Tingnan ang lahat ng mga set ng pag-aaral

Biol 1201 final exam Wischusen

Pataasin ang iyong marka sa homework at exams ngayon gamit ang Quizwiz!

A spontaneous reaction occuring at 250K and with a 2.0Kcal decrease in entropy can have which of the following changes in enthalpy? -600Kcal -250Kcal -100 Kcal 100Kcal 250Kcal 600Kcal

-600Kcal

Which of the following would you find as part of the "R" group of a nonpolar amino acid? -NH2 -CH3 -OH -PO4 -COOH

-CH3

If a/a b/b is crossed with A/A B/B, what is the expected percentage of offspring with both recessive phenotypes?

An individual with the genotype A/A can produce _____ type/s of gametes with respect to the "A" gene.

In a nucleotide, the nitrogenous base is attached to the sugar's _____ carbon and the phosphate group is attached to the sugar's _____ carbon.

1' ... 5'

A pH of 6 is how many times more acidic than a pH of 9?

1,000

A couple has three children, all of whom have brown eyes and blond hair. Both parents are homozygous for brown eyes (BB), but one is a blond (rr) and the other is a redhead (Rr). What is the probability that their next child will be a brown-eyed redhead?

1/2

A man has six fingers on each hand and six toes on each foot. His wife and their daughter have the normal number of digits. Remember that extra digits is a dominant trait. What fraction of this couple's children would be expected to have extra digits? Express your answer using the slash symbol and no spaces (for example, 1/16).

1/2

In a test cross, if the individual whose genotype is unknown is actually heterozygous, what is the expected phenotypic ratio of the offspring?

1/2 dominant, 1/2 recessive

The probability a rolling the number 2 with a pair of dice is

1/36

In the cross D/d F/f X D/d F/f what is the expected proportion of offspring with the genotype d/d F/f

1/8

Beginning with 10 molecules of pyruvic acid, in the presence of Oxygen , and assuming a normal mitochondrion how many molecules of ATP would be expected to be produced via substrate level phosphorylation. I am looking for total production, not net production.

Fluorine's atomic number is 9 and its atomic mass is 19. How many neutrons does fluorine have?

From its atomic number of 15, it is possible to predict that phosphorus always has

15 protons

A diploid organism whose somatic (nonsex) cells each contain 32 chromosomes produces gametes containing _____ chromosomes.

As part of your job you are asked to make 1 liter of a 0.5 molar sucrose solution. How much sucrose (C12H22O11) do you need? Use the information below listing the number of protons, neutrons, and electrons in each element. Element Protons Neutrons Electrons Hydrogen 1 0 1 Carbon 6 6 6 Nitrogen 7 7 7 Oxygen 8 8 8

171

A cell containing 36 chromosomes during Interphase would produce, via meiosis, daughter cells containing chromosomes.

An individual who is heterozygous for a single gene has how many unique alleles for that gene?

For each glucose that enters glycolysis, _____ acetyl CoA enter the citric acid cycle.

How many NADH are produced by glycolysis?

In a portal system how many capillary beds does the blood flow through as it travels from the heart back to the heart?

In glycolysis there is a net gain of _____ ATP

Voltage gated Na+ channels have ____ gates.

Normal human gametes carry _____ chromosomes.

If a cell contained 12 chromosomes, during Interphase, how many chromosomes would be present during Anaphase?

An atom with the atomic number 15 has a valence of?

During the synthesis of a triglyceride from glycerol and 3 fatty acids, which of the following will also occur? Hint: think about how many bonds are required to do this.

3 molecules of water will be produced

If a strand of DNA has the nitrogen base sequence 5'-ATTTGC-3', what will be the sequence of the matching strand?

3'-TAAACG-5'

Beginning with 1 moleucle of glucose, in the presence of Oxygen , and assuming a normal mitochondrion how many molecules of ATP would be expected to be produced via oxidative level phosphorylation. I am looking for total production, not net production.

If an organism normally has 34 chromosomes, how many molecules of DNA should there be in the G1 phase of the cell cycle?

http://session.masteringbiology.com/problemAsset/1100485/2/0210q.jpg This atom can form up to _____ single covalent bond(s).

Upon chemical analysis, a particular protein was found to contain 438 amino acids. How many peptide bonds are present in this protein?

437

An uncharged atom of boron has an atomic number of 5 and an atomic mass of 11. How many protons does boron have?

The log of 100,000 to the base 10 =

Transcribe the DNA sequence shown below. 5' TTAAGGCC

5' GGCCUUAA

http://session.masteringbiology.com/problemAsset/1000230078/3/DNA_Direction.jpg Based on the figure shown below what would locations A and C be?

5' and 3'

Nucleic acids are assembled in the _____ direction.

5' to 3'

The direction of synthesis of an RNA transcript is _____.

5' —> 3'

In crossing a homozygous recessive individual with a heterozygous individual, what is the chance of getting an offspring with the homozygous recessive phenotype?

50%

What is the atomic number of an atom that has 6 protons, 6 neutrons, and 6 electrons?

or each glucose that enters glycolysis, _____ NADH + H+ are produced by the citric acid cycle

Which of these equations best summarizes photosynthesis?

6 CO2 + 6 H2O → C6H12O6 + 6 O2

An atom with the atomic number 9 will have _______ electrons in its outermost electron shell

If a DNA double helix is 100 nucleotide pairs long and contains 25 adenine bases, how many guanine bases does it contain?

A mRNA molecule contains 246 nucleotides, what is the maximum number of amino acids in the polypeptide translated from this mRNA?

Which of these is NOT a lipid? A. RNA B. phospholipid C. cholesterol D. wax E. steroids

http://session.masteringbiology.com/problemAsset/1100526/2/1001q.jpg Identify the chloroplast.

http://session.masteringbiology.com/problemAsset/1100536/6/1828q.jpg Which of these is responsible for initiating a signal transduction pathway?

http://session.masteringbiology.com/problemAsset/1100616/5/1804q.jpg The process of transcription is indicated by the letter _____.

http://session.masteringbiology.com/problemAsset/1000226880/5/Permease.jpg Which of the membrane transport mechanisms moves molecules with or down their concentration gradient? A B C A and B B and C A, B, and C

A and B

Which of the following statements about mutations is false? An addition mutation results in an added base in the DNA sequence. A knock-out mutation results in a total absence of the mutated protein. A deletion mutation results in the loss of a base in the DNA sequence. Addition and deletion mutations disrupt the primary structure of proteins

A knock-out mutation results in a total absence of the mutated protein.

Which statement(s) about repressible operons is/are correct? Select all that apply. A repressible operon is on unless a corepressor is present. Repressible enzymes generally function in anabolic pathways. In a repressible operon, the repressor is synthesized in an active form

A repressible operon is on unless a corepressor is present. Repressible enzymes generally function in anabolic pathways.

Transcription begins at a promoter. What is a promoter?

A site in DNA that recruits the RNA Polymerase

An individual with the following genotype (A/a B/b C/c d/d) could produce all of the gametes shown below except:

A/B/C/D

During glycolysis alone which of the following molecules is/are required?

ATP

In cells, what is usually the immediate source of energy for an endergonic reaction?

ATP

In glycolysis, what starts the process of glucose oxidation?

ATP

Non-cyclic photophosphorylation produces (outputs)?

ATP and NADPH + H+

http://session.masteringbiology.com/problemAsset/1100524/3/0922q.jpg Structure A is _____.

ATP synthase

Chloroplast membrane vesicles are equilibrated in a simple solution of pH 5. The solution is then adjusted to pH 8. Which of the following conclusions can be drawn from these experimental conditions? The change in the solution's pH results in a gradient across the chloroplast membranes such that there is a lower concentration of protons inside the vesicles and a higher concentration outside. ATP will be produced because the proton gradient favors proton movement through the ATP synthase channels. Protons will not diffuse toward the outside of the vesicles. ATP will not be produced because there is no ADP and inorganic phosphate in the solution.

ATP will not be produced because there is no ADP and inorganic phosphate in the solution.

Glycolysis results in the production of

ATP, NADH + H+ and Pyruvic Acid

Which of the following parental genotypes would yield a 1:1:1:1 phenotypic ratio in the offspring? aaBb, aabb AaBb, AaBb AaBb, aabb aaBb, AaBb

AaBb, aabb

After Pyruvic Acid enters the mitochondrion it is converted into _____ prior to entering the Citric Aciod Cycle

Acetyl-CoA

Which term describes an electrical signal generated by neurons?

Action potential.

Lactose transport by membrane proteins occurs under conditions in which the concentration of lactose inside the cell is higher than the concentration outside the cell. What type of transport is used to move lactose into the cell?

Active transport

Active and passive transport of solutes across a membrane typically differ in which of the following ways? Active transport is usually down the concentration gradient of the solute, whereas passive transport is always against the concentration gradient of the solute. Active transport always involves the utilization of cellular energy, whereas passive transport does not require cellular energy. Active transport is always faster than passive transport. Active transport uses protein carriers, whereas passive transport uses carbohydrate carriers. Active transport is used for ions, passive transport is used for uncharged solutes.

Active transport always involves the utilization of cellular energy, whereas passive transport does not require cellular energy.

A black guinea pig crossed with an albino guinea pig produces 12 black offspring. When the albino is crossed with a second black one, 7 blacks and 5 albinos are obtained. What is the best explanation for this genetic outcome? Albino (A) and black (B) exhibit codominance. Albino (b) is a recessive trait; black (B) is a dominant trait. Albino (C A ) and black (C B ) exhibit incomplete dominance. Albino (A) is a dominant trait; black (a) is a recessive trait.

Albino (b) is a recessive trait; black (B) is a dominant trait.

Types of Carbohydrates Carbohydrates, more commonly known as sugars, are made up of carbon, oxygen, and hydrogen atoms. The smallest unit of a carbohydrate is a monosaccharide. Two monosaccharides make up a disaccharide, and many monosaccharides make up a polysaccharide. Disaccharides and polysaccharides can be hydrolyzed back into the individual monosaccharide units. Part A Select the statement that is incorrect.

All carbohydrates have the general formula Cn(H2O)n

Five dialysis bags, with membranes impermeable to sucrose, were filled with various concentrations of sucrose as follows: Bag #1 = 0.1 M sucrose Bag #2 =0.2 M sucrose Bag #3 = 0.3 M sucrose Bag #4 = 0.4 M sucrose Bag #5 = 0.5 M sucrose The bags were all weighed and then placed in separate beakers each containing an initial concentration of 0.6 M sucrose solution. After 30-minute the bags were removed weighed again and the percent change in mass of each bag was calculated. Which of the following statements would correctly reflect the outcome of this experiment?

All the bags weighed less because they lost water.

Which of the following statements most accurately describes the process of independent assortment?

Alleles of different genes segregate from one another in a random manner.

What property of dishwashing liquid (detergent) makes it useful to wash grease from pans?

Amphipathic nature

If a mutated DNA sequence produces a protein that differs in one central amino acid from the normal protein, which of the following kinds of mutations could have occurred? An addition mutation An addition mutation and a deletion mutation. A deletion mutation. None

An addition mutation and a deletion mutation.

During which stage of mitosis do the sister chromatids move away from each other?

Anaphase

Where in the neuron do action potentials begin?

Axon hillock.

http://session.masteringbiology.com/problemAsset/1000222578/6/activation_energy.jpg Which of the following respresents the activation energy of this reaction when it is enzyme catalyzed? A B C A and C B and C

http://session.masteringbiology.com/problemAsset/1100536/6/1831q.jpg Which of these is a membrane receptor?

http://session.masteringbiology.com/problemAsset/1100552/3/1606q.jpg In the accompanying image, a nucleotide is indicated by the letter _____.

http://session.masteringbiology.com/problemAsset/1100614/4/1716q.jpg Which of these is a tRNA?

http://session.masteringbiology.com/problemAsset/1100616/5/1806q.jpg RNA processing is indicated by the letter _____.

http://session.masteringbiology.com/myct/itemView?offset=next&assignmentProblemID=45698966# Which of these gametes contains one or more recombinant chromosomes?

B and C

http://session.masteringbiology.com/problemAsset/1100510/7/0705q.jpg Which of these cannot rapidly pass directly through the phospholipids of the plasma membrane? D only B, C, and D A only C only B only

B, C, and D

A black guinea pig crossed with an albino guinea pig produces 12 black offspring. When the albino is crossed with a second black one, 7 blacks and 5 albinos are obtained. What are the genotypes of the parents in the first cross (the cross that produced 12 black offspring)?

BB x bb

Two sister chromatids are joined at the centromere prior to meiosis. Which statement is correct? These chromatids make up a diploid chromosome. The cell that contains these sister chromatids must be haploid. Barring mutation, the two sister chromatids must be identical

Barring mutation, the two sister chromatids must be identical.

What determines which base is to be added to an RNA strand during transcription?

Base pairing between the DNA template strand and the RNA nucleotides

A black guinea pig crossed with an albino guinea pig produces 12 black offspring. When the albino is crossed with a second black one, 7 blacks and 5 albinos are obtained. What are the genotypes of the parents in the second cross (the cross that produced 7 black and 5 albino offspring)?

Bb x bb

http://session.masteringbiology.com/problemAsset/1319024/5/Chap48_Q3.jpg Why is an action potential an all-or-none response to stimuli?

Because voltage-gated ion channels open when membrane potential passes a particular level

Which of the following are common traits of chloroplasts and mitochondria? Both are surrounded by a single membrane. Both are found in plant and animal cells. Both have their own DNA. Both reproduce by meiosis. Proteins for both are synthesized on ribosomes in the rough ER.

Both have their own DNA.

What role does a transcription factor play in a signal transduction pathway?

By binding to DNA it triggers the transcription of a specific gene.

http://session.masteringbiology.com/problemAsset/1000222578/6/activation_energy.jpg Based on the same figure, which of the following represents the change in free energy for the reaction? A B C A and C B and C

http://session.masteringbiology.com/problemAsset/1100552/3/1610q.jpg A nitrogenous base is indicated by the letter _____.

http://session.masteringbiology.com/problemAsset/1100541/7/1201q.jpg Which of these cells is (are) haploid?

C and D

http://session.masteringbiology.com/problemAsset/1000326496/7/Antagonistic_Pairs.jpg Using the model of cell signaling regulation shown below an increase in compound 3 would stimulate cells ________ to release more compound _________.

C, 2

http://session.masteringbiology.com/problemAsset/1100552/3/1613q.jpg Which of these is(are) pyrimidines?

C, D, and E

Which of these formulas represents a carbohydrate? C4H8O2 C6H12O2 C6H6O2 C3H6O3 More than one of the above None of the above

C3H6O3

If the sequence of nucleotides is GGCCATTA what is the sequence of DNA nucleotides on the complementary strand of DNA?

CCGGTAAT

What is the basic role of CO2 in photosynthesis?

CO2 is fixed or incorporated into organic molecules.

The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____.

CUG

The binding of actin to myosin during muscle contraction is regulated by

Ca++

Based on size and charge which of the following would likely move through the lipid bilayer of a plasma membrane most rapidly?

Carbon Dioxide

Calvin Cycle Input

Carbon Dioxide

Which of the following is/are inputs required for photosynthesis?

Carbon Dioxide

Which of the following molecules represent outputs from the Citric Acid Cycle (alone)? NAD+ FAD ADP Carbon Dioxide more than one of the above

Carbon Dioxide

Into which molecule are all the carbon atoms in glucose ultimately incorporated during cellular respiration? ATP Water Carbon dioxide NADH

Carbon dioxide

Cytokinesis in plant cells occurs through the formation of a:

Cell Plate

All of the following occur during mitotic prophase EXCEPT

Chromosomes are duplicated.

Which of the following terms best describes the relationship between the newly synthesized RNA molecule and the DNA template strand?

Complementary

How are genes coordinately controlled in eukaryotic cells? Select all that apply. Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals. Coordinately controlled genes in eukaryotic cells are located together on the same chromosome. Coordinately controlled genes in eukaryotic cells share a set of control elements.

Coordinately controlled genes in eukaryotic cells are activated by the same chemical signals Coordinately controlled genes in eukaryotic cells share a set of control elements.

http://session.masteringbiology.com/problemAsset/1100526/2/1003q.jpg Identify a thylakoid.

http://session.masteringbiology.com/problemAsset/1100536/6/1115q.jpg Which of these acts as a second messenger?

http://session.masteringbiology.com/problemAsset/1100615/6/1827q.jpg Which of these is a regulatory gene?

http://session.masteringbiology.com/problemAsset/1100612/4/Part_ABC.jpg In the diagram below, the two blue strands represent _____.

DNA

Which of these is a difference between a DNA and an RNA molecule? DNA is usually double-stranded, whereas RNA is usually single-stranded. DNA contains uracil, whereas RNA contains thymine. DNA contains five-carbon sugars, whereas RNA contains six-carbon sugars. DNA is a polymer composed of nucleotides, whereas RNA is a polymer composed of nucleic acids. DNA contains nitrogenous bases, whereas RNA contains phosphate groups.

DNA is usually double-stranded, whereas RNA is usually single-stranded.

One type of chromosomal level gene regulation is:

DNA packing

During DNA replication the enzyme responsible for making the DNA strand is:

DNA polymerase

What catalyzes DNA synthesis?

DNA polymerase

Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments?

DNA polymerase can assemble DNA only in the 5' to 3' direction

http://session.masteringbiology.com/problemAsset/1100616/5/1807q.jpg Which of the following processes is NOT indicated by the label A, B, C, D, or E?

DNA unpacking

Beginning with 1 molecule of glucose, in the presence of Oxygen , and assuming a mitochondrion with two fewer hydrogen ion pumps in the electron transport chain what would happen to the oxidative level phosphorylation production

Decrease

If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred?

Deletion

A cell containing 2 sets of chromosomes would be:

Diploid

http://session.masteringbiology.com/problemAsset/1100486/2/0212a3.jpg Which of these figures correctly illustrates the nature of the bonding of H2O?

http://session.masteringbiology.com/problemAsset/1100526/2/1002q.jpg Identify the stroma.

http://session.masteringbiology.com/problemAsset/1100527/2/1005q.jpg Where does the Calvin cycle occur?

http://session.masteringbiology.com/problemAsset/1100538/2/1203q.jpg Which of these phases encompasses all of the stages of mitosis?

http://session.masteringbiology.com/problemAsset/1319194/5/Chap45_Q5.jpg The figure shows how glucose homeostasis is maintained by two antagonistic hormones, insulin and glucagon. Select the correct statement about these hormones.

Each of these hormones operates in a simple endocrine pathway.

A cell containing the following structures, ribosomes, plasma membrane and flagella, but without a nucleus, ER, or mitochnodria could be?

Either procaryotic or eucaryotic

Which stage of glucose metabolism produces the most ATP? Fermentation of pyruvate to lactate Glycolysis Electron transport and chemiosmosis Krebs cycl

Electron transport and chemiosmosis

Vertebrates have two major communication and control systems: the endocrine system and the nervous system. Choose the correct statement describing the coordination of these systems.

Epinephrine functions as a hormone in the endocrine system and as a neurotransmitter in the nervous system.

Which of these is NOT a product of glycolysis? FADH2 ATP pyruvate NADH

FADH2

Carrier proteins and channel proteins are both involved in?

Facilitated diffusion

Imagine a human disorder that is inherited as a dominant, X-linked trait. How would the frequency of this disorder vary between males and females?

Females would display this disorder with greater frequency than males

Which process is not part of the cellular respiration pathway that produces large amounts of ATP in a cell? Krebs cycle Fermentation Electron transport chain Glycolysis

Fermentation

Which of the elements below has the greatest electronegativity. Hint electronegativity is a measure of the attraction an atom has for electrons. http://session.masteringbiology.com/problemAsset/1000215237/5/Periodic_table.jpg

Fluorine (F)

Which part of the eye contains the densest concentration of cone cells?

Fovea

How do cells acquire homologous chromosome pairs that carry the alleles that are independently assorted?

Fusion of gametes

http://session.masteringbiology.com/problemAsset/1000234384/4/Cell_Cycle.jpg Which stage of the cell cycle is represented by "D" in the figure?

Select the correct molecule that is the main product of the Calvin cycle. Glucose NADPH G3P

G3P

Which of these correctly illustrates the pairing of DNA and RNA nucleotides? GTTACG CAATCG GTTACG CAAUGC GTTACG GTTACG GTTACG ACCGTA GTTACG UAACAU

GTTACG CAAUGC

Which molecule is metabolized in a cell to produce energy for performing work?

Glucose

Based on your knowledge of cellular respiration, which is the correct ranking the following molecules from highest to lowest in terms of the amount of energy that they contain. Hint: think about the fact that all the reactions in cellular respiration are spontaneous.

Glucose, Pyruvic Acid , Acetyl-CoA, NADH + H+, ATP

Which step of the cellular respiration pathway can take place in the absence of oxygen? Fermentation Glycolysis Electron transport chain Krebs cycle

Glycolysis

In DNA which nitrogenous base would pair with cytosine?

Guanine

A compound that is secreted in one part of the body and travels through the bloodstream to another part of the body where it has an effect is called a(n)

Hormone

The oxidized form of FAD is reduced by adding

Hydrogen

Which of the following is most related to the cohesiveness of water molecules? High Specific Heat Hydrophobic Interactions Ionic Bonds Hydrogen Bonds Covalent Bonds

Hydrogen Bonds

Which of the following terms describes how a neuronal membrane's potential is altered in the presence of inhibitory signals? Depolarization. Polarization. Repolarization. Hyperpolarization.

Hyperpolarization

If a red blood cell is placed in a salt solution and bursts, what is the tonicity of the solution relative to the interior of the cell?

Hypotonic

http://session.masteringbiology.com/problemAsset/1000231789/4/Replication_Bubble.jpg Based on the figure below leading strand replication would occur at locations?

II and III

Which statement(s) about inducible operons is/are correct? Select all that apply. Inducible enzymes generally function in synthetic pathways that produce end products from raw materials. In an inducible operon, the repressor is synthesized in an active form. In an inducible operon, an inducer inactivates the repressor.

In an inducible operon, the repressor is synthesized in an active form. In an inducible operon, an inducer inactivates the repressor.

http://session.masteringbiology.com/problemAsset/1319025/5/Chap48_Q3.jpg What causes the falling phase of the action potential? Select the best answer.

Inactivation of voltage-gated sodium channels and the opening of voltage-gated potassium channels

The random distribution, which occurs as different pairs of homologous chromosomes move into different gametes demonstrates:

Independent assortment

What is the role of cAMP in the signal transduction pathway activated by epinephrine?

It binds to and activates protein kinase A, which then phosphorylates other enzymes.

A reaction involving an increase in Enthalpy and an increase in Entropy will always be? Spontaneous Non-Spontaneous It can be either depending on the exact values

It can be either depending on the exact values

Which of the following statements does not describe a vertebrate eye? It contains many light-sensing columns called ommatidia. It acquires images by focusing light on receptor cells. It contains photoreceptors that are either rod- or cone-shaped. It contains cells that are sensitive to either dim light or color

It contains many light-sensing columns called ommatidia.

What is the fate of the phosphate group that is removed when ATP is converted to ADP?

It is acquired by a reactant in an endergonic reaction.

What happens to RNA polymerase II after it has completed transcription of a gene?

It is free to bind to another promoter and begin transcription.

Which of the following is true of a target cell?

It must have a receptor for the chemical signal

The operon model of the regulation of gene expression in bacteria was proposed by _____.

Jacob and Monod

Resting neurons are most permeable to which of the following ions?

K+.

Which part of the eye bends light to focus it on the retina?

Lens

How can a lipid be distinguished from a sugar?

Lipids are mostly nonpolar.

White blood cells known as macrophages, consume and digest foreign cells. The organelle involved in digesting the foreign cells is?

Lysosme

What process is responsible for the independent assortment of alleles?

Meiosis

The plasma membrane of a neuron has voltage-gated sodium and potassium channels. What is the effect of membrane depolarization on these channels?

Membrane depolarization first opens sodium channels and then opens potassium channels.

Which term describes the difference in electrical charge across a membrane?

Membrane potential.

What distinguishes facilitated diffusion from simple diffusion?

Membrane proteins help move molecules across the membrane.

Replicated chromosomes can be found during which of the following stages of the cell cycle?

Metaphase

Beginning with a diploid cell homologous pairs of chromosomes can be found in a cell at the end of which of the following stages of meiosis

Metaphase I

In a respiring mitochondrion the lowest hydrogen ion concentration would be expected to be found in the:

Mitochondrial matrix

Which of the following organelles would be expected to contain DNA? Intermediate filament Mitochondrion Lysosome Peroxisome Flagellum

Mitochondrion

http://session.masteringbiology.com/problemAsset/1000240393/3/Neuron_Types.jpg Based on the figure the neurons at location "C" are:

Motor Neurons

Which of the following functions is NOT associated with the cytoskeleton in eukaryotic cells? the beating of cilia or flagella the contraction of muscle cells in animals determining the shape of animal cells maintaining the position of the nucleus in the cell Movement of RNA molecules from the nucleus to the cytoplasm

Movement of RNA molecules from the nucleus to the cytoplasm

Which structure is not part of a neuron?

Myelin sheath.

During electron transport, energy from _____ is used to pump hydrogen ions into the _____.

NADH and FADH2 ... intermembrane space

Which of the following statements about the electron transport chain is true? The electron transport chain is the first step in cellular respiration. NADH and FADH2 donate their electrons to the chain. Water is the last electron acceptor. Electrons gain energy as they move down the chain.

NADH and FADH2 donate their electrons to the chain.

Which of the following molecules is the primary product of photosystem I? ATP NADPH Carbon dioxide Oxygen

NADPH

A membrane depolarization is generally caused by:

Na+ flowing into the cell

An EPSP is caused by the movement of and results in __________.

Na+, depolarization

In the post-synaptic neuron with a resting potential of -70mV and a threshold of -50mV. Two EPSPs decrease the membrane potential by 15mV each and one IPSP increases the membrane potential by with a 15mV. Does this post-synaptic cell fire an action potential?

A molecule which is bound to a site other than the active site of an enzyme and causes a decrease in the rate of the reaction would be best described as a

Non-competitive inhibitor

In eukaryotes the mRNA must be processed prior to translation. Where does this mRNA processing occur?

Nucleus

Which mutation(s) would not change the remainder of the reading frame of a gene sequence that follows the mutation(s)? One addition and one deletion mutation. One addition mutation. One addition and two deletion mutations. One deletion mutation.

One addition and one deletion mutation.

DNA does not store the information to synthesize which of the following?

Organelles

The ultimate acceptor of all electrons flowing down the electron transport chain is:

Oxygen

Which of the following particles could diffuse easily through a cell membrane? Glucose Hydrogen ion (H+) Sodium ion (Na+) Oxygen (O2)

Oxygen (O2)

The initiator tRNA attaches at the ribosome's _____ site.

Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis?

Phosphate groups

_____ catalyzes the production of _____, which then opens an ion channel that releases _____ into the cell's cytoplasm.

Phospholipase C ... IP3 .... Ca2+

Which term describes ATP production resulting from the capture of light energy by chlorophyll? Substrate-level phosphorylation Photophosphorylation Dephosphorylation Oxidative phosphorylation

Photophosphorylation

Which process produces oxygen?

Photosynthesis

Which of the following events would cause the cell cycle to arrest? Poor nutrient conditions Complete chromosome replication Chromosomes lined up along the metaphase plate Synthesis of cyclins by growth factors and activation of a cyclin-Cdk complex

Poor nutrient conditions

The cleavage and modification of polypeptides after translation would be considered level gene regulation

Post-translational

Identify the correct statement(s) about the resting membrane potential of a cell. Select all that apply. Potassium (K+) and sodium (Na+) gradients are maintained by active transport in a resting mammalian neuron. Concentration gradients of potassium (K+) and sodium (Na+) across the plasma membrane represent potential energy. Neurons are the only cells that have a charge difference across their membranes.

Potassium (K+) and sodium (Na+) gradients are maintained by active transport in a resting mammalian neuron. Concentration gradients of potassium (K+) and sodium (Na+) across the plasma membrane represent potential energy

Which channel is mainly responsible for the resting potential of a neuron?

Potassium leak channel.

The sequence of amino acids in a polypeptide chain is considered to be part of the structure? Primary Secondary Tertiary Quaternary Quinquinary

Primary

Which of the following enzymes creates a primer for DNA polymerase? Helicase Topoisomerase Ligase Primase

Primase

Which of the following statements about DNA synthesis is true? Nucleotides are added in a random fashion to single-stranded DNA. As DNA polymerase moves along the template strand, each new nucleotide provides a 5' hydroxyl group for the next reaction to occur. DNA polymerase adds dNTP monomers in the 3' to 5' direction. Primers are short sequences that allow the initiation of DNA synthesis.

Primers are short sequences that allow the initiation of DNA synthesis.

A procaryotic operon consists of:

Promoter, Operator and Structural Genes

http://session.masteringbiology.com/problemAsset/1000234380/3/Mitosis_Figure.jpg Which stage of cell division is represented in the figure.

Prophase

http://session.masteringbiology.com/problemAsset/1000234612/3/Meiosis.jpg Which stage of cell division is represented in the figure. Be sure to pay attention to whether the choices are mitosis or meiosis.

Prophase I

Which one of the following statements about the endomembrane system is correct? Most of the phospholipids of the endomembrane system are synthesized in the mitochondria. The endoplasmic reticulum is continuous with the plasma membrane. Mitochondria function in the modification and sorting of lipids and proteins. Proteins that will be secreted from the cell are likely to be found in closed spaces bounded by membranes of the endomembrane system. Ribosomes move lipids and proteins among the different organelles of the endomembrane system.

Proteins that will be secreted from the cell are likely to be found in closed spaces bounded by membranes of the endomembrane system.

The rough ER is the site of the production of:

Proteins to be exported from the cell

According to the chemiosmotic hypothesis, what provides the energy that directly drives ATP synthesis?

Proton gradient

Which of the following particles can pass through the ATP synthase channel? ATP Protons Inorganic phosphate ADP

Protons

Which part of the eye is the opening through which light initially passes?

Pupil

http://media.pearsoncmg.com/bc/bc_campbell_biology_8/img/activities_quizzes/1825q.swf In this animation the orange object represents _____.

RNA polymerase

http://session.masteringbiology.com/problemAsset/1100612/4/Part_ABC.jpg n the diagram below, the gray unit represents _____.

RNA polymerase

The synthesis of a new strand begins with the synthesis of a(n) _____.

RNA primer complementary to a preexisting DNA strand

What is the function of a spliceosome?

RNA processing

Which molecules determine the tissue specificity of hormones?

Receptors

Which of the following reactions ensures that the Calvin cycle can make a continuous supply of glucose? Carbon fixation Regneration of RuBP Production of 3-phosphoglycerate Production of G3P

Regneration of RuBP

Measurements of the amount of DNA per nucleus were taken on a large number of cells from a growing fungus. The measured DNA levels ranged from 3 to 6 picograms per nucleus. One nucleus had 4 picograms of DNA. What phase of the cell cycle was this nucleus most likely in?

The copying of chromosomes occurs during which of the following phases of the cell cycle?

S phase

What type of cell makes up the myelin sheath of a motor neuron?

Schwann cells

In Anaphase I of meiosis which of the following structures is moving on the spindle towards the poles? Think about the structure/s moving toward a single pole of the spindle.

Single Replicated Chromosomes

How is an action potential propagated down an axon after voltage-gated sodium channels open in a region of the neuron's membrane?

Sodium ions enter the neuron and diffuse to adjacent areas, resulting in the opening of voltage-gated sodium channels farther down the axon.

Which of the following transporters does not use passive transport to move molecules across a membrane? Valinomycin Gramicidin ion channel Sodium-potassium pump GLUT-1 glucose transporter

Sodium-potassium pump

Select the correct statement about feedback regulation in endocrine systems.

Some homeostatic control systems rely on pairs of negatively regulated hormone pathways, each counterbalancing the other.

Which type of hormone is lipid soluble?

Steroids

The Calvin Cycle occurs in the

Stroma

Gregor Mendel set up a dihybrid cross with one pea plant from the parental generation (P) producing round yellow peas and the other pea plant producing wrinkled green peas. The F2 generation included 315 plants producing round yellow peas, 108 with round green peas, 101 with wrinkled yellow peas, and 32 with wrinkled green peas. How would these results have differed if pea shape and pea color had been linked genes, located close together on the same chromosome?

The F2 generation would have included a higher percentage of pea plants producing round, yellow peas.

http://session.masteringbiology.com/problemAsset/1311134/5/Chap09_Q2.jpg In cellular respiration, a series of molecules forming an electron transport chain alternately accepts and then donates electrons. What is the advantage of such an electron transport chain?

The advantage of an electron transport chain is that a small amount of energy is released with the transfer of an electron between each pair of intermediates.

Which of these descriptions of the behavior of chromosomes during meiosis explains Mendel's law of independent assortment?

The arrangement of each pair of homologous chromosomes on the metaphase plate during metaphase I is random with respect to the arrangements of other pairs.

dentify all correct statements about the basic function of fermentation. Select all that apply. The basic function of fermentation is the production of ethyl alcohol or lactic acid. The basic function of fermentation is the production of additional ATP by further oxidation of the products of glycolysis. The basic function of fermentation is the regeneration of NAD+, which allows continued ATP production by glycolysis.

The basic function of fermentation is the regeneration of NAD+, which allows continued ATP production by glycolysis.

http://session.masteringbiology.com/problemAsset/1300635/5/Chap10_Q3.jpg Select the most accurate statement describing the basic function of the light reactions of photosynthesis. The basic function of the light reactions of photosynthesis is the trapping of light energy. The basic function of the light reactions of photosynthesis is the conversion of solar energy to chemical energy. The basic function of the light reactions of photosynthesis is the production of glucose

The basic function of the light reactions of photosynthesis is the conversion of solar energy to chemical energy.

Which of the following is an example of a hydrogen bond? The bond between Mg and Cl in MgCl2 The bond between the H of one water molecule and the O of another water molecule The bond between C and H in methane (CH4) The bond between Na and Cl in salt The bond between two hydrogen atoms (H2)

The bond between the H of one water molecule and the O of another water molecule

For the first several divisions of early frog embryos, cells proceed directly from the M phase to the S phase and back to M without gaps. Which of the following is likely to be true about dividing cells in early frog embryos?

The cells get smaller with each generation.

Which of the following statements is true about the net movement of an ion across a membrane by passive diffusion through a membrane channel? The cell expends energy as the ion passes through the membrane. For every ion that diffuses through the membrane, a different ion diffuses in the opposite direction. The charge on the other side of the membrane is generally the opposite of the ion's charge. There is a higher concentration of ions on the side of the membrane toward which the ion diffuses.

The charge on the other side of the membrane is generally the opposite of the ion's charge.

Which of the following statements accurately describes the function of a metabolic pathway involved in cellular respiration? The function of the citric acid cycle is the transfer of electrons from pyruvate to NADH to O2. The function of glycolysis is to begin catabolism by breaking glucose into two molecules of pyruvate, with a net yield of two ATP. The function of the bonding of acetic acid to the carrier molecule CoA to form acetyl CoA is the reduction of glucose to acetyl CoA

The function of glycolysis is to begin catabolism by breaking glucose into two molecules of pyruvate, with a net yield of two ATP.

Which of the following is true of an X-linked gene, but not of a Y-linked gene?

The gene is present in both males and females.

Which set of reactions uses H2O and produces O2? The light-dependent reactions The light-independent reactions

The light-dependent reactions

Which of the following statements best describes the relationship between the light-dependent and light-independent reactions of photosynthesis? The light-dependent reactions pass electrons through an electron transport chain to the light-independent reactions. The light-dependent reactions produce carbon dioxide, which is then used by the light-independent reactions. The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions. The light-independent reactions release energy, and the light-dependent reactions require energy

The light-dependent reactions produce ATP and NADPH, which are then used by the light-independent reactions.

What is the importance of the light-independent reactions in terms of carbon flow in the biosphere?

The light-independent reactions turn CO2, a gas, into usable carbon in the form of sugars.

In humans, what determines the sex of offspring and why?

The male gamete determines sex because each male gamete can contribute either an X or a Y chromosome.

Which event triggers the creation of an action potential?

The membrane depolarizes above a certain threshold potential.

In a normal cell which of the following statements is correct The concentration of K+ outside the cell is greater than inside The membrane potential is negative The concentration of negative ions is greater outside than inside The concentration of Na+ inside the cell is greater than outside

The membrane potential is negative

Which of the following is usually NOT true about active transport? The movement of material requires cellular energy. The movement of material is from a lower concentration to a higher concentration. The molecules being moved can cross the phospholipid bilayer easily. The process of phagocytosis is not a form of active transport.

The molecules being moved can cross the phospholipid bilayer easily.

Which statement correctly describes the nuclear envelope of a eukaryotic cell? The nuclear envelope is a single membrane, consisting of a phospholipid bilayer. Plasmadesmosomes in the nuclear envelope permit the exchange of macromolecules between the nucleus and the cytoplasm. All of the proteins of the cell are synthesized on ribosomes bound on the nuclear envelope. The nuclear envelope is continuous with the endoplasmic reticulum. The outer layer of the nuclear envelope is coated with laminin.

The nuclear envelope is continuous with the endoplasmic reticulum.

Which of the following factors does not affect membrane permeability? The polarity of membrane phospholipids The amount of cholesterol in the membrane Temperature The saturation of hydrocarbon tails in membrane phospholipids

The polarity of membrane phospholipids

Which of the following statements best describes the promoter of a protein-coding gene? The promoter is a nontranscribed region of a gene. The promoter is part of the RNA molecule itself. The promoter is a site at which only RNA polymerase will bind. The promoter is a site found on RNA polymerase.

The promoter is a nontranscribed region of a gene.

Which of the following statements about photoreception is true? The retinal molecule changes shape when it absorbs light. Rod cells are responsible for color vision. Rhodopsin is found in cone cells. Cone cells are sensitive to dim light

The retinal molecule changes shape when it absorbs light.

What behavior is observed if the voltage across a neuronal membrane is set to -20 mV?

The sodium channel opens, and Na+ ions flow in.

Which channel maintains the concentration gradients of ions across a neuronal membrane?

The sodium-potassium pump moving Na+ ions out and K+ ions in.

http://session.masteringbiology.com/problemAsset/1100492/3/0319q.jpg How does the pH of the solution on the right compare with that of the solution on the left?

The solution on the right is basic relative to the solution on the left.

Which of the following is a function of the S phase in the cell cycle?

The synthesis of sister chromatids

Which of these descriptions of the behavior of chromosomes during meiosis explains Mendel's law of segregation?

The two alleles for each gene separate as homologous chromosomes move apart during anaphase I.

http://session.masteringbiology.com/problemAsset/1311177/6/Chap13_Q4.jpg This chromosome has two chromatids, joined at the centromere. What process led to the formation of the two chromatids?

The two chromatids were formed by duplication of a chromosome.

The solutions in the two arms of this U-tube are separated by a membrane that is permeable to water and glucose but not to sucrose. Side A is filled with a solution of 1 M sucrose and 1 M glucose. Side B is filled with 1 M sucrose and 2 M glucose. After the system reaches equilibrium, what changes are observed?

The water level is unchanged

Which of these refers to atoms with the same atomic number but different atomic masses?

These atoms are isotopes.

Which of the following statements about lipid-soluble hormones is true?

They act by affecting the transcription of genes.

Which of the following statements about Okazaki fragments in E. coli is true? They are synthesized in the 3' to 5' direction. They are formed on the lagging strand of DNA. They are usually 50 to 500 bases long. They are sealed together by the action of helicase.

They are formed on the lagging strand of DNA.

Which of the following statements about action potentials in a given neuron is false? They are identical in magnitude. They are propagated down the length of the dendrite. They are identical in duration. They occur after the threshold potential is reached

They are propagated down the length of the dendrite.

What is the biological significance of the light-independent reactions of photosynthesis?

They convert carbon dioxide to sugar.

Over the course of one week you measure the amount of Carbon in the food consumed and absorbed by a person. You also measure the amount of Carbon in the CO2 that they exhale. During this time period the person loses 1.5 kgs of mass. Based on this you would expect.

They exhaled more Carbon than they consumed/absorbed.

Which of the following is TRUE concerning unsaturated fatty acids? Their chains are usually straight. They are usually solid at room temperature. They have a lower ratio of Hydrogen to Carbon than saturated fatty acids. They have no double bonds between the carbon atoms of the fatty acids.

They have a lower ratio of Hydrogen to Carbon than saturated fatty acids

http://session.masteringbiology.com/problemAsset/1311096/5/Chap13_Q2.jpg Look at the cell in the figure. Based on this figure, which of the following statements is true? This cell is haploid. This cell is diploid. It is impossible to tell whether the cell is haploid or diploid.

This cell is diploid.

Which of the following enzymes is important for relieving the tension in a helix as it unwinds during DNA synthesis? Ligase Topoisomerase Helicase Single-stranded binding proteins

Topoisomerase

Procaryotic genes are generally regulated by preventing

Transcription

What is the process called that converts the genetic information stored in DNA to an RNA copy?

Transcription

Which membrane protein would be used to move glucose across a membrane from a region of higher concentration to a region of lower concentration?

Transporter

If the sequence ATGCATGTCAATTGA were mutated such that a base were inserted after the first G and the third T were deleted, how many amino acids would be changed in the mutant protein?

Two

http://session.masteringbiology.com/problemAsset/1000215319/4/Functional_Groups.jpg Which of the highlighted functional groups represents an amino group

Which of the following is a structure that allows hormone-receptor complexes to bind to specific DNA sequences?

Zinc finger.

During RNA processing a(n) _____ is added to the 3' end of the RNA.

a long string of adenine nucleotides

http://media.pearsoncmg.com/bc/bc_campbell_biology_8/img/activities_quizzes/0216q.swf What is the result of the animated process?

a positively charged sodium ion and a negatively charged chlorine ion

Which of these is exhibiting kinetic energy? a rock on a mountain ledge the high-energy phosphate bonds of a molecule of ATP an archer with a flexed bow a person sitting on a couch while watching TV a space station orbiting Earth

a space station orbiting Earth

The Oxygen consumed during cellular respiration is directly involved in:

accepting electrons at the end of the Electron Transport Chain

Which of these enters the citric acid cycle? pyruvate glucose G3P acetyl CoA NADH + H+

acetyl CoA

Which of these is NOT a product of the citric acid cycle? acetyl CoA FADH2 CO2 ATP NADH + H+

acetyl CoA

The thin filaments of sarcomeres are composed of _____.

actin

If the concentration of phosphate in the cytosol is 2.0 mM and the concentration of phosphate in the surrounding fluid is 0.1 mM, how could the cell increase the concentration of phosphate in the cytosol?

active transport

How can one increase the rate of a chemical reaction?

add a catalyst

Active transport moves molecules ____________ their concentration gradients and ____________ energy

against, uses

In a cross between a true breeding red flowered rose and a true breeding white flowered rose what is the expected phenotypic ratio of the offspring? Assume red flowered is completely dominant.

all red flowered

Proteins are polymers of _____.

amino acids

What enzyme catalyzes the attachment of an amino acid to tRNA?

aminoacyl-tRNA synthetase

A protein kinase activating many other protein kinases is an example of _____.

amplification

Which of these causes the release of neurotransmitter molecules?

an action potential reaching the end of the axon

The smallest unit of an element that retains all of the properties of that element is

an atom

An ionic bond involves _____.

an attraction between ions of opposite charge

Centromeres divide and sister chromatids become full-fledged chromosomes during _____.

anaphase

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698952# This animation illustrates the events of _____.

anaphase

Homologous chromosomes migrate to opposite poles during _____.

anaphase I

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates the events of _____.

anaphase I

During _____ sister chromatids separate.

anaphase II

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates the events of _____.

anaphase II

Many of water's emergent properties, such as its cohesion, its high specific heat, and its high heat of vaporization, result from the fact that water molecules _____.

are attracted to each other by partial negative and positive charges on the oxygen and hydrogen atoms, respectively

Atoms with the same number of protons but with different electrical charges _____.

are different ions

A function of cholesterol that does not harm health is its role _____.

as a component of animal cell membranes

http://media.pearsoncmg.com/bc/bc_campbell_biology_7/media/interactivemedia/activities/load.html?13&A What name is given to this process?

asexual reproduction

A nerve impulse moves away from a neuron's cell body along _____.

axons

If the membrane potential of a neuron decreases, the membrane potential _____.

becomes more positive.

Post-synaptic cells respond to neurotransmitters through the neurotransmitter:

binding to a receptor

In an inducible operon the repressor (alone) ______________ the operator and ____________ transcription.

binds to, blocks

If muscles can only shorten when stimulated how is it possible for you to move your limbs in at least two directions (flexed and extended):

by using pairs of muscles working in opposition to one another

The release of _____ ions from the sarcoplasmic reticulum is required for skeletal muscle contraction.

calcium

a simple sugar is composed of equal parts carbon and water, which gave rise to the general name of any sugar as a ____________.

carbohydrate

The large diversity of shapes of biological molecules is possible because of the extensive presence of _____ in the molecules.

carbon

About 25 of the 92 natural elements are known to be essential to life. Which four of these 25 elements make up approximately 96% of living matter?

carbon, hydrogen, nitrogen, oxygen

Citric acid makes lemons taste sour. Which of the following is a functional group that would cause a molecule such as citric acid to be acidic?

carboxyl

Which of the following functional groups is acidic? carbonyl ketone methyl carboxyl aldehyde

carboxyl

A neuron's nucleus is located in its _____.

cell body

In your body, what process converts the chemical energy found in glucose into the chemical energy found in ATP?

cellular respiration

Which of the following correctly matches an organelle with its function? nucleus ... cellular respiration lysosome ... movement central vacuole ... storage ribosome ... manufacture of lipids mitochondrion ... photosynthesis

central vacuole ... storage

The movement of glucose into a cell against a concentration gradient is most likely to be accomplished by which of the following? cotransport of the glucose with a proton or sodium ion that was pumped across the membrane using the energy of ATP hydrolysis receptor-mediated endocytosis facilitated diffusion of the glucose using a carrier protein movement of glucose into the cell through a glucose channel passive diffusion of the glucose through the lipid bilayer

cotransport of the glucose with a proton or sodium ion that was pumped across the membrane using the energy of ATP hydrolysis

http://session.masteringbiology.com/problemAsset/1100485/2/0208q.jpg What type of bond is joining the two hydrogen atoms?

covalent

http://session.masteringbiology.com/myct/itemView?offset=next&assignmentProblemID=45698966# This animation illustrates the process of _____.

crossing over

Which of these acts as a second messenger?

cyclic AMP

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698952# This animation illustrates the events of _____.

cytokinesis as it occurs in animal cells

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698952# This animation illustrates the events of ____

cytokinesis as it occurs in plant cells

Translation occurs in the _____.

cytoplasm

During sensory adaptation your response to a stimulus

decreases

http://session.masteringbiology.com/myct/itemView?offset=next&assignmentProblemID=45698821# What name is given to the process seen in this animation? To view the animation, click here. Then click on the image to start the animation.

dehydration synthesis

A nerve impulse moves toward a neuron's cell body along _____.

dendrites

The portion of a neuron that transmits membrane potentials to the cell body is usually the:

dendrites

lactose, the sugar in milk, is a __________ , because it can be split into two monosaccharides

disaccharide

http://session.masteringbiology.com/problemAsset/1100485/2/0211q.jpg A(n) _____ bond joins these two oxygen atoms. (four electrons bonding)

double covalent

After DNA replication is completed, _____.

each new DNA double helix consists of one old DNA strand and one new DNA strand

A covalent chemical bond is one in which:

electrons are shared equally by two atoms

A substance that cannot be broken down into other substances by ordinary chemical procedures is a(n) _____.

element

The reaction ADP + P --> ATP is a(n) _____ reaction.

endergonic

Which of these reactions requires a net input of energy from its surroundings?

endergonic

http://session.masteringbiology.com/problemAsset/1100518/4/0817q.jpg This graph illustrates a(n) _____ reaction.

endergonic

Calcium ions that act as second messengers are stored in _____.

endoplasmic reticula

"Conservation of energy" refers to the fact that _____.

energy cannot be created or destroyed but can be converted from one form to another

http://session.masteringbiology.com/problemAsset/1100519/3/0825q.jpg What is the correct label for "A"?

energy of activation

A(n) _____ reaction occurs spontaneously.

exergonic

The energy for an endergonic reaction comes from a(n) _____ reaction.

exergonic

The following reaction A --> B + C + heat is a(n) _____ reaction.

exergonic

Select the INCORRECT association kinetic energy ... motion exergonic ... uphill enzyme ... protein potential energy ... positional energy exergonic ... spontaneous

exergonic ... uphill

The RNA segments joined to one another by spliceosomes are _____.

exons

false

Answer the following three questions using the information below. You increase the [OH-] in a solution by a factor of 10,000. The pOH will incresase.

false

Based on the observations of the chemical reaction in the question above indicate whether the following statement is true or false. The products would be contain less heat energy than the reactant.

false

Based on the observations of the chemical reaction in the question above indicate whether the following statement is true or false. This reaction will be spontaneous.

false

The amount of ATP produced via substrate level phosphorylation would be expected to increase.

false

The hydrogen ion concentration in the space between the mitochondrial membranes would be expected to increase.

false

True or False, an atom with more neutrons than the atom described in the question above will have a different valence.

false

True or false? A codon is a group of three bases that can specify more than one amino acid.

false

True or false? Action potentials travel in only one direction down an axon because potassium channels in the neuron are refractory and cannot be activated for a short time after they open and close.

false

True or false? Active transport differs from passive transport in that active transport does not require an input of energy.

false

True or false? Cone cells are color photoreceptors that use different retinal molecules to absorb different wavelengths of light.

false

True or false? During active transport through the sodium-potassium pump, ATP hydrolysis provides the energy to pump three sodium ions into the cell for every two potassium ions pumped out of the cell.

false

True or false? For a signal transduction pathway to be activated, hormones must be present in the bloodstream at very high concentrations.

false

True or false? Lipid-insoluble hormones affect their target cells by binding to receptors inside the cell.

false

True or false? The M phase is characterized by the replication and division of a cell's chromosomes.

false

True or false? The chemiosmotic hypothesis states that the synthesis of ATP generates a proton gradient that leads to electron flow through an electron transport chain.

false

True or false? The potential energy of a membrane potential comes solely from the difference in electrical charge across the membrane.

false

True or false? The principle of independent assortment is best illustrated by events that take place during metaphase II, during which sister chromatids segregate independently of each other.

false

True or false? The region of ATP synthase that catalyzes the production of ATP from ADP and inorganic phosphate spans the chloroplast membrane.

false

http://session.masteringbiology.com/problemAsset/1000226914/11/Osmosis_Table.jpg If the dialysis tubing segment containing solution A was placed in a sucrose solution whose concentration was equal to that of solution B the net movement of water would be out of the dialysis tubing segment.

false

http://session.masteringbiology.com/problemAsset/1000226914/11/Osmosis_Table.jpg The free energy of the water molecules in solution B is greater than the free energy of the water molecules in the sucrose solution.

false

http://session.masteringbiology.com/problemAsset/1000232904/9/Gentic_Code_2.jpg Using the table below is the following statement True or False. The mutated DNA will produce an identical amino acid sequence compared to the original DNA.

false

http://session.masteringbiology.com/problemAsset/1000237040/7/Pedigree.jpg Based on the pedigree shown below the allele for this disorder is recessive.

false

http://session.masteringbiology.com/problemAsset/1000237040/7/Pedigree.jpg Based on the question above individual number 1 is homozygous

false

http://session.masteringbiology.com/problemAsset/1000241296/9/Eye.jpg Based on the figure above is the following statement true or false? The amacrine cells are responsible for amplifying the stimulus energy

false

http://session.masteringbiology.com/problemAsset/1000241301/5/sarcomere.jpg Based on the figure below is the following statement true or false? The "A Band represents the length of the thin filaments

false

Meiosis II typically produces _____ cells, each of which is _____.

four ... haploid

gametes: 1/2 B and 1/2 b (heterozygous parent) and b; offspring: 1/2 Bb and 1/2 bb

gametes: B and b; offspring: all Bb

http://session.masteringbiology.com/problemAsset/1100521/2/0905q.jpg What process occurs in Box A?

glycolysis

http://session.masteringbiology.com/problemAsset/1100509/2/0703q.jpg Identify Structure A.

glycoprotein

Integral proteins (those embedded in the membrane) would be expected to:

have hydrophobic regions

http://session.masteringbiology.com/problemAsset/1100518/4/0809q.jpg In this reaction _____. the kinetic energy of the reactants is less than that of the products entropy has decreased disorder has decreased heat has been released to the environment the chemical energy of the products is greater than that of the reactants

heat has been released to the environment

Which of these are by-products of cellular respiration?

heat, carbon dioxide, and water

The first step in the replication of DNA is catalyzed by _____.

helicase

Because organisms are made primarily of water, they resist rapid temperature changes. This useful quality is based on water's _____.

high specific heat

What can we observe in order to visualize Mendel's Law of Segregation?

homologous chromosomes separating during meiosis I

Which of these is a phospholipid?

http://session.masteringbiology.com/problemAsset/1100498/3/0509a5.jpg

Which of these illustrates the secondary structure of a protein?

http://session.masteringbiology.com/problemAsset/1100500/4/0519a5.jpg

Which of these is ATP?

http://session.masteringbiology.com/problemAsset/1100517/2/0806a3.jpg

What name is given to the bond between water molecules?

hydrogen

http://session.masteringbiology.com/problemAsset/1100488/2/0218q.jpg The brackets are indicating a(n) _____ bond.

hydrogen

The secondary structure of a protein results from _____.

hydrogen bonds

The two strands of a DNA double helix are held together by _____ that form between pairs of nitrogenous bases.

hydrogen bonds

http://session.masteringbiology.com/problemAsset/1100492/3/0316q.jpg What is the arrow pointing to?

hydrogen ion

In a neutral solution the concentration of _____.

hydrogen ions is equal to the concentration of hydroxide ions

What type of reaction breaks the bonds that join the phosphate groups in an ATP molecule?

hydrolysis

http://session.masteringbiology.com/problemAsset/1100492/3/0317q.jpg What is the arrow pointing to?

hydroxide ion

What is the most common (numerous) functional group on most monosaccharides?

hydroxyl

An acid is a substance that _____.

increases the hydrogen ion concentration of an aqueous solution

http://session.masteringbiology.com/problemAsset/1100614/4/Part_D_translation.jpg What is the name of the process shown in the diagram?

initiation (of translation)

The electron transport chain is part of the

inner mitochnodrial membrane

During _____ the cell grows and replicates both its organelles and its chromosomes.

interphase

Nucleoli are present during _____.

interphase

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates _____.

interphase

During the editing of the initial transcript in a eukaryote what is removed from the sequence?

introns

In salt, what is the nature of the bond between sodium and chlorine?

ionic

An enzyme _____

is an organic catalyst

As a result of its involvement in a reaction, an enzyme _____

is unchanged

The somatic division

is under conscious control

The proximate (immediate) source of energy for oxidative phosphorylation is _____.

kinetic energy that is released as hydrogen ions diffuse down their concentration gradient

In muscle cells, fermentation produces _____.

lactate and NAD+

http://media.pearsoncmg.com/bc/bc_campbell_biology_8/img/activities_quizzes/1825q.swf Click on the diagram to start the animation. In this animation the blue sphere represents _____.

lactose

A single neuron can synapse with other neurons

many

Human gametes are produced by _____.

meiosis

http://session.masteringbiology.com/problemAsset/1000231866/4/Genetic_Code.jpg Part of the coding region for a piece of DNA is shown below 5' CTAGGGCAT what is the correct sequence of amino acids produced by this DNA? The choices are listed beginning with the first amino acid added to the polypeptide.

met-pro

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698952# This animation illustrates the events of _____.

metaphase

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates the events of _____.

metaphase I

During _____ chromosomes align single file along the equator of a haploid cell.

metaphase II

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates the events of _____.

metaphase II

Which of the following functional groups is non-polar? Hydroxyl Carboxyl Methyl Carbonyl Dehydroxyl

methyl

During RNA processing a(n) _____ is added to the 5' end of the RNA.

modified guanine nucleotide

A(n) _____ refers to two or more atoms held together by covalent bonds.

molecule

a _____________ cannot be hydrolyzed any further

monosaccharide

A single muscle cell is referred to as a _____.

muscle fiber

Axons insulated by a(n) _____ are able to conduct impulses faster that those not so insulated.

myelin sheath

The thick filaments of sarcomeres are composed of _____.

myosin

Hydrogen bonds must be broken during the process of DNA replication. These bonds occur between?

nitrogenous bases

Using this same model will cells A release more compound 1 if the levels of compound 3 increase, (Yes or No)

An impulse relayed along a myelinated axon "jumps" from _____ to _____.

node of Ranvier ... node of Ranvier

In the presence of a regulatory protein the lac operon is _____.

not transcribed

Which of the groups of organic molecules below would be expected to contain Nitrogen? none of the above steroids fatty acids carbohydrates nucleic acids

nucleic acids

A nitrogenous base, a phosphate group, and a five-carbon sugar are the three components of a(an)

nucleotide

http://session.masteringbiology.com/problemAsset/1100552/3/1608q.jpg This is an image of a(n) _____

nucleotide

The building blocks or monomers of nucleic acid molecules are called _____.

nucleotides

Which of these is rich in unsaturated fats? olive oil butter lard a fat that is solid at room temperature beef fat

olive oil

A hydrophobic amino acid R group (side group) would be found where in a protein?

on the inside of the folded chain, away from water

In cellular respiration, most ATP molecules are produced by _____.

oxidative phosphorylation

The final electron acceptor of cellular respiration is _____.

oxygen

http://session.masteringbiology.com/problemAsset/1100521/2/0907q.jpg What molecule is indicated by the letter D?

oxygen

What type of bond joins the monomers in a protein's primary structure?

peptide

Tertiary structure is NOT directly dependent on _____.

peptide bonds

What functional group is commonly used in cells to transfer energy from one organic molecule to another?

phosphate

http://session.masteringbiology.com/problemAsset/1100552/3/1609q.jpg The letter A indicates a _____.

phosphate group

A nucleotide is composed of a(n) _____.

phosphate group, a nitrogen-containing base, and a five-carbon sugar

A molecule characterized by a hydrophilic head group and two hydrophobic tails is a(an)

phospholipid

http://session.masteringbiology.com/problemAsset/1100509/2/0702q.jpg Identify Structure D

phospholipid bilayer of membrane

The most abundant lipids in most membranes are

phospholipids

a carbohydrate the yields many monosaccharides when hydrolyzed is a __________.

polysaccharide

Chemical energy is a form of _____ energy.

potential

Spindle fibers attach to kinetochores during _____.

prometaphase

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698952# This animation illustrates the events of _____.

prometaphase

Chromosomes become visible during _____.

prophase

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698952# This animation illustrates the events of _____.

prophase

Synapsis occurs during _____.

prophase I

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This is an animation of ______

prophase I

During _____ a spindle forms in a haploid cell.

prophase II

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates the events of _____

prophase II

Enzyme complexes that break down protein are called _____.

proteasomes

Translation uses the information in mRNA to guide the synthesis of

protein

Protein-phosphorylating enzymes' role in the regulation of gene expression involves _____.

protein activation

http://session.masteringbiology.com/problemAsset/1100616/5/1805q.jpg The letter E is indicating a process of gene expression that involves _____.

protein breakdown

In general, enzymes are what kinds of molecules?

proteins

The four main categories of large biological molecules present in living systems are _____.

proteins, nucleic acids, polysaccharides, and lipids

Which of the following subatomic particles always has a positive charge?

proton

Changing the number of _____ would change an atom into an atom of a different element.

protons in an atom

In fermentation _____ is reduced and _____ is oxidized.

pyruvate ... NADH

Enzymes work by _____.

reducing EA

The nuclear membrane's role in the regulation of gene expression involves _____.

regulating the transport of mRNA to the cytoplasm

Which of these is NOT a component of the lac operon?

regulatory gene only

During anaphase I of meiosis a cell would contain ______________ chromosomes and ___________ pairs.

replicated, homologous

The action of helicase creates _____.

replication forks and replication bubbles

Many eucarytoic organelles are connected via a flow of membrane. Which of the organelles listed below is not part of this membrane flow? ribosome golgi complex nucleus ER lysosome

ribosome

http://session.masteringbiology.com/problemAsset/1100498/3/Activity_Lipids_Quiz_Part_B_Art.jpg This figure is an example of a(n) _____.

saturated fat

Some regions of a polypeptide may coil or fold back on themselves. This is called _____, and the coils or folds are held in place by _____

secondary structure ... hydrogen bonds

A signal transduction pathway is initiated when a _____ binds to a receptor.

signal molecule

http://session.masteringbiology.com/problemAsset/1100486/2/0213q.jpg What type of bond joins the carbon atom to each of the hydrogen atoms?

single (nonpolar) covalent

Spliceosomes are composed of _____.

snRNPs and other proteins

http://session.masteringbiology.com/problemAsset/1100509/2/0701q.jpg What is the function of Structure E?

stabilization of the phospholipids

A lipid molecule with four fused carbon rings is a

steroid

What name is given to the reactants in an enzymatically catalyzed reaction?

substrate

In glycolysis, ATP molecules are produced by _____.

substrate-level phosphorylation

In the citric acid cycle, ATP molecules are produced by _____

substrate-level phosphorylation

http://session.masteringbiology.com/problemAsset/1100552/3/1611q.jpg You can tell that this is an image of a DNA nucleotide and not an RNA nucleotide because you see a _____.

sugar with two, and not three, oxygen atoms

The backbone of a DNA strand is composed of

sugar-phosphate bonds

The space between an axon of one neuron and the dendrite of another neuron is called a(n) _____.

synaptic cleft

What part of a neuron relays signals from one neuron to another neuron or to an effector?

synaptic terminal

Neurons store neurotransmitter molecules in vesicles located within _____.

synaptic terminals

Cytokinesis often, but not always, accompanies _____.

telophase

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698952# his animation illustrates the events of _____.

telophase

At the end of _____ and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids.

telophase I

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates the events of _____.

telophase I and cytokinesis

At the end of _____ and cytokinesis there are four haploid cells.

telophase II

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45698963# This animation illustrates the events of _____

telophase II and cytokinesis

An old DNA strand is used as a _____ for the assembly of a new DNA strand.

template

The Central nervous System (CNS) consists of:

the brain and spinal cord

http://session.masteringbiology.com/problemAsset/1100521/2/0906q.jpg What process occurs within Box B?

the citric acid cycle

In an inducible operon, in the presence of ________________, the structural genes will be transcribed.

the inducer

During _____ both the contents of the nucleus and the cytoplasm are divided.

the mitotic phase

During the course of muscle contraction the potential energy stored in ATP is transferred to potential energy stored in _____.

the myosin head

Regulatory proteins bind to _____.

the operator

Variations in the reactive properties of different organic molecules are most closely associated with _____.

the presence or absence of functional groups

http://session.masteringbiology.com/problemAsset/1100518/4/0808q.jpg In this reaction _____. the products have less potential energy than the reactants CD is a product the products have been rearranged to form reactants entropy has decreased AC is a reactant

the products have less potential energy than the reactants

http://session.masteringbiology.com/problemAsset/1100612/4/Part_ABC.jpg In the diagram below, the green unit represents _____.

the promoter

Of these events, the first to occur when a motor neuron stops sending an impulse to a muscle is _____.

the pumping of calcium ions out of the cytoplasm and back into the sarcoplasmic reticulum

A cell in Anaphase I of meiosis would contain ____________ number of chromosomes and ___________ amount of DNA compared to the same cell when it was in G2.

the same, the same

Protein signal molecules are not permeable to the cell membrane but can affect their target cells because

the target cells have cell membrane bound receptors specific to the signal molecule.

What is energy coupling?

the use of energy released from an exergonic reaction to drive an endergonic reaction

Myosin heads bind to _____, which they then pull and cause to slide toward the center of the sarcomere.

thin filaments

Which of these nitrogenous bases is found in DNA but not in RNA? thymine adenine guanine uracil cytosine

thymine

In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.

thymine ... cytosine

http://session.masteringbiology.com/myct/itemView?assignmentProblemID=45699025# In this animation, which of the following, when activated by a signal transduction pathway, moved from the cytoplasm to the nucleus of a cell?

transcription factor

http://media.pearsoncmg.com/bc/bc_campbell_biology_7/media/interactivemedia/activities/load.html?7&B Structure A in this animation is a(n) _____. To view the animation, click here. Then click on structure A in the image to start the animation

transport protein

true

A researcher isolates a chloroplast and decreases the pH inside the individual thylakoids. Assuming that there is abundant light energy and CO2 and that there are no other changes to this chloroplast indicate whether the following statement if True or False. Based on the preceding two questions indicate whether the following statement is True or False. If the researcher also increased the concentration of NADPH +H+ in the stroma of the experimental chloroplast, but not the control, the experimental chloroplast would produce more G3P or glucose.

true

Below you will find a DNA sequence and the amino acid sequence that it produces. There is also a nucleotide sequence containing a mutation in the DNA. Amino Acid Sequence GGLAFRVF Original DNA GGTGGCCTGGCCTTCCGAGTCTT Mutated DNA GGTGGCCTGGCCTTCCAAGTCTT Using this information determine if the following statement is true or false. The mutation is a "base substitution"

true

During a chemical reaction you observe that there is an increase in enthalpy and a decrease in the entropy. Based on these observations please indicate whether the following statement about this reaction is true or false. The products of this reaction are more organized than the reactants.

true

The [H+] of the solution will decrease.

true

The pH of the solution will increase.

true

Trancription Direction Part A During transcription the mRNA strand is produced anti-parallel to the template DNA strand.

true

True or False, based on the atom described in the question above, the valence of that atom is 1

true

True or false? Osmosis is a type of diffusion.

true

True or false? Single-stranded DNA molecules are said to be antiparallel when they are lined up next to each other but oriented in opposite directions.

true

True or false? The "blind spot" in vertebrate eyes is a region of the retina that contains no photoreceptors.

true

True or false? The light-dependent reactions of photosynthesis use water and produce oxygen.

true

True or false? The potential energy in an ATP molecule is derived mainly from its three phosphate groups

true

True or false? The reactions that generate the largest amounts of ATP during cellular respiration take place in the mitochondria.

true

True or false? The water-soluble portion of a phospholipid is the polar head, which generally consists of a glycerol molecule linked to a phosphate group.

true

While membrane depolarizations can be variable, all action potentials are the same.

true

You introduce cyanide to an actively respiring mitochondrion. Cyanide blocks the transfer of electrons from the last cytochrome in the ETC to Oxygen. Based on your understanding of cellular respiration would the following statements be true or false? The pumping of Hydrogen ions from the matrix to the space between the mitochondrial membranes would decrease.

true

http://session.masteringbiology.com/problemAsset/1000226914/11/Osmosis_Table.jpg Three segments of dialysis tubing (artificial membrane) are filled with three NaCl solutions of unknown concentration. The segments are weighed and then placed in a 0.35M sucrose solution. After 24 hours the segments are removed from the sucrose solution and re-weighed. Based on the information in the table below and assuming that neither NaCl nor sucrose is membrane premeable indicate whether the following statement is True or False. Solution A is more concentrated than solution C

true

http://session.masteringbiology.com/problemAsset/1000237040/7/Pedigree.jpg Based on the pedigree above individual number 3 is homozygous

true

http://session.masteringbiology.com/problemAsset/1000241296/9/Eye.jpg Based on the figure above is the statement below true or false? The rods and cone are involved in sensory transduction

true

http://session.masteringbiology.com/problemAsset/1000241296/9/Eye.jpg Based on the figure below is the statement below true or false? The horizontal cells are involved in the integration of sensory information.

true

http://session.masteringbiology.com/problemAsset/1000241301/5/sarcomere.jpg Based on the figure above is the following statement true or false? During a muscle contraction the space between the Z-lines will decrease.

true

How many genetically unique types of gametes could be produced by an individual with the genotype RrYY?

two

Meiosis I produces _____ cells, each of which is _____.

two ... haploid

In the absence of oxygen, what is the net gain of ATP for each glucose molecule that enters glycolysis?

two ATP

During prophase a homologous pair of chromosomes consists of _____.

two chromosomes and four chromatids

Which of the following best describes the structure of a biological membrane? a mixture of covalently linked phospholipids and proteins that determines which solutes can cross the membrane and which cannot two layers of phospholipids with proteins either crossing the layers or on the surface of the layers two layers of phospholipids (with opposite orientations of the phospholipids in each layer) with each layer covered on the outside with proteins a fluid structure in which phospholipids and proteins move freely between sides of the membrane two layers of phospholipids with proteins embedded between the two layers

two layers of phospholipids with proteins either crossing the layers or on the surface of the layers

During anaphase II of meiosis a cell would contain _________ chromosomes and _____ pairs.

unreplicated , homologous

Action potentials in myelinated axons propagate:

using salutatory motion

http://session.masteringbiology.com/problemAsset/1000240420/5/Action_potential.jpg Based on the figure location 4 is the result of _______ gates being open

voltage gated K+ ion channel

Excitable cells differ from other cells in that they have in their membranes

voltage-gated Na+ and K+ channels

The light reactions of photosynthesis use _____ and produce ____

water ... NADPH

dehydration reaction (or condensation reaction) is the process in which _____.

water molecules are produced as a polymer is formed from monomers

Hydrogen bonding is most often seen _____.

when hydrogen is covalently bonded to an electronegative atom

Which of the following clues would tell you if a cell is prokaryotic or eukaryotic? whether or not the cell is partitioned by internal membranes whether or not the cell contains DNA whether or not the cell carries out cellular metabolism the presence or absence of ribosomes the presence or absence of a rigid cell wall

whether or not the cell is partitioned by internal membranes

http://session.masteringbiology.com/problemAsset/1000326400/6/Negative_Feedback.jpg Using the model of cell signaling regulation shown below, will cells C produce more compound 3 if cells A release more compound 1, (Yes or No)

Biol 1201 final exam Wischusen

Kaugnay na mga set ng pag-aaral

Socrates

Econ 520: Chapter 3

Chapter 4 Psychology 2

Female Physiology Final: Lactation and Breast

ECON 431 Pretest

Quiz 1 - Unit 1

AH2 Adaptive Quizzing

Data Structure and Algorithms Reviewer

Security +

Ch.1

ECON Chapter 12 DSM

Sociology Test Four

Examination for Missouri Insurance Producer's License

Chapter 10- Practice quiz

Organizational behavior chapter 10

Chapter 3 Smart Books

Agency/Brokerage

Chapter 12: Diseases and Conditions of the Reproductive System

Geology Final

ch 10 fiance