Bio M2E Quiz 2 - Flow

Which of the following would be TRUE regarding the replication of the lagging strand? Select all that apply. A. The first Okazaki fragment will be made closest to the origin of replication. B. DNA polymerase would synthesize a fragment in the 3' to 5' direction. C. The lagging strand template is looped out so that both strands at a fork can be synthesized by a single replication complex. D. DNA ligase forms hydrogen bonds between the synthesized fragments.

A & C A. The first Okazaki fragment will be made closest to the origin of replication. C. The lagging strand template is looped out so that both strands at a fork can be synthesized by a single replication complex.

Which of the following statements about the metaphase checkpoint are TRUE. Mark all correct answers. A. A disruption of the metaphase checkpoint can lead to nondisjunction during anaphase. B. If a cell is stopped at the metaphase checkpoint, it may shift into a resting state. C. Correct spindle attachment to chromatids is required for a cell to pass through the checkpoint.

A & C! A. A disruption of the metaphase checkpoint can lead to nondisjunction during anaphase. C. Correct spindle attachment to chromatids is required for a cell to pass through the checkpoint.

In DNA proofreading during replication, DNA polymerase III enzyme acts as a: Select all that apply. A. exonuclease B. endonuclease C. ligase D. polymerase

A & D! A. exonuclease D. polymerase

In eukaryotes, an origin of replication: (Mark all that are TRUE) A. has two forks that replicate in the opposite direction B. uses the same strand of DNA as the leading strand at both forks. C. starts at one end of a chromosome and replicates to the other end D. must be present at multiple locations along a chromosome to replicate DNA efficiently

A & D! A. has two forks that replicate in the opposite direction D. must be present at multiple locations along a chromosome to replicate DNA efficiently

Cells spend most of their time in what phase? A. S phase B. G2 phase C. Mitosis D. G1 phase

A & D! A. S phase D. G1 phase Feedback:Different cell types can have variable length G1 phases. Accepted both G1 and S phase as acceptable answers here.

UV induced damage resulting in thymine dimers is normally repaired by which pathway? A. nucleotide excision repair B. mismatch repair C. DNA proofreading

A! A. nucleotide excision repair

In which repair mechanisms would DNA polymerase be used? (Select all that apply) A. nucleotide excision repair B. mismatch repair C. DNA proofreading

A, B, & C! A. nucleotide excision repair B. mismatch repair C. DNA proofreading

Two homologous chromosomes: (Select all that are TRUE) A. Carry the same genes in the same order, but the alleles for each trait may not be the same B. Are inherited, one from each parent C. Separate from each other in anaphase II D. Are present in the cell in mitosis as well as meiosis

A, B, & D! A. Carry the same genes in the same order, but the alleles for each trait may not be the same B. Are inherited, one from each parent D. Are present in the cell in mitosis as well as meiosis Feedback: Both homologous chromosomes are present during mitosis, even if they do not physically pair.

Which of the following statements about a loss of function mutation could be TRUE? (Select all that apply.) A. No mutant protein product is produced. B. The mutant protein is produced but is nonfunctional. C. The mutant protein has increased activity relative to the normal protein. D. Changes in the mutant protein are the result of a change at the nucleotide level.

A, B, & D! A. No mutant protein product is produced. B. The mutant protein is produced but is nonfunctional. D. Changes in the mutant protein are the result of a change at the nucleotide level.

Which of the following contribute to the fidelity of the genetic message stored in DNA? Choose all TRUE statements. A. The complementary strands of DNA provide a template to make new DNA strands. B. The complementary strands of DNA provide a template to repair DNA C. The bases of DNA nucleotides are protected in the middle of the helix D. A relatively simple code using 4 letters can store the information to produce complex proteins

A, B, C, & D! A. The complementary strands of DNA provide a template to make new DNA strands. B. The complementary strands of DNA provide a template to repair DNA C. The bases of DNA nucleotides are protected in the middle of the helix D. A relatively simple code using 4 letters can store the information to produce complex proteins

How does mitosis faithfully parcel out exact copies of heritable information to produce genetically identical daughter cells? Mark all that are TRUE in a normal cell division process. A. Sister chromatids are synthesized as exact copies of each other. B. Both chromatids are pulled to one side of the cell during anaphase. C. The cell waits until all chromosomes align in metaphase before anaphase occurs. D. If DNA replication makes errors, there are mechanisms to repair the error.

A, C, & D! A. Sister chromatids are synthesized as exact copies of each other. C. The cell waits until all chromosomes align in metaphase before anaphase occurs. D. If DNA replication makes errors, there are mechanisms to repair the error.

Which of the following statements about the synthesis of DNA during DNA replication is true? Mark all that are TRUE. A. New DNA must be synthesized in the 5' to 3' direction. B. DNA polymerase add a new nucleotide to the 5' carbon of the existinD. DNA ligase is required to link together fragments of the lagging strand. E. Replication uses a DNA polymerase complex that synthesizes simultaneously on both leading and lagging strands.g chain of nucleotides. C. RNA primers are only needed to form the lagging strand of DNA. D. DNA ligase is required to link together fragments of the lagging strand. E. Replication uses a DNA polymerase complex that synthesizes simultaneously on both leading and lagging strands.

A, D, & E! A. New DNA must be synthesized in the 5' to 3' direction. D. DNA ligase is required to link together fragments of the lagging strand. E. Replication uses a DNA polymerase complex that synthesizes simultaneously on both leading and lagging strands.

How many homologous chromosome pairs are found in the cell? A. 3 B. 6 C. 12

A. 3

Answer the following questions about the cell below in a process of meiosis. Homologous pairs of chromosomes are circled by a dashed line. This cell is in: A. Prophase I of meiosis B. Prophase II of Meiosis

A. A. Prophase I of meiosis

A certain genetic disease is caused by a single nucleotide change from GCG to GAG in a gene. Following a double strand break generated by CRISPR-Cas9 in a living cell, which cellular repair mechanism can be used to repair the mutant allele to the normal sequence? A. Homology directed repair (HDR) B. Non-homologous end-joining (NHEJ) C. DNA mismatch repair D. Nucleotide excision repair

A. Homology directed repair (HDR)

Which of the following statements about the structure of DNA is TRUE? A. The backbone consists of alternating sugars and phosphates connected by phosphodiester bonds. B. The two strands of DNA are held together by hydrogen bonds between phosphate groups. C. Purines pair with purines and pyrimidines with pyrimidines. D. The two strands of DNA are oriented in the same direction.

A. The backbone consists of alternating sugars and phosphates connected by phosphodiester bonds.

Which of the following would be common to both mitosis and meiosis? (Select all that apply.) A. The parent cell is diploid, and the daughter cells are haploid. B. Chromosomes must be replicated before the process begins. C. Sister chromatids are pulled apart during the process. D. Results in identical daughter cells. E. Homologous pairs of chromosomes align (in pairs) on the metaphase plate.

B & C! B. Chromosomes must be replicated before the process begins. C. Sister chromatids are pulled apart during the process.

When a double-strand DNA break occurs in the genome: (Select all that apply) A. the correct sequence from the opposite strand can be used as a template for repair. B. the correct sequence from a homologous chromosome can be used for repair. C. insertions or deletions may be generated in an attempt to repair the DNA. D. nucleotide excision repair can be used to repair the break.

B & C! B. the correct sequence from a homologous chromosome can be used for repair. C. insertions or deletions may be generated in an attempt to repair the DNA.

The genome of humans is made up of 46 chromosomes. Mark all that are TRUE about these chromosomes: A. In mitosis, homologous chromosomes are not present. B. The DNA double helix is wound around proteins called histones. C. Chromosomes always look like "X" shape structures. D. Chromosomes condense to undergo cell division.

B & D! B. The DNA double helix is wound around proteins called histones. D. Chromosomes condense to undergo cell division. Feedback: Even though homologous chromosomes do not physically pair during mitosis, there are still homologous pairs of chromosomes present. i.e. Each cell would have two chromosome 1s, two chromosome 2s, two chromosome 3s, etc.

During meiosis, maternal and paternal chromosomes of homologous pairs may align on either side of the metaphase plate. This is the basis for the law of: A. dominance B. independent assortment C. segregation

B! B. independent assortment

In MMR, Mut H acts as a ____________ and creates nick in the DNA at ________________. A. endonuclease; the site of the mismatch B. endonuclease; a GATC site away from the mismatch C. exonuclease; the site of the mismatch D. exonuclease; a GATC site away from the mismatch

B! B. endonuclease; a GATC site away from the mismatch

In MMR, the cell is able to distinguish the newly synthesized DNA from the original template DNA because the new DNA is: A. methylated B. not methylated C. oriented in the 5' to 3' direction D. oriented in the 3' to 5' direction

B! B. not methylated

Imagine the figure below shows an active replication fork. Which of the following statements are TRUE? A. The end labeled A is a 3' end. B. The strand labeled C is the leading strand template. C. D would be a molecule of helicase. D. E is an example of an Okazaki fragment. E. The sequences shown in red at the beginning of each new segment are composed of RNA nucleotides.

B, C, & E! B. The strand labeled C is the leading strand template. C. D would be a molecule of helicase. E. The sequences shown in red at the beginning of each new segment are composed of RNA nucleotides.

Which of the following events occur before or during mitosis. Select all that apply: A. Homologous chromosome pairing B. Replication of DNA C. Independent assortment D. Separation of sister chromatids E. Microtubule attachment

B, D, & E! B. Replication of DNA D. Separation of sister chromatids E. Microtubule attachment Feedback: DNA must be replicated (S phase) before entering a mitotic division. Sister chromatids separate during anaphase of mitosis. Microtubule attachment occurs as chromosome align on the metaphase plate.

Each chromosome at this stage of meiosis has: A. 1 chromatid B. 2 chromatids C. 4 chromatids

B. 2 chromatids

The figure below shows a ribosome during the process of translation. The nucleotide sequence in the open box on the tRNA would be: A. 3' TCT 5' B. 3' UCU 5' C. 3' AGA 5'

B. 3' UCU 5'

How many chromosomes are present in the cell at this stage? A. 2 B. 4 C. 8

B. 4

Which of the following would represent the RNA molecule transcribed from the DNA? A. 3' CAGUAUGAUAGCCAGCUGAUGGA 5' B. 5' CAGUAUGAUAGCCAGCUGAUGGA 3' C. 3' GUCAUACUAUCGGUCGACUACCA 5' D. 5' GUCAUACUAUCGGUCGACUACCA 3

B. 5' CAGUAUGAUAGCCAGCUGAUGGA 3' The RNA will be the complementary sequence of the template strand, synthesized in the 5' to 3' direction.

In addition to its normal role in replication, the enzyme DNA polymerase III also acts as a ____ during DNA proofreading. A. primase B. 5'-3' exonuclease C. 3'-5' exonuclease D. 5'-3' endonuclease

B. 5'-3' exonuclease

If both parents are carriers for a CF mutation, what is the chance that an offspring is a carrier? A. 75% B. 50% C. 25% D. 0%

B. 50%

What is the diploid (2n) number of this cell? A. 3 B. 6 C. 12

B. 6

Which of the cells together with Cell A illustrates the mechanism responsible for independent assortment. Cell B Cell C Cell D Cell E

Cell C - Cell C shows the alternate arrangement of chromosomes to Cell A. In cell A, the chromosomes carrying alleles G and t are on the left side of the metaphase plate, and g and T are on the right. In cell C, the chromosomes carrying G and T are on the left, and g and t are on the right. Each homologous pair of chromosomes aligns on the metaphase plate independent from the other chromosomes. Because each pair can align in two ways, this eventually generates variation in the chromosomes carried by individual gametes. Not B - Notice that cell B shows replicated chromatids that do not have identical sister chromatids. For example G/g on sister chromatids.

Which of the cells would represent the arrangement of chromosomes in metaphase of mitosis? Cell B Cell C Cell D Cell E

Cell D - shows the duplicated chromosomes lined up single file along the metaphase plate. This arrangement prepares the cells for separation of sister chromatids during anaphase of mitosis.

The LAST amino acid in the protein will be ____.

Correct: Ser (serine) is the last amino acid in the protein. The codon AGC is the last codon before the stop codon, UGA. A stop codon signals for RNA polymerase to stop and attracts a release factor, not a tRNA. It does not for code an amino acid.

In MMR, which enzyme removes the mismatched nucleotide? A. MutH B. MutL C. MutS D. Exo1 (exonuclease)

D! D. Exo1 (exonuclease)

A karyotype can provide information about the genome of an organism. Which of the following can a karyotype NOT provide? A. the number of chromosome pairs in an organism B. the sex of the organism C. whether mitotic non-disjunction occurred D. the presence of mutant genes on chromosomes

D! D. the presence of mutant genes on chromosomes

Are the daughter cells genetically identical to the parent cell and to each other? For both mitosis and meosis.

Daughter cells of mitosis are genetically identical to each other and to the parent. applied rubric item Daughter cells of meiosis are genetically variant. They are not identical to the parent cell or to each other.

At the end of meiosis II, which gametes would form given the arrangement of chromosomes in Cell A (shown during metaphase I). Assume that there is no recombination.

Gt and gT Gametes caring the alleles Gt and gT would from this cell. Given the arrangement shown in metaphase I, chromosomes carrying G and t will segregate into a cell on the left, and chromosomes carrying g and t will segregate into a cell on the right. As each cell goes through Meoisis II, the resulting gametes will carry the G and t alleles OR the g and T alleles.

What is Homology directed repair (HDR)?

Homology directed repair (HDR), whether part of CRISPR or as a natural repair mechanism in cell, uses a homologous sequence to make a precise repair. In CRISPR the homologous sequence is provided as a "donor DNA" molecule. In a natural system, the homologous chromosome can provide the template for repair.

A couple would like to know the chances of their child having Achondroplasia. Parent #2 has Achondroplasia; parent #1 does not. What is the possible chance of having a child with Achondroplasia? Select all possible answers. A. 100% B. 50% C. 25% D. 0%

A & B! A. 100% B. 50% If the affected parent is homozygous for the mutation then 100% of offspring would inherit the mutant allele, although in practice the homozygous mutant condition is often lethal. If the affected parent is heterozygous for the mutation then there would be a 50% chance of having an affected child.

In which repair mechanisms would DNA ligase be used? (Select all that apply) A. nucleotide excision repair B. mismatch repair C. DNA proofreading

A & B! A. nucleotide excision repair B. mismatch repair

The G1 checkpoint in the cell cycle: A. represents a commitment for the cell to complete cell division. B. checks for DNA damage before the S phase. C. checks for DNA replication before the cell divides by mitosis. D. replicates the DNA so cells can divide.

A & B! A. represents a commitment for the cell to complete cell division. B. checks for DNA damage before the S phase. Feedback:Accepted both choices A and B. G1 checkpoint does check for DNA damage to ensure that DNA has been repaired before replication in the S phase. Also accepted A because passing through the G1 gene point does commit a cell to move through the rest of the cycle including cell division as long as the cell is able to pass through remaining checkpoints.

When this mRNA is translated the FIRST amino acid in the protein will be ____.

Met. The start codon AUG codes for methionine. Methionine will be the first amino acid in the protein. When translating an mRNA, look for the start codon and then start breaking the sequence into triplet codons. If you answered Gln, you translated the first triplet in the mRNA (CAG) instead of looking for the start codon. The sequence CAGU before the start codon is an example of a 5' untranslated region.

How does your answer to the question above (if daughter cells of mitosis and meiosis are identical to parents/siblings) relate to the role of mitosis and meiosis in the life cycle of an organism?

Mitosis produces cells in used growth and development where all cells have the same DNA. Also acceptable, mitosis produces somatic or body cells that all share the same DNA. Mitosis involves the direct replication of two cells in an organism. Meiosis produces gametes that fuse with other gametes to produce genetically diverse offspring; generates variation among the offspring. Meiosis involves the formation of gametes in their cell replication and splitting.

What is non-homologous end joining (NHEJ)?

Non-homologous end-joining is a mechanism that repairs double stranded breaks (in CRISPR and in the cell) but as a "rough repair". Enzymes create random insertions and deletions of nucleotides to join the two pieces of DNA back together.; DNA mismatch repair repairs single mismatches right after replication; Nucleotide excision repair removed damaged nucleotides.

General transcription factors bind to the promoter region of the gene. TRUE or FALSE

True

T or F: A brain cell and a kidney cell express a different subset of genes from the genome.

True

T or F: A brain cell and a kidney cell have a different set of regulatory transcription factors present.

True

T or F: Depending on the particular gene, the template strand may be either strand of the DNA molecule.

True

T or F: Each regulatory binding site on the DNA would be recognized by a specific regulatory transcription factor.

True

T or F: RNA polymerase requires the presence of general transcription factors in order to bind to the promoter.

True

T or F: The experiment suggests that binding site 3 is an enhancer, and binding sites 1 and 2 are silencers

True

T or F: The promoter for a gene would be located "upstream" of the coding region.

True

DNA polymerase III adds new nucleotides to the ____ of a primer.

3'end

Which of the following statements about the DNA mismatch repair process is TRUE? A. The newly synthesized strand can be identified because the new DNA is methylated. B. An endonuclease makes an initial break in the sugar phosphate backbone. C. A single mismatched nucleotide is removed by an exonuclease. D. DNA ligase is not needed in mismatch repair.

B. An endonuclease makes an initial break in the sugar phosphate backbone. This is because once a mismatch has been detected and bound by MutS/MutL complex, an endonuclease (MutH) is activated at a site a distance away from the mismatch. C is incorrect because the original strand of DNA is methylated, and the new stand is not; an exonuclease removes a section of DNA nucleotides including but not limited to the mismatched nucleotide; DNA ligase is required to make a new phosphodiester bond along the backbone once the newly repaired DNA has been synthesized.

In which stage of meiosis do homologous chromosomes separate? A. Prophase I B. Anaphase I C. Prophase II D. Anaphase II

B. Anaphase I

Which of the following statements about the cell cycle is FALSE? A. A sister chromatid is produced during the S phase. B. The G1 checkpoint checks for microtubule attachments to chromosomes. C. The G2 checkpoint checks for complete replication of the genome. D. Disruption of the metaphase checkpoint can lead to aneuploidy.

B. The G1 checkpoint checks for microtubule attachments to chromosomes.

Which of the statements about dominant and recessive mutations is TRUE? A. The majority of loss-of-function mutations are dominant B. The majority of gain-of-function mutations are dominant C. The majority of gain-of-function mutations are recessive D. The majority of loss-of-function mutations are X-linked

B. The majority of gain-of-function mutations are dominant

A sample of DNA is found to have 35% T. What percent G would be expected? A. 10 B. 15 C. 35 D. 65

B: 15 If 35% T, then there would also be 35% A. That leaves 30% of the DNA - 15% would be G and 15% C.

The diploid cell to the right is in metaphase I of meiosis. Gene A/a and Gene D/d are located on the same chromosome. Which of the following gene combinations would ONLY be found in gametes formed when a crossover occurred between gene A/a and gene D/d during meiosis? A. A - D B. a - d C. A - d D. a - D

C & D! C. A - d D. a - D

Can two parents who are heterozygous for an FGFR mutation have a normal height child? If yes, what percent of the time? A. Yes; 75% of the time. B. Yes; 50% of the time C. Yes; 25% of the time D. No, they cannot have a normal height child.

C. Yes; 25% of the time

At the end of meiosis I, the two daughter cells are: A. identical to each other and to the parent cell. B. identical to each other, but different than the parent cell. C. different than each other and the parent cell.

C. different than each other and the parent cell.

Oswald Avery, Colin MacLeod, and Maclyn McCarty did experiments that followed up on the results of Griffith, as shown to the right. They injected different combinations of rough and smooth bacteria into mice, but they also treated heat-killed smooth bacteria with enzymes that destroyed particular biomolecules (DNase destroys DNA; protease destroys protein.) Which of the following would be a correct conclusion from their classic experiment. A. Smooth bacteria must be alive in order to transform rough bacteria into a pathogenic form. B. Protein is likely the "transforming agent". When protein is destroyed in heat-treated smooth bacteria, the mouse dies. C. DNA is likely the "transforming agent". When DNA is destroyed in heat-treated smooth bacteria, rough bacteria remain non-pathogenic.

C! C. DNA is likely the "transforming agent". When DNA is destroyed in heat-treated smooth bacteria, rough bacteria remain non-pathogenic.

In DNA mismatch repair (MMR), which enzyme is responsible for detecting the mismatched nucleotide? A. MutH B. MutL C. MutS D. Exo1 (exonuclease)

C! C. MutS

During meiosis, a pair of homologous chromosomes separate from each other. This basis for the law of: A. dominance B. independent assortment C. segregation

C! C. segregation

If the DNA content of a diploid cell in the G1 phase of the cell cycle is represented by x, then the DNA content of the same cell is: Mark all of the following statements that are TRUE. A. 0.5x at the end of the S phase of the cell cycle B. x at the end of the S phase of the cell cycle C. 2x at the end of the S phase of the cell cycle D. 2x at the end of G2 phase of the cell cycle E. x at the end of telophase of mitosis

C, D, & E! C. 2x at the end of the S phase of the cell cycle D. 2x at the end of G2 phase of the cell cycle E. x at the end of telophase of mitosis Feedback: DNA is replicated during the S phase, so the amount of DNA present would be 2x. At the end of G2, the chromosome are still in their replicated form. By the of telophase (and cytokinesis), the sister chromatids have separated, the two daughters return the same amount of DNA as the parent cell in G1.

If both parents are carriers for a CF mutation, what is the chance that an offspring has the disease? A. 75% B. 50% C. 25% D. 0%

C. 25%

How many chromatids are present in the cell at this stage? A. 2 B. 4 C. 8

C. 8

Beta thalassemia is a blood disorder that reduces the production of hemoglobin. The disorder is caused by a mutation in the promoter of the hemoglobin gene, and is inherited as an autosomal recessive trait. Which of the following statements would most likely be TRUE? A. Males with one copy of the mutant hemoglobin allele will have the disorder. B. The mutation in the hemoglobin promoter is a gain of function mutation. C. A single copy of the normal hemoglobin allele produces sufficient hemoglobin. D. All offspring of an affected parent will have this disorder.

C. A single copy of the normal hemoglobin allele produces sufficient hemoglobin. In recessive disorders, heterozygotes or carriers often have a normal phenotype because a single copy of the normal gene is able to make enough protein product to maintain the normal phenotype

In the cell, DNA replication would occur: A. Before mitosis B. Before meiosis C. Before mitosis or meiosis

C. Before mitosis or meiosis

How likely is it for a woman to have DMD? A. Women will never have this condition. B. One-fourth of the daughters of an affected man would have this condition. C. One-half of the daughters of an affected father and a carrier mother would be expected to have this condition.

C. One-half of the daughters of an affected father and a carrier mother would be expected to have this condition.

A recent CRISPR treatment for sickle-cell anemia involves reactivating the production of fetal hemoglobin. Mutations associated with sickle cell anemia are in the gene for adult hemoglobin; individuals have normal fetal hemoglobin genes. At birth, a protein called BCL11A, represses expression of fetal globin genes, but if the bcl11A gene is deactivated, normal fetal hemoglobin will be produced. Which of the following describes an CRIPR approach that would allow for expression of the fetal globin genes in an adult sickle cell patient? A. Provide donor template containing the normal sequence for the adult globin gene. B. Use HDR to switch on expression of the fetal hemoglobin gene by replacing it with the adult sequence. C. Use non-homologous end joining (NHEJ) to generate INDELs in the fetal globin gene. D. Use non-homologous end joining (NHEJ) to generate INDELs in the bcl11A gene.

D! D. Use non-homologous end joining (NHEJ) to generate INDELs in the bcl11A gene.

If one parent is a carrier of a CF mutation and the other is homozygous normal, what is the chance that an offspring has the disease? A. 75% B. 50% C. 25% D. 0%

D. 0%

Color blindness in humans is an X-linked recessive disease. A colorblind man, and a woman with normal vision who is not a carrier, plan on starting a family. Which of the following statements is TRUE? A. All of their sons would be colorblind. B. A son would have a 50% chance of being colorblind. C. A daughter would have a 50% chance of being colorblind. D. A daughter would have a 50% chance of being a carrier for the colorblind gene.

D. A daughter would have a 100% chance of being a carrier for the colorblind gene.

In which stage of meiosis do the chromatids of a chromosome separate? A. Prophase I B. Anaphase I C. Prophase II D. Anaphase II

D. Anaphase II

Which sequence is the correct order of proteins (enzymes) used in DNA replication: A. RNA primase, DNA helicase, DNA polymerase 1, DNA polymerase III, DNA helicase B. DNA helicase, DNA polymerase I, DNA polymerase III, RNA primase, DNA ligase C. RNA primase, DNA polymerase III, DNA ligase, DNA polymerase I, DNA helicase D. DNA helicase, RNA primase, DNA polymerase III, DNA polymerase I, DNA ligase

D. DNA helicase, RNA primase, DNA polymerase III, DNA polymerase I, DNA ligase

During the elongation phase of translation, the ribosome catalyzes the formation of: A. Hydrogen bonds between amino acids B. Phosphodiester bonds between amino acids C. Phosphodiester bonds between tRNA molecules D. Peptide bonds between amino acids E. Peptide bonds between tRNA molecules

D. Peptide bonds between amino acids

Hemoglobin is produced by red blood cells, but not by other cells of the body. Other body cells do not express the hemoglobin gene because they: A. do not have the hemoglobin gene. B. do not have a promoter for the hemoglobin gene. C. have a mutation that disables the hemoglobin gene. D. do not have the necessary regulatory transcription factors.

D. do not have the necessary regulatory transcription factors.

At the end of meiosis I, the two daughter cells will be: A. diploid with 6 chromosomes in each cell. B. diploid with 3 chromosomes in each cell. C. haploid with 6 chromosomes in each cell. D. haploid with 3 chromosomes in each cell.

D. haploid with 3 chromosomes in each cell.

In cats, black fur color is caused by an X-linked allele; the other allele at this locus causes orange color. The heterozygote is tortoiseshell. What kinds of offspring would you expect from the cross of a black female and an orange male? (Hint: Write out the genotypes of the parents and set up a Punnett square to solve this question.) A. tortoiseshell females; tortoiseshell males B. black females; orange males C. orange females; orange males D. tortoiseshell females; black males

D. tortoiseshell females; black males The black female is XBXB - if she were heterozygous (XBXb) she would have a tortoiseshell phenotype. The orange male is XbY - since he only has one copy of the allele, you know that the allele on the X is b. Possible offspring of these parents would be 50% XBXb (tortoiseshell females) and 50% XBY (black males).

In the same cell above, consider any single gene on any chromosome. How many copies of that gene would the cell have at the start of meiosis; at the end of meiosis? A. 2; 2 B. 2; 1 C. 4; 4 D. 4; 2 E. 4; 1

E. 4; 1

Two unaffected parents have a son with DMD. What are the genotypes of the parents? A. XdXd and XdY B. XdXd and XDY C. XDXD and XdY D. XDXD and XDY E. XDXd and XDY

E. XDXd and XDY

All nucleotides of an mRNA are translated in amino acids. TRUE or FALSE

FALSE

During anaphase I, sister chromatids would separate from each other. True or False

False

T or F: All nucleotides of the final mRNA product, excluding the 5' cap and poly-A tail, will be translated into amino acids.

False

T or F: Exons are non-coding sections of DNA that are transcribed into RNA but removed during RNA processing.

False

T or F: RNA polymerase synthesizes the primary transcript in the 3' to 5' direction.

False

T or F: The 3 binding sites have the same nucleotide sequence.

False

T or F: The 5'cap and poly-A tail are transcribed into RNA when the primary transcript is made.

False

T or F: The DNA found in the nucleus of a brain cell is different from the DNA in a kidney cell.

False

T or F: The DNA in a brain cell has different promoter regions than the DNA in a kidney cell.

False

T or F: The majority of nucleotides in the human genome are transcribed into mRNA

False

T or F: Transcription starts at the AUG start codon.

False

T or F: Whenever a binding site was deleted, the level of transcription of the reporter gene decreased.

False

The cell at this stage is haploid (1n). True or False

False