Bio Final
Which pre-mRNA processing step is important for initiating translation?
(7-methylguanosine) 5' cap
During [a] two net ATP are produced by [b], where as during [c] ATP and CO2 are produced. The majority of the ATP is made by [e].
- During glycolysis two net ATP are produced by substrate level phosphorylation, where as during citric acid cycle ATP and CO2 are produced. The majority of the ATP is made by oxidative phosphorylation
A noncompetitive inhibitor ...
-Binds to the enzyme on a site other that the active site -reduces enzyme activity; enzyme activity can be regained by removing the inhibitor
During strenuous exercise, glucose consumption accelerates to keep up with ATP demands of contracting skeletal muscle. When glucose supplies fall, how do your cellular respiration?
-Glycogen is hydrolyzed to glucose, which feeds into glycolysis -Stored fats undergo beta-oxidation and feed into the citric acid cycle
A competitive inhibitor ...
-Reduce enzyme activity; enzyme activity can be regained by increasing the substrate concentration - Competes with the substratefor the active site of the enzyme -has a structurethat's very similar to that of the substrate
Select the true statement regarding RNAs involved in translation:
-rRNA is a structural component of the ribosome -tRNAs facilitate translation by delivering the appropriate amino acid to the ribosome
Order of the following steps of translation:
1) Transcription of rRNA in the nucleolus 2) Assembly of ribosomal subunits and export to the cytoplasm 3) Attachment of the ribosome to the mRNA 4) Entrance of the charged tRNA into the ribosome 5) Release of the uncharged tRNA
Order the following molecules based on their relative energy value from the lowest to highest.
1. A Water 2. D Ethanol 3. B Glucose 4. C fatty acid
Order the direction of flow genetic information as described by the central dogma gene expression
1. DNA 2. RNA 3. Protein
Put the steps of the Central Dogma in order.
1. DNA 2. RNA 3. Protein 4. Function
Order the path of electrons as glucose is oxidized via cellular respiration:
1. Glucose 2. NADH 3. Electron Transport Chain 4. Oxygen
Order the following from highest to lowest energy value:
1. Glucose 2. Pyruvate 3. NADH 4. ATP
Order the path of energy as glucose is oxidized via cellular respiration:
1. Glucose 2. Pyurate 3. NADH 4. Proton Gradient 5. ATP
Order the following enzymes or proteins according to their step in DNA replication:
1. Helicase 2. Single-stranded binding protein 3. Primase 4. DNA Polymerase III 5. DNA Polymerase I 6. Ligase
Place the following 4 terms regarding biological evolution in their correct order.
1. Mutation 2. selection 3. Adaptation 4. Evolution
In this cotransport situation, the energy source moving glucose into the cell is ____. The energy source moving Na+ into the cell is ____. The energy source moving K+ into the cell is____. The energy source moving Na+ out of the cell is___
1. Na+ concentration gradient 2. Na+ concentration gradient 3.ATP 4. ATP
Put the steps for the synthesis and movement of a integral protein products to the cell membrane.
1. Synthesize the polypeptide on an endoplasmic reticulum bound ribosome. 2. Transport from ER via a transport vesicle 3. Vesicle fuses with golgi appartus... 4. transport from golgi apparatus... 5. vesicles fuses with plasma membrane. 6. integral proteins implanted in cell membrane.
Order the path of electrons as glucose is produced via photosynthesis
1. Water 2. P680 3. Electron Transport Chain 4. P700 5. NADPH 6. G3P
1. genetic material complexed with protein in eukar. cells 2. double membrane that separates nucleus from the cytoplasm 3. site of ribosomal subunit synthesis 4. passageway between nucleus and cytoplasm that allows import and export of specific factors 5. A network of intermediate filaments that maintains shape of nucleus.
1. chromatin 2. nucleus envelope 3. nucleolus 4. nuclear pore 5. nuclear lamina
Put the following in order. chromosomes condense nuclear envelope dissapates chromosomes align at equator of cell nuclear envelope reforms
1. chromosomes condense 2. nuclear envelope dissapates 3.chromosomes align at equator of cell 4. nuclear envelope reforms
1. Nucleus 2. Cell wall 3. Chloroplast 4. mitochondria 5. golgi apparatus 6. lysosome
1. contains genetic material of cell 2. strong, protective structure made of cellulose 3. makes sugar by converting light energy to chemical energy 4.converts organic compounds to cellular energy that can power the cell 5. modifies and packages proteins 6. hydrolyze macromolecules such as proteins and complex carbohydrates.
1. If a red blood cell shrivels when placed in a solution, the solution is ___ relative to the cytoplasm of the red blood cell.The solution has ___ solutes than the cell's cytoplasm. 2. If a red blood cell bursts when placed in a solution, the solution is ___relative to the cytoplasm of the red blood cell. The solution has ___ solutes than the cell's cytoplasm.
1. hypertonic, more 2. hypotonic, fewer
_____ are hollow rods that support vesicle movement _____ are fibers that give the nucleus its shape _____ are fibers that form a cleavage furrow
1. microtubules 2. intermediate filaments 3. microfilaments
1. the fibers that make up eukaryotic flagella are made of____ 2. The fibers that anchor organelles and give the nucleus its shape are made of___ 3. centrosomes are made up of___ 4. pseudopodia that give rise to amoeboid movement and stabilized by______ 5. cell junctions called desmosomes are anchored by_____ 6. muscle contraction occurs by myosin motor proteins moving along____ 7. cleavage furrow formation is supported by_____ 8. chromosome movement during anaphase occurs on_____
1. microtubules 2. intermediate filaments 3. microtubules 4. microfilaments 5. intermediate fil. 6. microfilaments 7.microfilaments 8. microtubules
Arrange to following from least inclusive to most inclusive (smallest to largest)
1. molecule 2. organelle 3. cell 4. tissue 5. organ 6. organ syst. 7. population 8. community 9. ecosystem 10. biosphere
Amino acid A is___ Amino acid B is____ Amino acid C is ____ Amino acid D is_____
1. non-polar 2. polar 3. acidic 4. basic
DNA polymers are made up of______ monomers Polysaccharides are made up of______ monomers Proteins are made up of____monomers
1. nucleotide 2. simple sugar 3. amino acid
Primary protein structure is stabilized by___ bonds Secondary protein structure is stabilized by____bonds Tertiary protein structure is stabilized by_____ bonds Quaternary structure is stabilized by_____bonds
1. peptide 2. hydrogen 3. hydrogen, covalent or ionic 4. hydrogen, covalent or ionic
For the following structures, identify whether they are found in plant/algae cells, animal cells or both: 1. Cellulose cell wall 2. Central vacuole 3. Centriole 4. Chloroplast 5. Cytoskeleton 6. Endoplasmic reticulum 7. Golgi apparatus 8. mitochondria 9. nucleus 10. Plasma membrane
1. plant/alg. 2.plant/alg 3. animal cell 4. plant/algae 5. all eukary. 6.all eukary. 7. all eukary. 8. all eukary. 9. all eukary. 10. all eukary.
A nucleoid is found in____ A lysosome is found in____ a ribosome is found in____ a mitochondria is found in____ a flagellum is found in____ a nucleolus is found in____ a plasma membrane is found in_____
1. prokar. only 2. eukary. only 3. both 4. eukar. only 5. both 6. eukary. only 7. both
Match the prefix/suffix or associated term with the associated type of molecule. 1.Ase 2.Pepti 3.Ose 4.Glyco 5. Mostly non-polar 6. Genes
1. protein 2. protein 3. carbo. 4.carbo. 5. lipids 6. nucleic acids
How do the following molecules pass through the plasma membrane? 1. Potassium ions 2. Water 3. Glycerol 4. Chloride ions 5. Urea
1. requires a channel or carrier 2. slowly by diffusion, more rapidly by a channel or carrier 3. slowly by diffusion more rapidly by a channel or carrier 4. requires a channel or carrier 5. slowly by diffusion, more rapidly by a channel or carrier.
The alpha-helix and beta-sheets are example of ____ structure When 2 complete proteins come together form a larger molecule, this is an example of _____ structure The sequence of amino acids in a protein are ___ structure The 3-D shape of a single polypeptide is ___ structure
1. secondary 2. quaternary 3.primary 4.tertiary
how do the following molecules pass through the plasma membrane? 1. Oxygen gas (a) 2. Glucose (b) 3. Sodium ions (c) 4. Sucrose (d) 5. Carbon Dioxide (e)
1. simple diffusion 2. requires channel or carrier 3. requires channel or carrier 4. requires channel or carrier 5. simple diffusion
1. synthesized lipids 2. provides shape to cells 3. digests proteins 4. manufactures ribosomes 5. produces secretory proteins 6. modifies and sort proteins 7. generates ATP
1. smooth ER 2. cytoskeleton 3. lysosome 4. nucleolus 5. rough ER 6. golgi 7. mitochondria
Arrange the following form least inclusive to most inclusive (smallest to largest)
1. tau protein 2. mitochon. 3. neuron 4. brain 5. nervous syst. 6. prairie dog 7. group of prairie dogs 8. the great plains 9. earth
1. On the outside of a cell, the concentration of sodium is ___ and the concentration of potassium is ____ 2. On the inside of a cell, the concentration of sodium is_____ and the concentration of potassium is ____
1.high, low 2. low, high
How many electrons are present in an ion with 9 protons, 11 neutrons and a charge of -1?
10
Urine, at pH6, contains________H+ as household bleach, at pH 13.
10,000,000 times as much
a solution at pH 10 contains________ than the same amount of solution at pH 8.
100 times less H+
what is the hydrogen ion (H+) concentration of a solution of pH6?
10^-6 M
Which of the following combinations of molecules illustrated could be linked to form a nucleotide?
11,12, and 13
which of the following molecules is the pentose sugar found in RNA?
12
which of the following molecule is a purine nitrogenous base?
13
If a muscle cell of a typical organism has 32 chromosomes, how many chromosomes will be in a gamete of that same organism?
16
How many ATP molecules NET Does glycolysis yield?
2
How many NADH molecules are produced by glycolysis?
2
how many fatty acids are in this structure?
2
If a DNA sample were composed of 20% guanine, what would be the percentage of cytosine?
20
In any given species, there are at least how many types aminoacyl tRNA synthetases?
20
What is the mass number of an ion with 9 protons, 11 neutrons and a charge of -1?
20
Normal human gametes have ___ chromosomes.
23
If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what would be the percentage of C?
23%
What is the predicted size of corresponding mature mRNA in base pairs (bp), excluding the 5' cap 3' poly-A tail?
295 bases
Examine the table of codons in the figure above. A possible sequence of nucleotides in the template strand of DNA that would code for the polypepti val would be
3' -AAA-GAA-TAA-CAA- 5'.
If the template strand of DNA is 5' - AGT- 3' the coressponding mRNA is
3' -UCA-5'
If the sequence of 5' - 3' strand is AATGCTAC, then the complementary sequence has the following sequence:
3'- TTACGATG-5'
Which of the following represents the complementary DNA sequence to the sequence below. 5'ATTGTCGCGT'3
3'TAACAGCGCA5'
Hershey and Chase Used ... to label protein
35 S
Hershey and Chase used ... to label protein
35 S
How many nucleotides are in 12 mRNA codons?
36
Carbon shares_____ electrons to complete its valence shell?
4
This atom can form up to____ single covalent bond(s)
4
What is sugar synthesized?
4
Where does the Calvin Cycle occur?
4
A neutral atom of boron has an atomic number of 5 and an atomic mass of 11. How many protons does boron has?
5
In a fuctioning chloroplast (in sunshine). Which space has the lowest pH?
5
In a functioning chloroplast (in sunshine), which space has the lowest pH?
5
For this mRNA: 5" GGACAUGGCAGUAUUUUUAAGGCGAU 3' Identify the start codon:
5' AUG at position 5
One strand of DNA has the following sequence: 3'GCCAGTATCAG5'
5' CGGTCATAGTC3'
Identify the stop codon:
5' UAA at position 17
Which of these would be part of the mRNA in the cytosol?
5' UTR E1 E2 E3 E4 UTR 3'
RNA is synthesized ... direction
5' to 3'
RNA is synthesized in the ... direction
5' to 3'
In which direction does DNA replication take place?
5'-->3'
Where is ATP Synthase located?
6
Carbon's atomic number is 6. This means that it has __________ electrons. After completing the first energy level, carbon has __________ valence electrons and can form __________ bonds.
6;4;4
Which equation represents photosynthesis?
6CO2 + 6H2O + sunlight ---> C6H12O6 + 6O2
A liver cell that is ... step
7; 1
Which of these are subunits of a triglyceride?
9 and 10
Identify cholesterol in this model:
A
Identify the amino group:
A
The inhibitor that is most likely to match the shape of the substrate is the inhibitor attached to the enzyme ...
A
Which of these behaves as a base?
A
Which of these functional groups may raise the pH of a solution to which is added?
A
Which of these has the most potential energy?
A
Match the description of events with the phase of mitosis during which it occurs. Spindle begins to form Chromosomes align midway between poles of cell. Nuclear envelope breaks down. Chromosomes de-condense. Sister chromatids separate. Spindle fibers attach to kinetochores. Nuclear envelope re-forms.
A B A D C A D
differences in the composition of RNA and DNA are found in_____
A and B
Which of the following best represents the tree of life?
A and C
DNA replication results in
A duplicated chromosome with two identical copies called sister chromatids
Which mutation is likely to be most harmful?
A frameshift near beginning of the gene
Which mutation is likely to be most harmful?
A frameshift near the beginning of the gene.
The genetic code is essentially the same for all organism.
A gene from an organism can theoretically be expresed
Which of the following analogies best describes the induced- fit model of enzyme- subtrate binding?
A hug between two people
Selecting the true statement(s) regarding RNA modifcation
A poly- A tail added to the 3' end of the pre-mRNA A guanine nucleotide cap is added to the 5' end of pre-mRNA Non coding sequences called introns are spliced out by spliceosomes
New DNA synthesis at a replication fork begins by the formation of ...
A short piece of RNA
Which of these contains a covalent bond?
A,B and C
The energy 'currency" used by cells is ...
ATP
The energy 'currency' used by cells is
ATP
What is the typical direct source of energy for an endergonic reaction in cells?
ATP
When 3 phosphate groups are covalently attached to adenosine, _________ is formed.
ATP
Which of the following transfer energy from the light reactions to the Calvin Cycle?
ATP NADPH
The light reactions of photosynthesis supply the Calvin Cycle with:
ATP and NADPH
Which of the following are products of the light reactions of photosynthesis that rae utilized Calvin Cycle?
ATP and NADPH
Predict the end result if a chloroplast's light-independent enzymes were blocked from functioning ...
ATP and NADPH accumulation
During the second half glycolysis, what occurs?
ATP is made
During the second half of glycolysis, what occurs?
ATP is made
What is ATP's importance in the cell?
ATP stores the potential to react with water, thereby removing a phosphate group and releasing energy for cellular processes.
Which complex is involved in ATP synthesis?
ATP synthase
Which of the following structures is not a component of a photosystem?
ATP synthase
The first codon to be translated is ... The second codon to be translated is ... The third codon to be translated is ...
AUG GCA GUA
Which of these enters the citric acid cycle?
Acetyl CoA
An enzymatic reaction proceeding at the optimum pH and optimum temperature is slowed by the presence of a competitive inhibitor? What can you do to speed the reaction up again?
Add more substrate, it will outcompete the inhibitor and increase the reaction rate.
Which of the following mutations would likely be most dangerous to a cell?
Addition of one nucleotide at beginning of a gene
Bacterial transformation is a major concern in many medical setting. Why might health care providers be concerned?
All of the above
Which of the following is/are true of epigenetic changes?
All of the above
The absorption of human-generated CO2 by the oceans_____
All of the listed response are correct.
These mRNAs are the result of:
Alternative splicing
Which of the following types of reactions would decrease the entropy (create order) within a cell?
Anabolic reactions
Given The following information, determine what % T is in frog DNA?
Approximately 29%
Living organisms increase in complexity as they grow, resulting in a decrease in the entropy of an organism. How does this relate to the second law of thermodynamics?
As a consequence of growing, organisms cause a greater increase in entropy in their environment than the decrease in entropy associated with their growth
Which of the following amino acids would you find at position X?
Asparagine
How many codons would be needed in an RNA to make a protein that has 50 amino acids?
At least 50
What would you find ATP synthase?
B
Which atomic diagram shows that electron with the highest potential energy?
B
Which of these plays a major role in energy transfer?
B
identify the phosphate group:
B
identify the saturated fat (triglycerides)
B
which of these cannot form hydrogen bonds with water?
B
Order the following from lowest energy (less heat to break apart) to highest energy (most hear to break apart):
B,A,C
select the water soluble amino acid(s)
B,C,D
An allosteric inhibitor does which of the following?
Binds to an ezyme away from the active site and changes the conformation of the active site, decreasing its affinity for the substrate.
A plant has a unique photosynthetic pigment. The leaves of this plant appearto be reddish yellow. What wavelengths of visible light are absorbed by pigment?
Blue and violet
How would anaerobic conditions (when no O2 is present) affect the rate of electron transport and ATP production during oxidative phosphorylation?
Both electron transport and ATP synthesis would stop
The inhibitor of Enzyme B is best described as
Both noncomp and allosteric
In photosynthesis, the reactions that require ATP take place in
Both the light reactions and the Calvin cycle
Given following substrate, predict which of the following would likely be ca competitive inhibitor.
C
In which region is your enzyme saturated with substrate
C
Independent assortment is occuring at step(s)____.
C
What would you find P680+?
C
Which bond is a peptide bond?
C
Which drawing above depicts the electron configuration of oxygen (16 8 O)?
C
Which of these increases the hydrogen ion concentration of a solution (acts as an acid)?
C
identify a glycolipid in this model:
C
Daughter cells are genetically different from each other at step(s)____.
C and D
Which of these ionizes (becomes charged) in water?
C and D
Which equation represents cellular respiration?
C6H12O6 + 6O2 = 6CO2 + 6H2O + ATP
The element present in all organic molecules is
Carbon
What is removed from pyvurate during conversion into an acetyl group?
Carbon Dioxide
What is removed from pyruvate during its conversion into an acetyl group?
Carbon Dixoxide
The Carbons in glucose are found in ... at the end of glucose oxidation.
Carbon dioxide
The carbons in glucose are found in ... at the end glucose oxidation.
Carbon dioxide
The cellular process of breaking down large molecules into smaller ones is defined as
Catabolism
How do telophase I and telophase II differ during meiosis in animal cells?
Cells remain diploid at the end of telophase I, but are haploid at the end of telophase II.
A mutation eliminates the exonuclease function of DNA pol III. Which prediction about the mutational load in daughter cells is most likely to be correct?
Cells with the DNA pol III mutation will have significantly more mutations than average
What process in your cells converts the chemical energy in glucose into the chemical energy in ATP?
Cellular Respiration
A noncompetitive inhibitor decreases the rate of enzymatic reaction by
Charging the shape of the enzyme active site
the concept of "descent with modification" was proposed by
Charles Darwin
Which of the following components is not used by both plants and cyanbacteria to carry out photosynthesis?
Chloroplasts
Chromosome pairs that carry different alleles of the same genes are [a]. Replicated forms of a chromosome are [b]. Crossing over occurs between [c] of homologous chromosomes. Chromosomes of different lengths and with different genes are [d].
Chromosome pairs that carry different alleles of the same genes are homologous chromosomes. Replicated forms of a chromosome are sister chromatids. Crossing over occurs between non sister chromatids of homologous chromosomes. Chromosomes of different lengths and with different genes are nonhomologous chromosomes.
The inhibitor of Enzyme A is best described as ...
Competitive
An ... inhibitor has a structure similiar to the substrate. It binds to the ... site A ... inhibitor does not have a structure similiar to the suvstrate. It binds to an ... site
Competitive... active Non competitive... Allosteric
Figure 6.4 illustrates various aspects of the free energy change (g) for the reaction A + B <---> C + D. Which of the following changes in free- energy represents the difference between the free-energy content of the reactants and free energy content of the products?
D
Where would you find the enzyme Rubisco?
D
Which of these is a reactant in the production of ATP substrate-level phosphorylation?
D
identify a glycoprotein in this model:
D
The isotope 32P preferentially lables...
DNA
A mutant bacterium produces daughter cells with many errors in their replicated DNA. The parent bacterium likely acquired a mutation in which enzyme?
DNA polymerase
During proofeading, which of the following enzymes 'reads' the DNA?
DNA polymerase
During the proofreading, which of the following enzymes 'reads' the DNA?
DNA polymerase
An RNA primer is required for DNA replication because
DNA polymerase can only add nucleotides to an existing strand of nucleotides
Which of the following is incorrect comparing prokaryotic and eukaryotic DNA replication?
DNA replication always occurs in the nucleus
Which of the following best demonstrates the unity among all organisms?
DNA structure and function.
The ends of the linear chromosomes are prevented from shortening during duplication by the action of
DNA telomerase
Which of the following observations and inferences led Charles Darwin to his theory of natural selection as a mechanism for evolution?
Darwin synthesized his theory of natural selection from all of the listed observations and inferences.
Rate of ATP synthesis ... Rate of proton pumping into intermembrane space ... rate of oxygen consumption ... size of proton gradient ... Electron transport rate ...
Decrease Stays the same Stays the same Decrease Stays the same
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains
Degrenracy
Which of the following chemical equations describes a hydrolysis reaction?
Disaccharide + H2O= monosaccharide + monosaccharide
Select the stage of meiosis described: During [a], pairs of homologous chromosomes align in the center of the cell. During [b], the nuclear envelope reforms creating four distinct haploid cells. During [c], homologous chromosomes separate to opposite poles. During [d], individual chromosomes condense and the spindle forms. During [e], homologous chromosomes pair and crossing-over occurs. During [f], sister chromatids separate to opposite poles. During [g], the nuclear envelope reforms, creating two genetically distinct, haploid daughter cells. During [h], individual chromosomes align in the center of the cell.
During metaphase I, pairs of homologous chromosomes align in the center of the cell. During telophase II, the nuclear envelope reforms creating four distinct haploid cells. During anaphase I, homologous chromosomes separate to opposite poles. During prophase II, individual chromosomes condense and the spindle forms. During prophase I, homologous chromosomes pair and crossing-over occurs. During anaphase II, sister chromatids separate to opposite poles. During telophase I, the nuclear envelope reforms, creating two genetically distinct, haploid daughter cells. During metaphase II, individual chromosomes align in the center of the cell.
Identify the polysaccharide
E
identify phospholipids in this model:
E and F
What is the most likely pathway taken by a newly synthesized protein that will be secreted by a cell?
ER ----> Golgi-----> vesicles that fuse with plasma membrane
Which of these can cause a frameshift mutation?
Either an insertion or a deletion of a based
What electrons receives electrons from NADH?
Electron Transport Chain
ATP uncouplers are H+ channels that form in the inner mitochondrial membrane. When they are present, the membrane becomes very permeable to protons (H+ions). If ATP uncoupler are present in actively respiring muscle cell, how would it affect the proton pumping driving by electron transport?
Electron transport would continue to pump protons across the inner mitochondrial membrane, but the ubncoupler would allow the protons to leak back across membrane.
The addition of a nucleotide onto a new DNA strand is ... The energy source is ...
Endergonic ... phosphate bonds
Which of the following comparisons or contrasts between endergonic and exergonic reaction is false?
Endergonic reactions take place slowly and exergonic reactions take place quickly
How do enhancers and promoters differ?
Enhancers increase the effciency of gene expression, but are not essential for transcription. Promoter recognition is essential to transcription initiation
control of gene expression in eukaryotes cells occurs at which level?
Epigenetic, transcriptional, post- transcriptional, translational, and post- translational
Chemiosmosis in chloroplasts involves ...
Establishment of proton gradient across the thykaloid membrane
Is accessible to enzyme needed for gene expression includes DNA primarily found in expressed genes is found among telomeric and centromeric DNA Is tightly coiled during interphase
Euchromatin Euchromatin Heterochromatin Heterochromatin
The following reaction: A --> B + C + heat is an ... reaction.
Exergonic
Choose the pair of terms that correctly completes this sentence: Catabolism is to anabolism as _______ is to _______.
Exergonic; Endergonic
Identify the carboxyl group
F
Which of these functional groups may lower the pH of a solution to which is added?
F
Consider this schematic of cellular respiration: which of these not a product of glycolysis?
FAD2
Which of the following transfers electrons directly to the electron transfer chain?
FADH2 NADH
A codon can specify more than one amino acid.
False
Homologous Chromosomes are identical.
False
The reaction requires a net of input of energy from its surroundings
False
An ion with 9 protons, 11 neutrons and a charge of -1 is at atom of what element?
Flourine
An addition of a nucleotide in an exon causes a ... mutation. A change in the first nucleotide of a codon causes a ... mutation A change from an amino acid codon to a stop codon is a ... mutation A change in the third nucleotides of a codon can often cause a ... mutation
Frameshift Missense nonsense silent
An additon of a nucleotide in an exon causes a ... mutation A change in first nucleotides of a codon causes a ... mutation A change from an amino acid codon to a stop codon is a ... mutation a change in the third nucleotide of a codon can cause a ...mutation
Frameshift missense nonsense silent
The next RNA nucleotide added will be:
G
Which nitrogenous bases are found in DNA and RNA?
G C A
A particular cell has half as much DNA as some other cells in a mitotically active tissue. The cell in question is most likely in
G 1
During late ___ the cell commits to undergoing cell division.
G1 phase
What's the product of Calvin Cycle that contains fixed carbon?
G3P
Sexual reproduction comes at a cost, energy and time must be spent finding a mate and doing meiosis. But, the benefit is worth it. Why is it an advantage to reproduce sexually?
Genetically unique members of the population will increase the probability of reproductive success when the environment changes.
Given the following equation for ecllular respiration. Glucose [a] and oxygen is [b] Glucose is... oxygen is
Given the following equation for cellular respiration. Glucose is oxidize and oxygen is reduced.
Explain how imatinib ( gleevec) interacts with BCR-ABL kinase to prevent chronic myeloid leukemia (CML).Be specific about how the drug interacts with the enzyme
Gleevec is an ATP- competitive inhibitor of BCR-ABL. It competes with ATP for the binding to the enzyme.
During strenuous exercise, anaerobic conditions can result if the oxygen supply cannot keep up with demands of muscle conditions remains the same as it was under aerobic conditions, how will glucose consumption be affected?
Glucose utilization would increase a lot Glycolysis produces far less ATP than aerobic respiration. Cells will need to ocnsume much more glucose contraction
Energy is stored long-term in the bonds of ...
Glucose: ATP
Energy is stored long-term in the bonds of ... and used short-term to perform work from a(n) ... molecule
Glucose; ATP
Consider this schematic of cellular respiration: What process occurs in box A?
Glycolysis
Which step cellular respiration occur in the absence of oxygen?
Glycolysis
How does a cell make ATP in the absence of O2?
Glycolysis only
Identify the polysaccharide
H
Which of following sequences correctly represent the flow of electrons during photosynthesis?
H20 --> NADPH --> Calvin Cycle
Enzymes are vulnerable to conditions that could alter their shape (denature) and hence eliminate their function. Which of the following contribute to the
Heat Excessive salt pH change
The first step in DNA replication depends on the action of ...
Helicase
Which of the following list of DNA replication enzymes in first involved during the formation of the replication fork?
Helicase
[a] seperates the DNA double helix and [b] connects the Okashaki fragments
Helicase ... Ligase
Kingdom Animalia
Heterotrophic by ingestion and multicell.
The control of which enzyme exerts the most control on glycolysis?
Hexokinase
At step 2, the DNA is labeled "open". What chromatin modification is associated with open DNA?
Histone Acetylation
Select the true statement regarding chromatin regulation.
Histone acetylation is reversible Methylated histones are associated with condensed chromatin Highly condensed DNA is not transcribed
In chromatin, what's the DNA wrapped around ?
Histones
Select the true statement(s) regarding tRNA:
Hydrogen bonds that form between bases result in a 3D shape. It hydrogen bonds with codons in the mRNA it contains exons it carries amino acid to the ribosome
What are the four most abundant elements found in living systems?
Hydrogen, oxygen, nitrogen, and carbon
Which of these viruses has protein produced on host cell ribosome?
I, II, III
in the figure above, which numbered segment(s) of the cycle would contain cells at metaphase of mitosis?
III only
Which of the following best describes the logic of scientific theory?
If my hypothesis is correct, I can expect certain test results.
The effects of high levels of ADP is to ... in cellular respiration.
Increase the activity of specific enzymes.
In a situation where the enzyme is operating at optimum temperature and pH, and has been saturated with substrate. What is your best option for
Increase the amount of enzyme
During __ the cell grows, replicates its chromosomes and replicates its organelles.
Interphase
During eukaryotic RNA processing, the non-translated sequences that are removed are called?
Introns
What is the purpose of alternative RNA splicing?
It can allow the production of different protein products from a single mRNA
What is Rubisco's role in photosynthesis?
It catalyzes a reaction in the Calvin cycle.
What is the role of the nuclear envelop in regulating gene expression?
It controls passage of mRNA from the nucleus to the cytoplasm
What's the role of the nuclear envelope in regulating gene expression?
It controls passage of mRNA from the nucleus to the nucleus to the cytoplasm
Select the true statement regarding rRNA:
It is a structural component of ribosomes It is involved in protein synthesis it is symthesized in the nucleolus
Zinc, is an essential trace element, may be found bound to the active site of some enzymes. What best explains of zinc.
It is co-factor that helps the substrate bind efficiently
No energy transformation is 100% efficient. When you burn fuel in your car, you only harness about 25% of the energy of the fuel to power your car. What
It is released as heat
How can a point mutation in DNA change the function of a protein ?
It might substitute a different amino acid in the protein, which could change its function
What is the function of splicing?
It's action results in the conversion of pre-mRNA to mRNA
When Hershey and Chase examined infected bacterial cells, they found ... demonstrating that .. is the transforming material.
Labeled DNA; DNA
When Hershey and Chase examined infected bacterial cells, they found ... demonstrating that ... is the transforming material.
Labeled DNA; DNA
Which of the following fermentation methods can occur in animal skeletal muscles?
Lactic acid fermentation
During DNA replication, short segments of newly synthesized DNA are joined together by ...
Ligase
What is the role of light in the light reactions?
Light supplies the energy to transfer electrons from water to NADP+
How do meiosis and fertilization affect ploidy?
Meiosis decreases ploidy from 2n to n; fertilization increases ploidy from n to 2n.
Upon translation, the first amino acid will be ... The second amino acid will be ... THe third amino acid will be ...
Met Ala Val
Where do plants cells do cellular respiration?
Mitochondria
During glycolysis, which molecule is reduced when glucose is oxidized?
NAD+
Which of the following are products of the Calvin Cycle that are used in the light reaction?
NADP+ ADP
What compound provides the reducing power for the Calvin cycle reactions?
NADPH
which of the following molecules is a weak base?
NH2
The reaction ADP + P --> ATP is an .... reaction
Non spontaneous Anabolic Endergonic
Folic acid is the substrate for dihydrofolate reductase, an enzyme involved in making nucleotides. When methotrexate is added to this enzyme reaction, nucleotide synthesis decreases. The addition of more folic acid did not help increase nucleotide production when methotrexate is present. What do you conclude methotretaxte is?
Non- comp inhibitor
Which of the following is not an example of an energy transformation?
None of the above
Which of the following types of mutations results in truncated (shortened) protein?
Nonsense mutation
What type of molecule is ATP?
Nucleic Acid
The site of DNA replication is ... The site of transcription is ... The site of RNA splicing is ... The site translation ...
Nucleus Nucleus Nucleus Cytoplasm
A repressible operon is typically ... and regulates ... processes. An inducible operon is typically ... and regulates ... processes.
On ... Anabolic Off ... Catabolic
In box c, ATP is produced by ...
Oxidative phosphorylation
Occurs during cellular respiration Occurs in the inner mitochondrial membrane Energy source is electrons from glucose Final electron acceptor is oxygen Occurs during photosynthesis Occurs inside the thykaloid membranes of the chloroplast Uses sunlight as the energy source Final Electron acceptor is NADP+ Transfer electrons through an electron transport chain Electrons provide energy to pump protons to one side of the membrane
Oxidative phosphorylation Oxidative phosphorylation Oxidative phosphorylation Oxidative phosphorylation Photophosphorylation Photophosphorylation Photophosphorylation Photophosphorylation Oxidative phosphorylation and Photophosphorylation Oxidative phosphorylation and Photophosphorylation
When a compound donates (loses) electrons it becomes ... When a compound accepts (gains) electrons It becomes ... ... is the compound that functions as an electron acceptor in glycolysis The reduced form of the electron acceptor in glycolysis is ...
Oxidized Reduced NAD+ NADH
What is input D that is essential for steps in box C?
Oxygen
Which of the following a produced by chloroplasts?
Oxygen Sugar
Given the equation below, what is the final electron acceptor?
Oxygen Gas
DNA and RNA nucleotides are very similar in structure. Which com
Pentose Sugar
DNA and RNA nucleotides are very similar in structure. Which component is always different when comparing an RNA with a DNA nucleotide?
Pentose Sugar
The most common from of post-translational modfication involves the activation of a protein by ...
Phosphorylation
ATP production resulting from the capture of light energy by chlorophyll is called ...
Photophosphorylation
Phosphorylation is very common type
Post- translation regulation
How is Cdk activity regulated?
Post-translational association with cyclin
When cyclin/cyclin-dependant kinase (MPF) promotes entry into mitosis, it does so by phosphorylating target proteins involved in DNA condensation, nuclear envelope breakdown and spindle assembly. Phosphorylation is very common type of ___.
Post-translational regulation
Chemical bond energy is a form of ... energy
Potential
An enzyme-catalyzed reaction is conducted in a test tube with fixed amount of enzyme. Increasing the enzyme concentration may overcome the effects of which of the following conditions?
Presence of a fixed amount of a comp inhibitor
What is the primary function of the Cavin Cycle?
Produce simple sugars from carbon Dioxide
How are photosynthesis and cellular respiration related?
Products of photosynthesis drive cellular respiration products of cellular respiration drive photosynthesis
ATP uncouplers are H+ channels that form in the inner mitochondrial membrane. When they are present, the membrane becomes very permeable to... gradient?
Protons would diffuse back through the channel down their electrochemical gradient and the proton gradient would dissipate.
In fermentation [a] is reduced and [b] is oxidized.
Pyruvate ... NADH
Regarding the carbon-based (C) compounds involved in acetyl CoA formation,
Pyruvate is 3-C molecule, while acetyl CoA is 2-C molecule. One molecule of CO2 is released during Acetyl CoA formation
Which of these binds to a promoter and transcribes a gene?
RNA polymerase
Which of the following does the enzyme primase synthesize?
RNA primers
In the Hershey Chase experiment showing that the genetic material... isotopes?
Radioactive 35S was used to label phage protein and radioactive 32P was used to label phage DNA
The experiments by Hershey and Chase helped confirm that DNA was the hereditary material on the basis of finding that:
Radioactive phosphorus was found in the cell
In this reaction, NAD+ is ... to NADH and isocitrate is ... to alpha-ketgluterate
Reduced... oxidized
In the regulation of gene expression, which form of regulation take the longest to take place and it is the most long-lasting?
Regulation of gene expression in Eukaryotes takes the longest to take
Which process is most directly driven by light energy?
Removal of electrons from Chlorophyll molecules
Dehydrogenases and kinases are two important kinds of enzymes. Each of them function in cellular respiration. Dehydrogenases ... and kinases ...
Remove hydrogens ... transfer phosphate groups
DNA replication is best described by which of the following?
Semi Conservative
DNA replication is best described by which of these following?
Semi- convervative
What is a likely evolutionary advantage of sexual reproduction over asexual reproduction?
Sexual reproduction results in genetic variation in the offspring.
Select the true statement (s) regarding RNA splicing:
Some exons of the primary transcript may be removed All introns of the primary transcript are removed
When oxygen is released as a result of photosynthesis, it is a direct by-product of
Splitting water molecules
In which compartments of the plant cell do the light-independent reactions photosynthesis take place?
Stroma
Which of the following molecules is likely to have the most potential energy?
Sucrose
In photosynthesis, the reactions that require ATP take place in:
The Calvin Cycle alone
Which of the following statements is most likely to be true in the case of the feedback-regulated enzymatic pathway shown?
The Final product inhibits Enzyme 1
Many mammals control their body temperature by sweating. Which property of water is most directly responsible for the ability of sweat to lower body temperature?
The absorption of heat by the breaking of hydrogen bonds
which statement is true of all atoms that are anions?
The atoms has more electrons than protons
In autotrophs, the rate of cellular respiration cannot exceed photosynthesis. Why not?
The cells will run out of organic fuel
How does the sodium-potassium pump effects the concentrations of sodium (Na+) and potassium (K+) across the plasma membrane?
The concentration of Na+ is greater outside the cell and the concentration of k+ is greater inside the cell.
A change in temperature affects ... A change in concentration of the reactants affects ... The introduction of an enzyme ensures...
The energy with which the molecules collide The rate of molecular collision The correct orientation of molecule during collision
The following image represents [a] which occurs during [b] and is one of the ways Meiosis creates genetic [c].
The following image represents Crossing Over which occurs during Prophase I and is one of the ways Meiosis creates genetic diversity.
How is the information encoded DNA actually used by organisms?
The information in DNA is transcribed to RNA and then translated into protein.
Which of the following statements best represents the relationships between the light reactions and the Calvin cycle?
The light reactions provide ATP and NADPH to the Calvin Cycle, and the Calvin Cycle returns ADP, and NADP+ to the light reactions.
You are studying the regulation of a prokaryotic operon. Experimental results suggest that the operon is inducible.
The operon is usually off and is involved in a catabolic process
the sodium-potassium pump actively transports three sodium ions (Na+) out of the cell and two potassium ions (K+) into the cell. How does this affect the distribution of charge across the plasma membrane?
The outside of the cell is more positive than the inside because more positive ions are pumped out of the cell than are pumped in.
The pH of the inner thylakoid space has been measured, as have the pH of stroma and of the cytosol of particle relationship would you expect to find?
The pH of the stroma is higher than that of either the thykaloid space or cytosol
In this reaction ...
The products have more potential energy than the ractants
What determine a virus's host range?
The proteins on its surface and that of the host
Look at the graph of reaction rate versus substrate concentration for an enzyme. (Figure 1) If line A represents the reaction without an inhibitor, line B represents...
The reaction is the presence of a competitive inhibitor
Which interpretation is correct?
The red and violet-blue wavelength are much more effective than other wavelengths at driving photosynthesis
There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by the fact that
The rules for base pairing
What is the difference (if any) between the structure of ATP and the structure of the A nucleotides triphosphate used to make DNA?
The sugar molecule is different
Which of these correctly orders the events of a viral replication cycle?
The virus enters the cell, hos enzymes replicate the viral genome, enzymes trasncribe the viral genome into mRNA.
Comparing atoms with the same atomic number but different atomic masses:
These atoms are isotopes
How are the NADPH and G3P molecules made during photosynthesis similar?
They both store energy in chemical bonds
What do the electrons added to NAD+ do?
They go to another pathway for ATP production.
What do the electrons added to the NAD+ do?
They go to another pathway for ATP production.
which of the following is true of unsaturated fats?
They have double bonds in their fatty acid chains
Which of the following is not true about enzymes
They increase ∆G of reactions
Carotenoids in vegetables are considered to have antioxidant properties in human nutrition. What related function do they have in plants?
They protect against oxidative damage from excess light energy
DNA replication involves unwinding two strands of parent DNA, copying each strand to synthesize complementary strands, and releasing the parent and daughter DNA. Which of the following accurately describes this process?
This is an anabolic process
How many NADH molecules are produced on each turn of the citric acid cycle?
Three
Which statement abut thykaloid in eukaryotes is not correct?
Thykaloids contain a chlorophyll solution
G3Ps are the final product of the Calvin Cycle. What can the G3P's used for?
To make Lipids To make Glucose To make proteins To make nucleic acids
What is the purpose fermentation?
To reset the cell so more glycolysis can occur
Prokaryotic cells lack a nucleus. Therefore, the genes in prokaryotic cells are:
Transcribed and translated almost simultaneously
Select the true statement regarding transcriptional factors:
Transcription factors bind at specific DNA Some transcription factors must bind at specific DNA sequences
In the thykaloid membrane, what's the main role of the pigment molecules other than P680 and P700?
Transfer light energy to the reaction- center chlorophyll
When RNA is used as a template for the synthesis of protein, this is called ...
Translation
mRNA .... snRNA ... tRNA ... rRNA ... RNA primers ...
Translation Splicing translation Translation DNA syntheis
A mutation makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation?
Translation stalls a fter the initiation AUG codon is identified
A mutation makes the 60S ribosomal subnit nonfunctional in a human cell line. What wouldbe the predicted effect on translation?
Translation stalls after the initiation AUG codon is identified
During cellular respiration, the reactions that generate the larges amount of ATP take place in the mitochondria
True
During cellular respiration, the reactions that generate the largest amount ATP take place in mitochondria.
True
The reaction occur spontaneously
True
Which of the following statements correctly describes vaccines and how they help prevent viral infection?
Vaccines are inactive version of a virsu that stimulate an immune reaction in a person.
Which wavelength of light is most effective at driving photosynthesis?
Violet-blue wavelengths due to their short wavelength and high energy
Select the by-products of cellular respiraton
Water Heat Carbon Dioxide
In photosynthesis, the light reactions use ... and produce ...
Water; NADPH
If electron transport stops because there is no O2 to serve as the final electron acceptor, ATP synthesis associated with oxidative phosphorylation also
Without electron transport from NADH and FADH2 to O2, the pumping of protons across the inner mitochondrial membrane
Is the NADH produced in glycolysis used in any other reactions of cellular respiration where ATP is produced?
Yes, NADH is an input to oxidative phosphorylation, where more ATP is produced.
a substance that reduces the hydrogen ion concentration of a solution is________
a base
the carbon atoms is tetravalent; this means that_______
a carbon atom can complete its valence shell by forming four covalent bonds
if a treatment were available that would disrupt nuclear lamina in living cells, what would you expect to be the most likely immediate consequence for the cell?
a change in the shape of the nucleus
an acid is_________
a compound that donates hydrogen ions to a solution.
When one or more pairs of valence electrons are shared by two neutral atoms, what type of bond is formed?
a covalent bonds
Variable
a distinct parameter of importance in an experiment
which of the following factors would tend to increase membrane fluidity?
a greater proportion of unsaturated phospholipids
Water molecules have ____ than molecules of similar size, such as ammonia and methane, reflecting its....
a higher boiling point
the functional group labeled C is
a keton
response (dependent) variable
a measurable parameter which changes in response to the experimental variable.
A cell has the following molecules and structures: enzymes, DNA, ribosomes, plasma membrane, and mitochondria. It could be a cell from
a plant cell but not an animal cell
Through a microscope, you can see a cell plate beginning to develop across the middle of a cell and nuclei forming on either side of the cell plate. This cell is most likely
a plant cell in the process of cytokinesis.
to give this amino acid a negative energy
a side group with a carboxyl group
to give this amino acid a polar charge
a side group with a sulfhydryl group
to give this amino acid a positive charge
a side group with amine group
to give this amino acid a neutral charge
a side group with methyl group
glycogen is___
a storage polysaccharide found in animals
How did this molecule form? (Hydronium ion H3o+)
a water molecule gained an hydrogen ion from another water molecule.
Choose the pair of terms that completes this sentence about functional groups in organic chemistry: Carboxyl is to __________ as __________ is to base.
acid; amino
One of the buffers that contribute to pH stability in human blood is carbonic acid (H2CO3). Carbonic acid is a weak acid that dissociates into a bicarbonate ion (HCO3-) and a hydrogen ion (H+). Thus, H2CO3 ↔ HCO3- + H+ If the pH of the blood increased, one would expect the buffer to:
act as an acid and increase the concentration of HCO3- and H+.
a food company wishes to convert corn oil into a spread that is solid at room temperature. One way to accomplish this goal would be____
add hydrogens, decreasing the number of double bonds in the oil molecules.
If an enzyme in solution is saturated with substrate, the most effective way to obtain a faster yield of products is to
add more of the enzyme
Which of the following mutations would likely be most dangerous to a cell?
addition of one nucleotides at beginning of a gene/
A reducing chemical reaction ...
adds an electron to the substrate
A reducing chemical reaction
adds electron to the substrate
which of these is a part of ATP?
adenosine
In this cotransport situation, glucose is moving____ its concentration gradient. Na+ is moving into the cell___ its concentration gradient. Na+ is moving out of the cell____ its concentration gradient. K+ is moving ____ its concentration gradient.
against, with, against, against
Although the structures of the functional groups that are most important to life vary, they share one thing in common: They __________.
all help give each biological molecules its unique properties.
two chromosomes are homologous, they
all of the above
A gamete __.
always receives only one of the parent's alleles for each gene.
identify this molecule
amino acid
A compound that donates hydrogen ions to a solution is __________.
an acid
An ionic bond involves _____.
an attraction between ions of opposite charge
controlled variable
an experimental parameter which is kept fixed for all subjects in an experiment.
Centromeres divide and sister chromatids become distinct chromosomes during _____.
anaphase
At which stage of meiosis are sister chromatids separated from each other?
anaphase II
Thinking about the environments where plant and animal cells typically exist, which of the following statements is correct?
animal cells are generally in an isotonic solution, and plant cells are generally in a hypotonic solution.
hydrophilic molecules
are charged molecules that are attracted to the partial charge of the water molecule
Atoms with the same number of protons but with different electrical charges _____.
are different ions
Thalidomide and L-dopa are drugs that occur as enantiomers, these molecules_______
are mirror images of one another
hydrophobic molecules_______
are uncharged, nonionic substances that seem to repel water.
Isotopes of an element will always differ in_______
atomic mass
Fill in the blanks on the following statement about water's properties. Water molecules are polar, therefore they are _____ to each other and form ___.
attracted, hydrogen bonds
cyanobacteria
autotro., unicell., cell wall of peptidoglycan.
Kingdom Plantae
autotrophic, cell wall of cellulose, and multi.
protist
autotrophic, heterotro., unicell., multicel.
The 3 domains of life are
bacteria, archae, and eukarya
The ability of water molecules to form hydrogen bonds with other water molecules and water's ability to dissolve substances that have charges or partial charges are __________.
both caused by water's partial charges
Beta- oxidation is ...
breakdown of fatty acids
which of the following categories includes all others in the list?
carbohydrate
amino acids are acids because they always have a(n)_____ functional group?
carboxyl
which series of terms is in the correct sequence of biological organization, from the simplest to the most complex?
cell, tissue, organ, population, community
In the cells of some organisms, mitosis occurs without cytokinesis. This will result inf
cells with more than one nucleus
the term insoluble fiber o food packaging generally refers to which of the following carbohydrates?
cellulose
in what way do the membranes of a eukaryotic cell vary?
certain proteins are unique to each kind of membrane.
At metaphase I, homologous chromosomes are connected only at what structures?
chiasmata
which structure is not part of the endomembrane system?
chloroplast
Which structures are found in algae cell but not animal cells?
chloroplast cell wall central vacuole
In green algae cell, proteins may be synthesized in the following place(s):
chloroplast rough er mitochondria cytoplasm
these molecules are best described as ______
cis, trans isomers
When a double bond joins two carbon atoms, __________ can form.
cis-trans isomers
What process occurs in box B?
citric acid cycle
The drug cytochalasin B blocks the function of actin. Which of the following aspects of the cell cycle would be most disrupted by cytochalasin B?
cleavage furrow formation and cytokinesis
Water moves up a plant because of hydrogen bonds by a process called __________.
cohesion and adhesion
if the pH of a solution is decreased from pH8 to pH 6, it means that the
concentration of H+ is 100 times greater than it was at pH8
The benefit of gense organized into an operon is that the operon allows for
coordinated regulation of a group of genese that encode proteins involved in a common cellularpathway
A carbon atom is most likely to from what kind of bond(s) with other atoms?
covalent
Select all of the following that apply to how genetic variation is generated during meiosis and sexual reproduction.
crossing over between homologous chromosome random fertilization independent assortment
In prokaryotic cell, glycolysis occurs in the ...; in a eukaryotic cell, glycolysis occurs in the ...
cytoplasm, cytoplasm
Motor proteins provide for molecular transport of materials in cells by interacting with what type(s) of cellular structure?
cytoskeletal structures
Based on the figure below, which of these experimental treatments would increase the rate of sucrose transport into a plant cell?
decreasing extracellular pH
which of the following best summarizes the relationship between dehydration reactions and hydrolysis reactions?
dehydration reactions assemble polymers, and hydrolysis reactions break down polymers
when two amino acid monomers are positioned so that the carboxyl group of one is next to the amino group of the other, they can be joined through a _____ reaction. This reaction forms a_____ bond
dehydration synthesis; peptide
With evolution as the core theme of biology, we can explain traits shared by organisms as evidence of __________ and traits that differ among organisms as evidence of __________.
descent from common ancestor; adaptation through natural selection.
The molar mass of glucose (C6H12O6) is 180 g/mol. Which of the following procedures should you carry out to make a 0.5 M solution of Glucose?
dissolve 90 g of glucose in a small amount of water, then add more water until the total volume is 1L.
What type of bond joins these 2 oxygen atoms?
double covalent
At the end S phase ...
each DNA double Helix consists of one old and one new DNA strand
the tendency of an atom to pull electrons toward itself is_____
electronegativity
These molecules are best described as_____
enantiomers
The evolution of eukaryotic cells most likely involved
endosymbiosis of an oxygen-using bacterium in a larger host cell- the endosymbiont evolved into mitochondria.
which of the following is required for the sodium-potassium pump to transport potassium ions into an animal cell?
energy from ATP
non-polar covalent bonds are always formed from atoms that are_______
equal in their electronegativity
one glycerol and three fatty acids are joined together by a(n)____ linkage to form a macromolecule
ester
to join together a fatty acid and glycerol a ______ is formed
ester bond
Negative control
experimental subject(s) which are not tested with the experimental variable. Shows what no effect ....
Positive Control
experimental subject(s) which are tested with the experimental variable. Shows what an effect looks like.
The rate of diffusion of glucose through artificial phospholipid bilayers is exceptionally low. By contrast, the cells lining the small intestine rapidly transport large quantities of glucose from glucose-rich food into their glucose-poor cytoplasm. Based on this information, which transport mechanism is most likely responsible for glucose transport in the intestinal cells?
facilitated diffusion
Weak chemical bonds such as hydrogen bonds __________.
form when a hydrogen atom that is covalently bonded to an electronegative atom like oxygen or nitrogen is attracted......
A nonlinear, realistic model of the scientific process is called the process of science. The core activity of this process is ______
forming and testing hypotheses
Meiosis usually produces ________ daughter cells.
four haploid
in water, each molecule is connected to____ other water molecules by___ bonds
four; hydrogen
Plasmodesmata in plant cells are most similar in function to which of the following structures in animal cells?
gap junctions
The process that directs the manufacture of a cell product from a gene is called
gene expression
to join together 2 carbohydrates a _______ is formed
glycosidic bond
How does cytokinesis occur in plant cells?
golgi-derived vesicles move on microtubules to the middle of the cell to form the cell plate.
a carbon has 6 electrons but its valence is 4 because________
has only 2 electrons in its first shell and 4 in the second shell.
In this reaction _____.
heat has been released to the environment
Sweating has a cooling effect because of water's high __________.
heat of vaporization
Kingdom fungi
heterotrophic, cell wall of chitin, multicel.
More polar
high specific heat
Requires more heat to change the temperature of the substance
high specific heat
more resistance to temperature change
high specific heat
slow to vaporize
high specific heat
How are Meiosis I and Meiosis II different?
homologous chromosomes separate in meiosis I; sister chromatids separate in meiosis II
The two DNA strands of a double helix are held together by_____
hydrogen bonds
When ice forms, the __________ are farther apart than in liquid water, allowing the ice to form an organized crystal structure and float.
hydrogen bonds
when the bond connecting a disaccharide is broken, this is done via a____ reaction. This reaction breaks a _______
hydrolysis; glycosidic linkage
Nonpolar molecules that cluster away from water molecules are called __________ molecules.
hydrophobic
which of the following are properties of hydrocarbons?
hydrophobic, non-polar, and a good source of stored energy.
Which of the following statements best distinguishes hypotheses from theories in science?
hypotheses usually are relatively narrow in scope; theories have broad explanatory power.
Consider a pendulum swinging. Which type(s) of energy is/are associated with the pendulum in the following instances: i. the moment at which it completes one cycle, just before it begins to fall back towards the other end, ii. the moment that it is in the middle between the two ends, iii. just before it reaches the end of one cycle (just before instant i.).
i. potential, ii. kinetic, iii. potential and kinetic
If plant cells are grown on media containing radioactively labeled thymine for one generation, where will radioactively labeled macromolecules accumulate?
in the nucleus, mitochondria, and chloroplasts
where would you find Y prior to its insertion in the plasma membrane?
integral (within) the endoplasmic reticulum membrane
Regions of non- coding RNA that are removed by splicing are called ... RNA splicing is carried out by molecular complexes called ... When non-coding RNA sequence are removed, this process is called .. In the final mRNA, ... are joined togther without intervening sequence
introns splicesomes splicing Exons
When the proton number and electron number are unequal, the atom or molecule __________.
is an ion
The molecular shape of a biological molecule is important because_____
it determines how biological molecules recognize and respond to one another.
When the pH of a solution shifts from 3 to 7, the hydrogen ion concentration has changed, and __________.
it has decreased by 10,000 times
which of the following statements about diffusion is correct?
it is a passive process in which molecules move from a region of higher concentration to a region of lower concentration.
The fact that oxygen is an atom that is strongly electronegative means that __________.
it more strongly pulls shared electrons toward itself when forming a covalent bond with a less electronegativity atom
which of the following statements regarding chemical reaction illustrated in Figure 3.11 is true?
it results in a peptide bond
Fermentation in animal cells produces ...
lactase and NAD+
Fermentation in animal cells produces ...
lactate and NAD+
You've been experiencing acid indigestion lately, and you'd like a quick fix for the problem. You do a little research on the Internet and discover that your problem is caused by excess stomach acid. In the pharmacy aisles, however, you're having a little trouble deciding what to purchase to address the problem. At the pharmacy counter, the clerk recommends that you purchase PEPCID AC or Alka-Seltzer tablets. If you could check the pH of the recommended tablets, you would expect it to be
less hydrogen ions
the sodium-potassium pump generates the following concentration gradients across the plasma membrane.
low (Na+) and high (K+) inside the cell and high (Na+) and low (K+) outside.
least likely to exhibit hydrogen bonding
low specific heat
less polar
low specific heat
less resistant to temperature change
low specific heat
vaporizes readily
low specific heat
Adding a base tends to _____ of a solution.
lower the hydrogen ion concentration and increase the pH
which of the following are involved in translation?
mRNA
Select the true statement regarding mRNA:
mRNA carries genetic information from the nucleus to the cytoplasm mRNA is the template for protein synthesis mRNA is the product of RNA processing
What is the purpose of cellular respiration?
make ATP
In the pharmaceutical industry, 2 enantiomers of a drug
may not be equally effective.
In humans, gametes are produced by ___.
meiosis
The part of meiosis that is similar to mitosis is ________.
meiosis II
To accumulate more K+ than the water around it, an algae cell uses:
membrane proteins ATP active transport
which structure-function pair is mismatched?
microtubule; muscle contraction
which of the following is a correct match between a cytoskeletal element and its function?
microtubules and chromosome movement
movement of vesicles within the cell depends on what cellular structures?
microtubules and motor proteins
Enantiomers are______.
mirror-image isomers of a molecule
Cyanide binds to at least one molecule involved in producing ATP. If a cell is exposed to cyanide, most of the cyanide will be found within the
mitochondria
Which plant cell organelle contains its own DNA and ribosomes?
mitochondrion
Which structure is common to plant and animal cells?
mitochondrion
Which of the following chemical equations describes a dehydration reaction?
monosaccharide + monosaccharide = disaccharide + H2O
which of the following statements about the cytoskeleton is correct?
movement of cilia and flagella is the result of motor proteins causing microtubules to move relative to each other.
which of the following membrane activities requires energy from ATP hydrolysis?
movement of sodium ions from a lower concentration in a mammalian cell to higher concentration in the extracellular fluid.
Sources of genetic variation in the cells shown below include:
mutation independent assortment crossing over
what function(s) does the phosphate group contribute to this molecule?
negative charge to interact with water
All of the following are hydrogen bonding properties except_____
nonpolar covalent bonding
With regard to the cell cycle check points, how do normal cells differ from cancer cells?
normal cells adhere strictly to cell cycle check points, cancer cells do not.
which of the following organelles are enclosed by a double membrane?
nuclei and chloroplasts
The molecules below make up a _____
nucleic acid
The RNA components of eukaryotic ribosomes are synthesized in the ...
nucleolus
The chemical characteristics or reactivity of an element depend mostly on the __________.
number of electrons in its outermost shell.
the location of the saturated fatty acid in this molecule is_____
on the bottom left
The location of the unsaturated fatty acid in this molecule is____
on the bottom right
In receptor-mediated endocytosis, where are the receptors that bind specific molecules located immediately following endocytosis?
on the interior surface of a cytoplasmic vesicle.
during prophase a chromosome consists of______
one centromere and 2 chromatids
a covalent bond is likely to be polar if_______
one of the atoms sharing electrons is much more electronegativity
In an animal cell, DNA may be found in which of the following organelles?
only in the nucleus and mitochondria
Inorganic carbon such as CO2 differs from organic carbon because __________.
organic carbon always has a hydrogen atom covalently attached to it.
hydrogen bonds occur when______
partial opposite charges on molecules come close enough to attract each other.
which of the following processes includes all the others?
passive transport
In this cotransport situation, Na+ moves into the cell by ______, Na+ moves out of the cell by______
passive transport, active transport
to join together with amino acids a ____ is formed
peptide bond
Which cell would be best for studying lysosomes?
phagocytic white blood cell
What are three parts of a DNA nucleotide?
phosphate group, deoxyribose, nitrogen base
to join together with 2 nucleic acids a _____ is formed
phosphodiester bond
What type of macromolecule is this?
phospholipid
Which molecule is most soluble in water?
phospholipid
the difference between pinocytosis and receptor-mediated endocytosis is that_______
pinocytosis is nonselective in the molecules it brings into the cell, whereas receptor-mediated endocytosis is highly selective.
the selective barrier that controls passage of materials into and out of a cell is called______
plasma membrane
What type of bond is found between the oxygen and hydrogens within a water molecule?
polar covalent
the structural level of a protein least affected by a disruption in hydrogen bonding is the.
primary level
A cell with an abundance of free ribosomes is most likely carrying out which of the following processes?
producing primarily cytoplasmic proteins
Transcription of a gene begins at a site on the DNA called [a] and translation of an mRNA begins at a site called [b]
promoter ... start codon
Chromosomes become visible during _____.
prophase
Spindle fibers attach to kinetochore proteins at the centromere during __.
prophase
a macromolecule with a distinct carboxyl and amino terminus is a(n):
protein
Among the products of glycolysis, which compounds contain energy that can be used by other biological reactions?
pyuvate, ATP, and NADH
You want to use a radioactive tracer that will label only the protein in an RNA virus. The virus is composed of a protein coat and RNA core (nothing else). Which would you use to label just the protein
radioactive sulfur
Post-translational control refers to:
regulation of gene expression after translation
If you wish to join three monomers together to make a short polymer of three units you will need to
remove 2 water molecule via dehydration synthesis reactions
Which of the following does not occur during mitosis?
replication of the DNA
Building protein [a] energy; ATP hydrolysis [b] energy
require... release
which of the following is present in prokaryotic cell?
ribosome
where does protein synthesis occur in bacteria?
ribosomes
Which structure is the site of the synthesis of proteins destined for export from the cell?
rough er
extracellular matrix proteins are produced by ribosomes in which part of eukaryotic cell?
rough er
a protein like collagen that is part of the extracellular matrix is moved through the cell via which pathway?
rougher ER ---> Golgi---> plasma membrane
The level of protein structure shown at point Y is best described as_____
secondary structure
Vinblastine, a drug that inhibits microtubule polymerization, is used to treat some forms of cancer. Cancer cells given vinblastine would be unable to carry out which of the following processes?
separate chromosomes during cell division
The sugars associated with glycoproteins and glycolipids of animal cell membranes.
serves as marker that distinguished one cell from another.
A compound with several hydroxyl groups_______
should dissolve in water
Submerging a red blood cell in a hypertonic solution will result in
shriveling of the cell
When are sister chromatids present?
sister chromatids form during S phase and are present until anaphase.
what organelle or structure is primarily involved in the synthesis of oils, phospholipids, and steroids?
smooth er
What is the structure shown in Figure 3.10?
steroid molecule
Glucose has a molecular mass of 180 daltons. To make a 2-molar (2 M) solution of glucose, __________.
stir 360 g of glucose in water to dissolve the sugar, and then add enough water to bring the total volume of the solution up to 1L.
glucose and fructose are_____
structural isomers
these molecules are best described as____.
structural isomers
buffers are_______
substances that minimize changes in the concentration of H+ and OH- in a solution.
During glycolysis, ATP is produced by ...
substrate-level phosphorylation
What two main products result from photosynthesis?
sugars/carbohydrates and oxygen
which functional group is not present in this molecule?
sulfhydryl
The chemical group that helps stabilize protein structure is the __________.
sulfhydryl group (-SH)
____ is an emergent property of water that allows insects like the raft spider to walk on water.
surface tension
... Contains an anticodon ... carries genetic information of making a specific protein ... has an maino acid attached ... is a component of ribosomes ... contains exons
tRNA mRNA tRNA rRNA mRNA
A controlled experiment is one that
tests experimental and control groups in parallel
The protein, lipid, and carbohydrate compositions of the cytoplasmic and extracellular sides of membranes are different from one another , this happens because _____
the 2 sides of a cell membrane face different environments and carry out different functions
DNase is an enzyme that catalyzes the hydrolysis of the covalent bonds that join nucleotides together. What would first happen to DNA molecules treated with DNase?
the bonds between deoxyribose phosphate groups would be broken.
If a buffer were added to the solution on the right, how would the buffer behave?
the buffer would act as an acid and add H+ to the solution.
Submerging a plant cell in distilled water will result in
the cell becoming turgid
How does the sodium-potassium pump effect the concentration of sodium (Na+) and potassium (K+) across the plasma membrane?
the concentration of Na+ is greater outside of the cell and the concentration of K+ is greater inside the cell.
How do unsaturated fatty acids help keep any membrane more fluid at lower temperatures?
the double bonds form kinks in the fatty acid tails that prevent adjacent lipids from packing tightly together.
The reactivity of an atom arises from______
the existence of unpaired electrons in the valence shell
Chemiosmosis involves
the movement of hydrogen ions across the mitochondrial membrane
Chemiosmosis involves ...
the movement of hydrogen ions across the mitochondrial membrane
experimental (independent) variable
the one parameter which is varied. The subject of the experiment.
water is a polar molecule. This means that______
the opposite ends of the molecule have opposite electrical charges.
Enzymes that break down DNA catalyze the hydrolysis of the covalent bonds that join nucleotides together. What would happen to DNA molecules treated with these enzymes?
the phosphodiester linkages of the polynucleotide backbone would be broken.
Structural isomers have____
the same molecular formula but different covalent arrangements of their carbon skeleton.
which solution has a lower pH value?
the solution on the left
in ionic interactions,_________
the transfer of valence electrons results in a completed valence shell for each ion
The partial charges on a water molecules occur because of______
the unequal sharing of electrons between the hydrogen atoms n the oxygen atoms of a water molecule.
an accident victim has lost a lot of blood due to a serious injury. Replacement of the lost body fluids with a hypertonic saline solution would have which of the following?
the victim's red blood cells will swell and lyse.
If more sugar were added to the solution on the left side of the tube, what would happen to the water level on the right side of the tube?
the water level on the right would go down.
why are the vertebrate sex hormones estrogen and testosterone considered to be lipids?
their carbon skeletons are composed of primarily C-C and C-H bonds
The cell walls of bacteria, fungi, and plant cells and the extracellular matrix of animal cells are all external to the plasma membrane. Which of the following is a characteristic common to all of these extracellular structures?
they are constructed of polymers that are synthesized in the cytoplasm and then transported out of the cell for assembly.
Select all that apply to sister chromatids:
they are the result of DNA replication they are held together at the centromere they are identical
Chemical groups are significant because __________.
they contribute to the molecular shape of a molecule and its unique properties.
which of the following statements is true about chemical reactions?
they involve the making and breaking of chemical bonds.
which of the following structures plays a major role in making skin tissue water tight?
tight junctions
When DNA is used a template for the synthesis of mRNA, this is called ...
transcription
The information in a gene that directs the production of a cellular product is gene expression. The correct sequence for the transfer of information from a gene to a function protein is __________.
transcription, translation, and protein folding.
which of the following molecules is required to build cilia or flagella?
tubulin
Domain Bacteria
unicell., autotro. or hetero., cell wall of peptidoglycan
The molecule shown in Figure 3.9 is a(n)
unsaturated fatty acid
DNA double helix does not have which of the following?
uracil
Virusses can ...
use the host cell to copy themselves and make viral proteins
The behavior of an atom depends on the ______
valence electrons in the outermost electron shell