BIO Q 11

The primer required to initiate synthesis of a new DNA strand consists of A. RNA B. DNA C. an Okazaki fragment D. primase

A. RNA

Which of the following sequences represents the mRNA sequence transcribed from this DNA temple strand? For the purposes of this exercise we are ignoring the role of promoter and terminator sequences. The 5'- and 3'- ends of the template strand is given. Assume the answers are all presented antiparallel as 5'-to-3' from left to right. 3'-ATTGCTACTGCATGCTAGGAACACAAACTAAGCGG-5' A. UAACGAUGACGUACGAUCCUUGUGUUUGAUUCGCC B. ATTGCTACGGCATGCTAGGAACACAAACTAAGCGG C. TAACGATGCCGTACGATCCTTGTGTTTGATTCGCC D. AUUGCUACGGCAUGCUAGGAACACAAACUAAGCGG E. UAAGCAUCAGCUAGCAUGGUUCUCUUUCAUUGCGG

A. UAACGAUGACGUACGAUCCUUGUGUUUGAUUCGCC

The anticodon of a particular tRNA molecules is A. complementary to the corresponding mRNA codon B. complementary to the corresponding triplet in the DNA sense strand C. the part of the tRNA that bonds to a specific amino acid D. changeable, depending on the amino acid that attaches to the tRNA E. catalytic, making the tRNA a ribozyme

A. complementary to the corresponding mRNA codon

Which enzyme catalyzes the elongation of a DNA strand in the direction? A. primase B. DNA polymerase C. helicase D. DNA ligase E. topoisomerase

B. DNA polymerase

An intron is A. the region of a bacterial operon where RNA polymerase initially binds to the DNA B. a non-coding sequence of nucleotides within a eukaryotic gene that is excised from the pre-mRNA during post-transcription modification of mRNA C. part of the ribosome where tRNA molecules combine with mRNA during translation D. an eukaryotic protein that binds to DNA, causing the DNA to coil up tightly during metaphase of the cell cycle E. a repeating sequence of adenine nucleotides attached to the 5' end of a molecule of mRNA after transcription has been completed

B. a non-coding sequence of nucleotides within a eukaryotic gene that is excised from the pre-mRNA during post-transcription modification of mRNA

Referring to the DNA sequence presented in the previous two problems, what would be the consequence (in terms of the polypeptide formed) of a base substitution involving the 12th base in the sense strand of the DNA being switched from A (adenine) to C (cytosine)? Note the original (unmutated) sense strand of the DNA is repeated below and the base to be mutated is boldface, italicized and highlighted in red. The codon chart is also provided for your use. 3'-ATTGCTACTGCATGCTAGGAACACAAACTAAGCGG-5' A. early termination of translation B. substitution of the amino acid "tyr" by the amino acid "asp" in the polypeptide C. failure for initiation of translation D. production of a totally nonfunctional polypeptide E. creation of a totally new species

B. substitution of the amino acid "tyr" by the amino acid "asp" in the polypeptide

Given a sequence of DNA bases of 5'-TATAGCGAT-3', its complementary sequence of DNA bases is A. 3'-TATAGCGAT-5' B. 3'-UAUAGCGAU-5' C. 3'-ATATCGCTA-5' D. 3'-AUAUCGCUA-5' E. 5'-ATATCGCTA-3'

C. 3'-ATATCGCTA-5'

Referring to the previous question, use the codon chart provided to determine the amino acid sequence coded for by this DNA template strand (first transcribe this sequence into mRNA; then translate this mRNA into the amino acid sequence of a polypeptide). Don't forget the roles of initiator codons and terminator codons. The DNA sequence from the previous question is repeated below. 3'-ATTGCTACTGCATGCTAGGAACACAAACTAAGCGG-5' A. met-arg-cys-arg-thr-ile-leu-val-phe-asp-ser B. met-leu-gly-thr-gln-thr-lys-arg C. met-thr-tyr-asp-pro-cys-val D. ile-ala-thr-ala-cys E. met-thr-tyr-asp-pro-cys-ala

C. met-thr-tyr-asp-pro-cys-val

In his work with pneumonia-causing bacteria and mice, Griffith found that A. the protein coat from smooth (S) cells was able to transform rough (R) cells B. heat-killed S cells were able to cause pneumonia only when they were transformed by the DNA of R cells C. some chemical from S cells was transferred to R cells, transforming them into S cells D. the polysaccharide coat of R cells caused pneumonia E. bacteriophages injected DNA from S cells into R cells

C. some chemical from S cells was transferred to R cells, transforming them into S cells

A eukaryotic cell lacking telomerase would A. be highly sensitive to sunlight. B. produce Okazaki fragments. C. undergo a reduction in chromosome length. D. have a high probability of becoming cancerous. E. be unable to repair thymine dimers.

C. undergo a reduction in chromosome length.

Alternative RNA splicing; A. is a mechanism for increasing the rate of transcription. B. can allow the production of proteins of dramatically different sizes from a single mRNA. C. can allow the production of proteins of dramatically different amino acid sequences from a single mRNA. D. B and C only E. A, B, and C

D. B and C only; A. is a mechanism for increasing the rate of transcription. B. can allow the production of proteins of dramatically different sizes from a single mRNA. C. can allow the production of proteins of dramatically different amino acid sequences from a single mRNA.

Chargaff's analysis of the relative base composition of DNA was significant because he was able to show that A. the amount of A is always equivalent to T, and C to G. B. the human genome is more complex than that of other species. C. the relative proportion of each of the four bases differs from species to species. D. both A and C E. both B and C

D. both A and C; A. the amount of A is always equivalent to T, and C to G. C. the relative proportion of each of the four bases differs from species to species.

Replicating the lagging strand of DNA-that is, adding bases in the direction-utilizes which of the following? A. Okazaki fragments B. RNA primers C. DNA ligase D. A and B only E. A, B, and C

E. A, B, and C

A frameshift mutation could result from A. a base deletion only. B. a base substitution only. C. a base insertion only. D. deletion of three consecutive bases. E. either an insertion or a deletion of a base.

E. either an insertion or a deletion of a base.