All of these choices are correct

A mutation may alter the sequence within a promoter and affect the rate of transcription i.e. "TATA" mutated to TACA

Also mutations may occur in regulatory elements or operator sites.

what cancer would occur if both copies of the Rbgene and both copies of the E2F gene were rendered inactive due to mutations?

Cancer would not occur if both copies of the Rb gene and both copies of the E2F gene were rendered inactive due to mutation. an active copy of the E2F gene is needed to promote cell division.

could drugs that inhibit protein kinases be used to combat cancer?

Drugs that inhibit protein kinades may be used to combat cancer if they target the protein kinases that are overactive in certain forms of cancer,

how does the presence of a growth factor ultimately affect the function of the cell?

Growth factors turn on a signaling pathway that ultimately leads to cell division.

Why is a person with xeroderoma pigmentosum so sensitive to sunlight ?

The sun has UV rays and other harmful radiation that could damage DNA .A person with XP has a defect in the nucleotide excision repair pathway. Therefore their DNA is more likely to suffer mutations ,which causes growths on the skin.

Which of the following is most likely to occur when a tumor-suppressor gene is mutated? The tumor-suppressor gene may be overactive. The resulting tumor-suppressor protein would further suppress cell proliferation. The resulting tumor-suppressor protein would activate an oncogene. The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation. None of the choices are possible.

The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation.

What components of NER are responsible for removing the damaged DNA?

UvrC and UvrD are responsible for removing the damaged DNA, UvrC makes cuts on both side of the damage and then UvrD removes the damaged region

cancer

a diease of multicellular organisms,charaterized by uncontrollable cell divison. most cancers about 90% do not involve genetic changes that are passed from parent to off spring.

Mutation

a heritable change in the genetic material

oncogenes

a mutant gene from the proto-oncogene

induced mutations

are brought on by environmental agents. they are at a higher rate than spontaneous mutation rate

chimeric genes

are composed of two gene fragments fused together.

point mutations that do not alter the amino acid sequence of the resulting gene product are called___ mutations. a.frameshift b.natural c.silent d.nonsense e.missense

c.silent

missense mutation

changes a single amino acid in a protein, alters the function of the encoded protein in a way that promotes cancer

If a cell accumulates DNA damage during mitosis , the cell cycle can pause at a ___.

checkpoint

Should a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle. cis-acting elements checkpoint proteins trans-acting elements growth factors Ras's

checkpoint proteins

Induced: chemical mutagens

chemical subatances that may cause changes in the structure of DNA.

silent mutations

does not alter the amino aid sequence; occur in the third base of many codons. Genetic code is a degenerate.

mutagens can cause mutations by a.chemically altering DNA nucleotides b.disrupting DNA replication c.Altering the genetic code of an organism. d.all of the above e. a and b only

e. a and b only

oncogenes can be produced by a missense mutations b.gene amplification c. chromosomal translocation d.retroviral insertion e. all of the above.

e. all of the above.

Ras

intracellular signaling protein,when GTP is bound Ras promotes cell division .when GTP is hyrodlyzed to GDP and Pi, RAS is inactivated and cell division is inhibited,

sickle-cell disease

is the result of a single amino acid substitution

malignat

lost normal growth regulation,invasive can invade healthy tissue, can migrate to other parts of the body(metastatic)

A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein? nonsense mutation missense mutation silent mutation sense mutation frameshift mutation

nonsense mutation

A mutation causes a gene to become overactive, contributing to uncontrolled cell growth. Which term best describes this gene? tumor-suppressor gene oncogene spliced gene alternatively spliced gene malignant gene

oncogene

Induced: physical agents

physical agents such as UV(ultraviolet) light and x-ray can damage the DNA

A tumor suppressor gene normally functions to increase expression of tumor genes. prevent development of cancer. mutate DNA in non-dividing cells. cause growth of tumors from non-tumor cells. increase damage to DNA resulting from UV light.

prevent development of cancer.

The bcr gene is normally expressed in blood cells.explain how this observation is related to the type of cancer that translocation causes.

the type of cancer associated with this fusion is leukemia,which is a cancer of the blood cells. the gene fusion produces a chimeric gene the is expressed in blood cells because it has the bcr promoter.the abnormal fusion proten promotes cancer in these cells.

Which of the following types of physical mutagens produces thymine dimer mutations? ultraviolet light X-rays microwave gamma rays ionizing radiation

ultraviolet light

retroviral insertions

viral DNA may insert into a host chromosome in such way that viral promoter and response elements are next to a proto-oncogene.

The insertion of a ___ into the promoter of a gene could result in increased expersion of the gene resulting in cancer,

virus

Thymine dimer

a site where two adjacent thymine bases become covalently cross-linked to each other,

gene amplifcations

abnormal increase in copy number of results in too much of the encoded protein

Frameshift mutation

addition or deletion of nucleotides that are not multiples of 3 .completely different amino acid sequence downstream from mutation.

point mutation

affect only a single base pair ; 2 basic alterartions 1) the base sequence within agene can be changed 2) one or more base pairs can be removed from a gene

cancer cells are said to metastatic when they a.begin to divide uncontrollably b.invade healthy tissue c. migrate to other parts of the body d. cause mutations in other healthy cells e. do all of the above.

c. migrate to other parts of the body

many cells that hav accumulated mutations are eliminated by____.

cell death

Nonsense mutation

change from a normal codon to a stop or termination codon. produces truncated polypeptides.

missense mutation

changes a single amino acid in a polypeptide. may not alter function if substituted amino acid is similar in chemistry to orginal.

a ____ can cause fusion of two genes together , resulting in formation of chimeric onogene

chromosomal translocation

Sickle-cell anemia is a human disease that occurs as a result of what type of mutation in the b-globin gene? silent missense nonsense frameshift sense

missense

carcinogens

80% of human cancers are related to exposure to carcinoges.most carcinogens are mutagens that promote genetic changes in somatic cells.

base substitution

A mutation that involves the substitution of a single base in the DNA for another base.

At what phase of the cell cycle does p53 halt cell division if it senses DNA damage? S G2 M G0 G1

G1

Which of the following statements about canc... Which of the following statements about cancer is FALSE? It is characterized by uncontrolled cell division. Over 1 million Americans are diagnosed with cancer each year. Most cancers involve genetic changes that are passed from parent to offspring. At least 80% of all human cancers are related to exposure to carcinogens. It is caused by an accumulation of mutations.

Most cancers involve genetic changes that are passed from parent to offspring

Which of the following is true concerning a somatic cell mutation? A small fraction of the gametes carry the mutation. Half of the gametes carry the mutation. All of the gametes carry the mutation. Only a small group of cells within the organism is affected by the mutation. All cells within the organism are affected by the mutation.

Only a small group of cells within the organism is affected by the mutation.

Which of the following would occur from a mu... Which of the following would occur from a mutation in the gene's promoter region? The sequence of the mature mRNA would change. The ability of pre-mRNA to be properly spliced would change. The ability of mRNA to be translationally regulated would change. The amino acid sequence of the translated protein would be altered. The rate of transcription may increase or decrease.

The rate of transcription may increase or decrease.

What would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene? a silent point mutation with no deleterious effects a missense point mutation resulting in the change of one amino acid a nonsense point mutation resulting in the generation of a premature stop codon a frameshift mutation, producing a different amino acid sequence altogether All of the choices are possible.

a frameshift mutation, producing a different amino acid sequence altogether

why is a thymine dimer harmful ?

a thymine dimer is harmful because it can cause errors in DNA replication.

tumor

an overgrowth of cells with no useful purpose. may begin as benign or precancerous, do not invade or spread.

what aspect of hemoglobin structure does glutamatic acid at the sixth position in normal beta- globin prevent? speculate how the charge of this amino acid may play a role.

at neutral PH, gluatamic acid is negatively charged. perhaps the negative charges repel each other and prevent hemoglobin proteins from aggregating into fiber like structures.

The Ames test a.provides a way to determine if any type of cell has experienced a mutation. b. provideds a way to determine if an agent is a mutagen. c. Allows researchers to experimentally disrupt gene activity by causing a mutation in a specific gene. d. provides a way to repair mutatuins in bacterial cells. e.does all of the above.

b. provideds a way to determine if an agent is a mutagen.

if a mutation eliminatated the function of UvrC, which aspect of nucleotide excision repair would not work? a. sensing a damaged DNA site b. endonuclease cleavage of the dmaged strand c.removal of the damaged strand d.synthesis of a new strand using the undamaged strand as a template. e. none of the above

b.endonuclease cleavage of the dmaged strand

xeroderma pigmentosum a, is a genetic disorder that results in uncontrolled cell growth. b.is a gentic disorder in which the NER system is not fully functional. c is agenetic disorder that results in the loss of pigment in certain patches of skin. d.results from the lack of DNA polymerase proofreading e. is both b and d

b.is a gentic disorder in which the NER system is not fully functional.

Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp base addition - silent substitution - missense base addition - missense substitution - nonsense base addition-frameshift

base addition-frameshift

what is the advantage for an organism to have checkpoints that can stop the cell cycle?

checkpoints prevent cells division if a genetic abnormality is detected. this helps to properly maintain the genome ,therby minimizing the possibility that a cell harboring a mutation will divide to produce two daughter cells.

a change in the number of _____ of a gene can cause too much protein to be made.

copies

Which of the following proteins is responsible for advancing a cell through the four phases of the cell cycle? caspases cyclins claudins endonucleases cofactors

cyclins

a mutation in which of the following regions is least likely to affect gene function? a promoter a. coding region c.splice junction d.intergenic region e.regulatory site.

d.intergenic region

Some point mutations lead to an mRNA that produces a shorter polypeptide.this type is known as a ___ mutation. a.neutral b.silent c.missense d.nonsense e.chromosomal

d.nonsense

the mutagenic effect of UVl ight is a. alteration of cytosines bases to adenine bases. b. the formation of adenine dimers that interfere with genetic expression c.the breakingof the sugar-phosphate backbone of the DNA molecule. d.the formation of dimers that disrupt DNA replication e.the deletion of thymine bases along the DNA molecule,

d.the formation of dimers that disrupt DNA replication

When cancer cells have the ability to migrate to other parts of the body, they are said to be invasive. benign. metastatic. oncogenic. genetic.

metastatic.

Nucleotide excision repair (NER)

most common DNA repair system, the region encompassing several nucleotides in the damaged strand is removed from the DNA .Intact undamaged strand is used as a template for resynthesis of a normal complementary strand. .found in all eukaryotes and prokaryotes .

Which of the following proteins is a transcriptional factor that binds genes and regulates the transcription of genes that promote cell division? GRB2 epidermal growth factor myc raf-1 MAPK

myc

MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and increases in the rate of cell division, then the mutated gene is called a(n) spliceosome. transposon. tumor-suppressor gene. oncogene. None of the choices are correct.

oncogene.

Why are somatic mutations unable to be transmitted to offspring?

only germ-line cells give rise to gametes .a somatic cell cannot give rise to a gamete and therefore cannot be passed to offspring,

tumor suppressor genes

proteins encoded by tumor-suppressor genes usually have one of two functions 1. proteins that maintain the integrity of the genome by monitoring and/or repairing alterations in the genome. 2.proteins that are negative regulators or inhibitors of cell division.

The Ras protein normally regulates cell growth. A mutation that occurs in the gene encoding Ras can cause Ras to become overactive, which results in cancer. This means that Ras is an example of a/an retrovirus. tumor-suppressor gene. carcinogen. proto-oncogene. enhancer protein.

proto-oncogene.