Bio 148 Exam II
Transcription starts at ___. Translation starts at ___.
+1 nucleotide, start codon
Transcription begins at the _____________. Translation begins at the __________.
+1 nucleotide, start codon Transcription begins right downstream of the promoter, at the +1 nucleotide. When translation of the RNA occurs, it will begin at the start codon in the RNA.
If the bottom strand of the DNA is used as a template for transcription, which of the following RNAs would be produced? 5' ATTAGCCTTTAAAT 3' 3' TAATCGGAAATTTA 5'
5' AUUAGCCUUUAAAU 3' template is read 3' to 5', the produced is complementary
The region between the +1 nucleotide and the start codon is called the ________
5' UTR
Which of the following is part of a mature mRNA but NOT found in a primary transcript? introns start codons 5' cap
5' cap
If the bottom strand of DNA is used as a template for transcription, which of the following RNAs would be produced?5'-ATTAGCCTTTAAAT-3' 3'-TAATCGGAAATTTA-5'
5'-AUUAGCCUUUAAAU-3'
Which of the following mRNA sequences was transcribed from the DNA sequence shown here if the sequence is from the template strand? 3'-AAGTCCGGTA-5'
5'-UUCAGGAU-3'
Which of the following is a true statement?
An individual with high fitness has more surviving offspring than individual who is less fit.
Which of the following accurately describes how the presence of an antibiotic causes evolution in a bacterial population?
Antibiotics cause antibiotic resistant bacteria to have higher fitness than antibiotic sensitive bacteria. If a bacteria is resistant to an antibiotic, then it will be more likely to survive and reproduce. The following generation of bacteria will therefore have higher rates of antibiotic resistance.
You have a friend helping you study for the exam. They tell you the four statements below. Which one is FALSE?
Bacteria mutate to become resistant to antibiotics only when antibiotics are present in the environment
Gene duplication events have been important for the evolution of new traits because
One copy of the gene can undergo mutation and eventually adopt a new function
Each nucleotide in an RNA codes for one amino acid
False Its a combination of three nucleotides in the RNA that codes for one amino acid.
Transcription begins at a start codon.
False Transcription begins at the +1 nucleotide
Transcription begins at a start codon.
False Translation begins at a start codon
Which of the following is made out of DNA nucleotides (i.e., is part of a DNA molecule)?
Gene switch
What determines the tertiary structure of proteins?
Genes determine the amino acid sequence of the protein, which determines its tertiary structure
Two distantly related species (like a cow and a yeast) will:
Have many genes that differ between the two species
Resistance to a wide variety of insecticides, antibiotics, and herbicides has recently evolved in hundreds of insects, bacteria, and plants. Which of the following best explains why?
Humans are altering the environments of these organisms, and the organisms are evolving by natural selection
A protein functions in the cytoplasm. You would expect to find _______ amino acids on the exterior of the folded protein and __________ amino acids in the interior.
Hydrophilic, hydrophobic
A protein functions in the cytoplasm. You would expect to find ___ amino acids on the exterior of the folded protein and ___ amino acids in the interior.
Hydrophilic, hydrophobic hydrophilic - watery environment hydrophobic - avoiding watery environment and interaction with each other
Which of the following is NOT bound to the central atom of an amino acid?
Hydroxyl group
Which of the following is a similarity between DNA and RNA?
In both, nucleotides are connected by phosphodiester bonds Only RNA has a 2' hydroxyl group. This is because the hydroxyl group is found on the sugar in nucleotides, and RNA and DNA use different sugars (RNA uses ribose and DNA uses deoxyribose). In both RNA and DNA, nucleotides are connected by phosphodiester bonds.
Which of the following is true concerning artificial selection?
It can change the heritable characters and the frequency of alleles in a population over time
Which of the following statements accurately describe(s) tRNA? Choose the most complete correct answer.
It carries amino acids to the ribosome AND It is transcribed from a DNA template
Which of the following is true concerning mRNA in eukaryotes. (Choose the most complete answer.)
It is produced in the nucleus and translated in the cytoplasm
Which event could create a bacterial cell that is antibiotic-resistant in a population of bacteria that initially are not resistant?
Random mutation
Mutation is a ______ process, while natural selection is a ________ process.
Random, directed
Mutation is a _______ process, while natural selection is a ______process.
Random, directed
Which of the following does NOT occur during RNA processing? addition of a 3' poly A tail addition of a 5' cap splicing Removal of exons from the primary transcript
Removal of exons from the primary transcript
Which statement restates the fact that rifampin resistance in M. tuberculosis is an adaptation?
Rifampin resistance is a heritable trait that increases the fitness of bacteria in Rifampin compared to susceptible bacteria.
The primary structure of a protein refers to the.......
Sequence of amino acids in a polypeptide
Two members of the same species will:
Share all the same genes, but may contain different alleles
Which of the following is true concerning mRNA in eukaryotes. (Choose the most complete answer.)
It is produced in the nucleus, contains untranslated sequences and is translated in the cytoplasm
Gene DNA sequence W-CTGCAACATGATG-X Y-GACGTTGTACTAC-Z mRNA sequence 5'-CAUCAUGUUGCAG-3' Based on the DNA and mRNA transcript sequence in the image, what letter represents the 3' end of the TEMPLATE strand in the double stranded DNA sequence?
Letter X
A protein called hepatoglobin is synthesized by human liver cells but not by human skin cells. Which of the following explains this fact?
Liver cells have the activator for the hepatoglobin gene switch but skin cells do not. Activators are proteins that attach to gene switches to turn the switch ON. Turning a switch on allows the gene to be transcribed. Both liver and skin cells would have the same gene to code to hepatoglobin, but only liver cells with activator proteins for the hepatoglobin gene's switch would be able to transcribe the gene into RNA and translate it into the hepatoglobin protein.
If the DNA sequence that acts as the template for transcription reads 3' TTT 5', the amino acid it encodes will be:
Lys The codon for Phe is UUU or UUC, which means the DNA template for Phe would be either 3' AAA 5' or 3' GAA 5'. The diagram above shows the CODON sequence for each amino acid. The codons are the complementary sequence of the DNA template for transcription. (But the codons are made out of RNA so they use U instead of T.) So if the DNA template is 3' TTT 5' then the transcribed RNA sequence will be 5' AAA 3'. (Remember that the DNA template sequence will always be complementary to the RNA transcript!) mRNA is always read from 5' to 3' during translation, but in this case the sequence reads the same backwards and forwards so it doesn't matter. AAA = Lys!
How do the chromosomes from a bird and the chromosomes from a whale differ?
Many of the genes are different between the two species Since birds and whales are distantly related, they will have many different genes. For example, birds have a specialized vocal organ called a syrinx that enables them to sing, but whales do not have this organ. Therefore, birds would have genes coding for the development of the syrinx and whales would not.
Where is RNA synthesized in eukaryotes?
Nucleus In eukaryotes, RNA is synthesized in a DNA template, which is in the nucleus
Where is RNA synthesized in eukaryotes?
Nucleus Its synthesized from a DNA template. DNA is in the nucleus
Within a eukaryotic cell, you would expect to find RNA polymerase in the ____. Proteins involved with splicing would be found in the ___.
Nucleus ; nucleus
What fraction of all the genes in your liver cells are transcribed?
Some You do not transcribe every gene in every cell type. Liver cells transcribe liver cell genes
The fish in which the pelvic switch mutation originally occurred had a pelvis. Which statement accurately describes why?
The mutation occurred in germ line cells that gave rise to gametes
What caused the mutation in the pelvic switch?
The mutation was random and may have occurred in the ancestral population that got land-locked in the lakes
If you compare any two different amino acids, how will they differ?
Their R groups will differ
A protein called hepatoglobin is synthesized by human liver cells but not by human skin cells. Which of the following explains this fact?
There is a liver cell gene switch but no skin cell gene switch for the hepatoglobin gene.
Why was there selection for loss of pelvic spine in freshwater environment? Why not just keep the spine?
There were predatory and energetic costs (fitness disadvantages) to having a pelvic spine in the freshwater habitats.
How can different cells in one organism have different shapes and actions?
They express different genes All cells in an organism (except for sex cells) have the same DNA, the same number of chromosomes, and the same genes. The difference between cells is which genes are expressed. For example, in a skin cell, only the genes related to producing and maintaining skin would be expressed, while in a liver cell, only the genes related to producing and maintaining liver function would be expressed. Gene expression is controlled by regulators, such as switches, that turn gene transcription on and off.
A mutation in a gene switch could:
change the amount of protein expressed The sequence of amino acids in a protein would only change if the DNA sequence of the gene that codes the protein has changed. Switches are not part of the gene—they are DNA sequences upstream or downstream of the gene that regulate gene expression. Switches turn transcription of a gene on and off; they do NOT affect the gene sequence or have any effect on what happens during translation. Switches can only change the expression of a protein. Note: "Expression," in this case, refers to whether the protein coded by a gene is actually created at the end of transcription and translation. If the protein is created (that is, if transcription and translation were successful), then it has been expressed.
Genes ___.
code for proteins
Genes ____ .
code for proteins
The LAST amino acid to be translated is always:
could be anything depending on the RNA sequence
Two proteins with different amino acid sequences will have:
different primary structures and different tertiary structures The primary structure is made of a chain of amino acids. The tertiary structure is formed when that amino acid chain folds up and certain amino acids form bonds with each other. So a change in the amino acid sequence would mean the primary structures were different, which would then lead to differences in the tertiary structure.
Which of the following is translated?
exons
Which of the following is translated? 5' cap exons +1 nucleotide promoter both 5' cap and +1 nucleotide
exons
True or false: There are codons that specifically signal "START making proteins" and do not code for anything else.
false
Which process is described by the Central Dogma?
how genetic information is expressed The Central Dogma describes the process by which information (stored as DNA) is expressed by transcribing DNA into RNA and translating RNA into proteins.
What process does the Central Dogma explain?
how genetic information is expressed The central dogma refers to how DNA is transcribed into mRNA and translated from mRNA into proteins.
Which bonds are responsible for the secondary structure called alpha helix?
hydrogen bonds that form between the C=O and N-H groups in the backbone of a polypeptide
A gene that codes for the BIO148 Protein is expressed in the liver and kidneys of an animal. An animal is born with a mutation that prevents the expression of the BIO148 Protein in kidney, but does not prevent its expression in liver. Where is this mutation most likely located?
in a gene switch
Which of the following is part of a primary transcript but NOT part of a mature mRNA? introns 5' cap polyA tail
introns
Fill in the blank. ______ are part of the primary transcript but never leave the nucleus.
introns Promoters and other regulatory elements, such as switches, are not transcribed. The primary transcript includes everything that is transcribed, including the 5' UTR, introns, exons, and the 3' UTR. The primary transcript is then modified to produce mature mRNA by removing (splicing) the introns and adding a 5' cap and 3' Poly(A) tail.
The population of medium ground finches on the island of Daphne Major shows variation in beak size. After a drought, the average beak size of the offspring of surviving finishes increased. Beak size in medium ground finches ____.
is controlled by genes that produce variable phenotypes in the population. Beak depth is heritable and we can see from the graph that there is variation in the population both before and after the drought.
A _____ is a copy of genetic information that can be found in the cytoplasm of eukaryotic cells.
mRNA
Which of the following is used by ribosomes during translation? Introns mRNA Switches mRNA and switches DNA
mRNA
Which of the following is used by ribosomes during translation? switches introns mRNA mRNA and switches DNA
mRNA
Which of the following is/are bound by ribosomes during translation?
mRNA
Which of the following is/are bound by ribosomes during translation? promoter primary transcript mRNA All of the above
mRNA
In a eukaryotic cell the DNA is enclosed in the nucleus, whereas ribosomes that make proteins are located in the cytoplasm. How does the information in DNA needed to specify the amino acid sequence of a particular protein make it to the cytoplasmic protein-manufacturing centers?
mRNA molecules act as the link between genes and protein-manufacturing centers
Which of the following lists the steps of gene expression in the correct order? replication, RNA processing, transcription none of these is correct transcription, translation, RNA processing translation, RNA processing, transcription
none of these is correct
RNA processing occurs in the ___________
nucleus
Where is mRNA made?
nucleus
Pick the CORRECT association between structure and bonds that cause the structure Primary structure Secondary structure Tertiary structure
peptide bonds hydrogen bonds interactions between R groups
What factor appears to have influenced whether having armor or not in sticklebacks is an adaptation?
predation pressure
Transcription produces a
primary transcript
The mutation that caused the loss of expression of Pitx1 in the pelvis of freshwater sticklebacks was _________; the process that selected for individuals without pelvic spine in freshwater lakes was _____________.
random; non-random
Proteins are synthesized when ____________ read ___________ in the ________________ of the cell
ribosomes; mRNA; cytoplasm
Proteins are synthesized when ____________ read ___________ in the ________________ of the cell.
ribosomes; mRNA; cytoplasm
Which of the following is transcribed into RNA?
sequences that encode the start codon Promoters and switches are both upstream of the +1 nucleotide and are not transcribed.
Which of the following have the exact same genes but different alleles of those genes?
two different individuals of the same species the genes and alleles are the same in all somatic cells within an individual
5'-ATGTTACGATTACGTACT-3' 3'-TACAATGCTAATGCATGA-5' If the bottom strand is the template strand, the sequence on the RNA strand is identical to which of the two DNA strands (except for U vs T)?
upper strand
True or False? A mutation that affects a switch can change the amino acid sequence of a protein.
False
Which of the following is a true statement?
An individual with high fitness has more surviving offspring than individual who is less fit
A sequence of _____ nucleotides is called a ___________ which codes for ________ amino acid(s).
3; codon; 1
Which pair of cells will have the most similar DNA sequence?
A liver cell and a skin cell from the same person
Consider a gene called M that is expressed in the heart muscles and the stomach muscles of mice. Some mice inherit weak hearts and die young because the M gene is not expressed in heart muscles. Further investigation shows that the M gene is expressed in the stomach muscles of these mice. Which of the following is a possible reason for the heart condition of these mice?
A mutation in the gene that encodes the activator for the M gene heart switch In this case the M gene has two switches: one that activates transcription for M in the heart and another that activates transcription for M in the stomach. Since M is being expressed in the stomach, but not the heart, then the gene for M must be fine and the switch for M in the stomach must be working correctly. Therefore the switch for M in the heart is NOT working correctly. Why? In order to work correctly, switches must be activated with activator proteins. So switches can fail to activate because of a mutation in the switch itself OR because of a mutation the activator protein that activates the switch.
How might a single base substitution in the sequence of a gene affect the amino acid sequence of a protein encoded by the gene?
A single amino acid could change A base substitution, also known as a point mutation, can have several possible outcomes: 1. It could be a silent mutation, when the sequence still codes for the same amino acid. 2. It could be a missense mutation, when the sequence now codes for a different amino acid. 3. It could be a nonsense mutation, when the sequence now codes for stop codon and shortens the polypeptide chain.
The DNA molecules in muscle cells contain information about which of the following? A. Eye color and skin color B. Eye color, but not skin color C. Skin color, but not eye color D. Neither eye color nor skin color
A. Eye color and skin color The DNA in every cell in your body are the same
Only 1% of the bacteria in a population are resistant to the antibiotic rifampicin. Which of the following environments would cause the % of rifampicin resistant bacteria to increase over time?
An environment with rifampicin but not any other antibiotics.
The fish in which the pelvic switch mutation originally occurred had a pelvis. Which statement accurately describes why? A. the mutation occurred in a cell that gave rise to a sperm or egg B. the mutation was found in only some pelvic cells, not others C. The mutation occurred in an mRNA molecule and only affected some PitX1 protein molecules
A. the mutation occurred in a cell that gave rise to a sperm or egg
Given the DNA template strand shown in the figure above, which of the following bases would you find in the resulting mRNA strand and where would the strand be synthesized in eukaryotes?
AAAAA; nucleus mRNA is complementary to DNA, so the Ts would be transcribed as As. Transcription occurs in the nucleus.
Human insulin is a protein that is produced by specialized cells in the pancreas. These cells release insulin into the bloodstream, where it affects the function of many cell types in the body. Based on this, you would expect to find the gene for human insulin in ___.
All cells in the body
The idea of "common descent" implies that...
All closely related organisms descended from a common ancestor
In a study of red deer in one European forest, researchers found that frequency of alleles of certain genes change in the population as climate changed. They proposed that this is a result of natural selection imposed by climate change. Which of the following must be true for evolution by natural selection in such a case? Variation among individuals is heritable Reproductive success varies according to genetic make up There is genetic variation in the red deer population All of the answers here are true
All of the answers here are true
What fraction of all the genes in your liver cells are also in your kidney cells?
All of them. DNA in every body cell of a multicellular organism is the same
Which of the following populations will undergo evolution? A population of cats on a breeder's farm. The cats vary in body size, a heritable trait, and only the slimmest cats are allowed to breed. A population of fish in a lake. The fish vary in body size, a heritable trait, and fishermen catch and kill only the largest individuals (they release smaller individuals back into the lake). A population of birds in a forest. The birds vary in where they build nests, which is a heritable trait, and birds that build nests in the highest parts of trees produce the most offspring.
All of these scenarios would lead to the populations undergoing evolution.
What makes up a polypeptide?
Amino Acids
What makes up polypeptides?
Amino acids
Only 1% of bacteria in a population are resistant to the antibiotic rifampicin. Which of the following environments would cause the % of rifampicin resistant bacteria to increase over time? A. An environment without rifampicin or any other antibiotics B. An environment without rifampicin but containing other antibiotics C. An environment with rifampicin but not any other antibiotics
C. An environment with rifampicin but not any other antibiotics
Which of the following would you NOT find in your skin cells? A. Genes needed for eye color B. Eye color gene switches C. Eye color gene activators
C. Eye color gene activators
Condition 1: The population must vary in traits that are heritable Condition 2: Some heritable traits must increase reproductive success Condition 3: Individuals pass on all traits they acquire during their lifetime Condition 4: Sexual reproduction (like what occurs in many eukaryotes) Which of these conditions are always true of populations evolving due to natural selection?
Conditions 1 and 2
Condition 1: The population must vary in traits that are heritable. Condition 2: Some heritable traits must increase reproductive success. Condition 3: Individuals pass on all traits they acquire during their lifetime. Condition 4: Sexual reproduction Which of these conditions are always true of populations evolving due to natural selection?
Conditions 1 and 2
The PitX1 gene in stickleback fish is normally expressed in the pituitary, jaw, and pelvis. Assume that a fish inherits a mutation that inactivates the pelvic switch. You isolate DNA from pituitary, jaw, and pelvic tissue. In the DNA of which tissues would you expect to find the pelvic switch mutation? A. pituitary tissue B. Pelvic tissue C. jaw tissue D. all tissues
D. All tissues
Which part(s) of amino acids are involved in peptide bond formation? A. the amino group B. the side chain C. the carboxyl group D. A and C E. A, B, and C
D. Answers A and C
Your liver cells and your skin cells contain the same ___ but different ___.
DNA ; proteins
Scientists know that a single genetic mutation gives rise to blue eyes. This mutation arose around 10,000 years ago and spread throughout European populations. Which of the following would be a possible explanation for the origin of the blue eye allele?
DNA polymerase inserted an incorrect base during replication of a cell that gave rise to gametes.
Genotype is to ____ as phenotype is to ____
DNA sequence, amino acid sequence
Which of the following is required for the initiation of transcription? A. Intron B. Start codon C. 5' cap D. RNA primer E. None of the above
E. None of the above
A farmer finds that a few of the potato plants in his field are resistant to potato beetles. He uses the seeds from those plants to seed the next year's crop. The next year's crop has mostly beetle-resistant plants. Which of the following statements is true?
Evolution has occurred in the potato field. Population = Potato plants on the farmTrait = susceptibility to beetlesDid the mean trait value change in the population over time? Yes!the population of potato plants shifted from mostly susceptible to beetles, to mostly resistant to beetles. Hence evolution has occurred.
Which part of the primary transcript is ultimately translated into protein?
Exons
The DNA molecules in muscle cells contain information about which of the following?
Eye color and skin color
Which of the following are present in your liver cells? A. Switches to turn on liver cell genes B. Switches to turn on kidney cell genes C. Switch activators for liver cell genes D. Switch activators for kidney cell genes E. A and C are correct F. A, B, and C are correct G. A, B, C, and D are correct
F. A, B, and C are correct
A mutation in the protein-coding region of PitX1 that inactivated the protein product would have the same effect on fitness as the pelvic switch mutation
False
All genes are transcribed in every cell type
False
Dramatic changes in traits and phenotypes require lots of changes at the genetic level.
False
The pelvic spine is an adaptation in all sticklebacks.
False
Transcription begins at a start codon.
False
Transcription ends at a stop codon
False
Transcription stops at a stop codon.
False
+1 ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGC CACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATG CAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGT TTGATGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCG GGAGGTGGCCAcgtatcggtaGGCGGCAGGAAGGCGCACCCCCctgatcgtgatcgCCAG CAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTTGACTTCTGGAAGACCT TCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGctgctttatgcgTTTA ATTACAGACCTGAA Sequence that encodes Start Codon: Bold and italics Sequence that encodes Stop Codon: Bold Introns: Lower case letters The next two questions refer to the DNA sequence above. Assume that this is the CODING strand For the DNA sequence above, what would be the first four amino acids encoded?
Met, Ser, Gly, Pro To find the first four amino acids, first find the START codon, where translation begins. Then from the start codon, count the next three codons. (Remember, the start codon is translated and therefore the first amino acid is always Met.) Start codon and next 3 codons: ATG AGT GGA CCT In this case, you are working with sequences from the CODING strand, so the sequences can be translated directly into RNA by changing T to U. (If it was the template strand, then you would have to convert the sequences into their complementary sequences.) DNA to RNA: ATG AGT GGA CCT --> AUG AGU GGA CCU Finally, convert the codons to amino acids: 1. AUG --> Met 2. AGU --> Ser 3. GGA --> Gly 4. CCU --> Pro
The first three amino acids encoded by the gene above are: Hint: remember where translation starts.
Met-Leu-Val Translation starts at the start codon. Since you were given the template strand, the RNA will be complementary. The RNA sequence beginning at the start codon is AUG-UUG-GUG. Use the codon table to determine which amino acids are encoded. Note: If you are asked to translate something beginning at the start codon, Met should always be the first amino acid! TAC-> AUG (Met) AAC-> UUG (Leu) CAC-> GUG (Val)
Which of the following statements regarding mutation is FALSE?
Mutations that result in new phenotypes are always found in exons
In the above sequence, nucleotide +4 changes from a "A" to an "C". What change occurs to the encoded protein because of this mutation?
No change would occur to the encoded protein. Nucleotide +4 comes before the start codon, so it is not translated. Therefore no change would occur in the protein.
what is the role of the start codon in transcription?
No role! It has a role on in translation. We are talking about transcription.
Which of the following is required for the initiation of transcription? Start codon RNA primer Intron None of these
None of these To initiate transcription, a promoter is required. RNA polymerase must be activated to begin transcribing at the promoter.
A protein that is heated until all hydrogen bonds and bonds between side chains are broken will have
Normal primary structure but abnormal secondary and tertiary structure Peptide bonds won't be broken so the sequence of amino acids (the primary structure) will still be intact. Hydrogen bonds are responsible for secondary structure, so if they are broken the secondary structure will be abnormal. Bonds between side chains are responsible for tertiary structure, so if they are broken, tertiary structure will be abnormal.
Olfactory (smell) receptors are a family of over 900 proteins in the nasal passage, each slightly different, but sharing most of the same structure. Each different variation detects a different chemical structure, which combine to allow us to sense thousands of different odors. What is the most likely source of the 900 slightly different proteins?
One gene that made a single olfactory protein was miscopied in DNA replication, allowing for gene duplication, then the different copies independently mutated.
Which of the following are parts of the gene that get transcribed by RNA polymerase? Switches Promoter Activator
Promoter
Use the DNA sequence below to answer the next two questions. Assume this DNA sequence is from the TEMPLATE strand. Nucleotides 31-33 encode the start codon and are in bold and underlined. Nucleotides 451-453 encode the stop codon are underlined. The nucleotide numbers that begin the row are listed to the left of the row. The genetic code is below. -121 gccctcttcg gtcatcagcc ggaactggac gtcggcgaag gggaaacact ctatggcgcc -61 atacgctacg aggccccccg gccgatcgcg gaggtggtgc gatcgaccta taccgccaac +1 agagaatcca gagtcttgag taccgccgca tacaaccacc gagcaggagc atttgccgtc +61 gccgacgctc aggaactcgc acaccagttg caggagcatc aaaagaagat cttttctccg +121 tcggcgcaaa agacgatgcg gctcttcagc ccggcagagg cagcggcctt catcggaatc +181 ggcgaaggct atctgcgcca gatcgcctca gaaggccatg gtccgcagcc gctgtcaaac +241 tatgcgataa gaggacatca gaccgtatcc gccgggttct cgacgaaggc gctcttgtct +301 agcaagaccg gcaaatatat tccgcatcgt cgaccgggcg aaaagctgca agtcgtctcc +361 gtcatgaatt tcaaaggtgg ttcgggcaag acgacgacat ccgctcacct cgcgcagtat +421 ctcgccttgc gcggctatcg ggtgctggcg atcgatctcg atccgcaggc ctcgctctcc Nucleotides -30 to -2 are part of the ________ region of the gene
Promoter Sequences upstream of the transcription start site (+1) are not transcribed and are part of the promoter of a gene. If a sequence is not transcribed, it can't be translated.
Which of the following is a part of a DNA molecule? Choose the most complete correct answer.
Promoter, Gene, and Switch All of these are DNA sequences. Promoters are DNA sequences that act as a landing site for transcription factors and RNA polymerase. Switches are DNA sequences that can be bound by activator proteins to activate transcription. Amino acids are the subunits of proteins - they are not found in DNA
How might an evolutionary biologist explain why a species of birds has evolved a larger beak size?
Some members of the ancestral population had larger beaks than others. If larger beak size was advantageous, they would be more likely to survive and reproduce. As such, large beaked birds increased in frequency relative to small beaked birds. This describes the necessary components of evolution by natural selection: - Variation in beak size in the ancestral population (necessary for evolution by natural selection) - Larger beak size has a positive impact on fitness (natural selection) - Beak size changed in frequency from one generation to the next (evolution)
Once transcription has initiated, which of the following would occur next?
The 5' UTR is transcribed
Many different types of protein molecules are made within cells. If two cells in a single individual animal contain different proteins, then
The cells contain the same genes, promoters and gene switches but different switch activators
Many different types of protein molecules are made within cells. If two cells in an animal contain different proteins, then
The cells contain the same genes, promoters and gene switches but different switch activators The body cells of all multicellular organisms have the same DNA sequences, so the genes and the switches (both made of DNA) will be the same. Gene expression differs between cells because there are different activators in different cell types that turn on different genes.
Finch beak size is a heritable trait. Large beaks is an adaptation to large hard seeds. Small beaks is an adaptation to small soft seeds. Which of the following describes how natural selection could cause a finch population to change from mostly large beaked birds to mostly small beaked birds after a climate change event?
The food source changed from large hard seeds to small soft seeds, so finches with smaller beaks produced more offspring than finches with large beaks.
A population of dark mice live in a wooded region close to a sandy white beach. White mice are born due to mutations in a gene required for dark fur. Most of the mice are dark but some are white. If white mice mate, they produce white offspring. The climate changes, causing the forest to die off and the beach to expand. Which of the following is expected to occur to the mouse population over time after the forest dies off?
The frequency of white mice in the population will increase. Since beach habitat gives white mice a fitness advantage (that is, they can produce more offspring successfully), increasing the size of the beach and reducing the size of the forest would probably lead to an increase in the frequency of white mice in the population.
In a particular gene, the nucleotides that encode the start codon are +21 through +24. The stop codon is found at nucleotides +557-560. Nucleotide +2 is.....
Transcribed but not translated
In a particular gene, the nucleotides that encode the start codon are +21-24. The stop codon is found at nucleotides +557-560. Nucleotide +2 is ...
Transcribed but not translated
In a particular gene, the nucleotides that encode the start codon are +21-24. The stop codon is found at nucleotides +557-560. Nucleotide +561 is.....
Transcribed but not translated
Nucleotide #561 is ...
Transcribed but not translated
During _____, the enzyme ____ reads complementary nucleotides in the ___ strand to produce RNA.
Transcription, RNA polymerase, template
Which of the following is FALSE about translation in eukaryotes?
Translation ends at the very end of an mRNA
Based on the video you watched about RNA processing, the mature RNA contains sequences that will not be translated.
True
One nucleotide change in DNA can have a large phenotypic effect.
True
You have genes important for eye function in your skin cells.
True
There is a population of beetles that typically have black wings. A scientist studying these beetles knows that their eggs hatch in early spring, the baby insects grow through the late spring and summer, they lay eggs in the early fall, and die in the early winter. Recently some beetles have been born with white wings. Early in life the black and white winged beetles seem to be very similar in number of mating events, eggs laid, and survival rates, but shortly after laying their eggs the white beetles die and there are only adult black winged beetles during the late fall. Which of the following is a true statement about the beetles?
White and black winged beetles have equal fitness.
Does the protein product made from a stretch of DNA depend on which strand was used as the template for transcription?
Yes Draw a double stranded DNA molecule and transcribe it both ways. The sequence of nucleotides, and therefore the protein product, will be different depending on which strand is used as template.
Transcription ends _____________. Translation ends_____________
after the poly(A) signal; at a stop codon
The Pitx1 gene in stickleback fish is normally expressed in the pituitary, jaw, and pelvis. Assume that a fish inherits a mutation that inactivates the pelvic switch. You isolate DNA from pituitary, jaw, and pelvic tissue. In the DNA of which tissues would you expect to find the pelvic switch mutation?
all tissues
Which part(s) of amino acid can be involved in peptide bond formation?
amino group and carboxyl group
The rock pocket mouse MC1R gene controls fur color development. If a point mutation occurs in the coding sequence of the gene (one nucleotide is changed to another nucleotide), it will be a ______________. missense mutation beneficial mutation (have a positive effect on fitness) deleterious mutation (have a negative effect on fitness) silent mutation any of the above
any of the above
All proteins ____. (Choose the most complete answer.)
are synthesized on ribosomes and are made of amino acids connected by peptide bonds
Which strand in this transcription bubble is the coding strand?
bottom its the strand not being copied, which ends up having the same sequence as the RNA transcript
What type of mutation never has an effect on fitness?
silent A silent mutation has no impact on the protein that the gene codes for. For example, TCA and TCG both code for Ser. If there was a mutation in a sequence that changed TCA to TCG, then the same amino acid would still be coded for and the protein would not change.
The _______________ of a polypeptide is determined by its _____________
structure, amino acid sequence The structure of a DNA sequence is determined by its amino acid sequence. See below the hierarchy of how each part of transcription and translation affects the next: DNA sequence --> RNA sequence --> amino acid sequence --> structure --> function
For a population to evolve through natural selection:
there must be heritable variation in the population
Which strand in this transcription bubble is the coding strand?
top strand The one being read by RNA is the template, the one not being read is the coding strand.
