BIOL review

240) Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing and frequent lung infections. Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death). If recombinant DNase I is added to a vial of respiratory secretions from a cystic fibrosis patient, which of the following results would indicate that the recombinant DNase I is functional? A) The secretions become thicker and more viscous. B) The secretions become less viscous. C) There is no effect on the secretions. D) This experiment could not tell you if the DNase was functional or not.

...

100) There is a mutation in the operator of the trp operon in a cell such that the trp repressor is unable to bind to the operator. If tryptophan is added to the cell, what will happen? A) Tryptophan will bind to the repressor, and trp enzymes will be produced. B) Tryptophan will bind to the repressor, and trp enzymes will not be produced. C) Tryptophan will not bind to the repressor, and trp enzymes will be produced. D) Tryptophan will bind to the operator, and trp enzymes will be produced.

A

104) Small pieces of RNA that can regulate translation of mRNA are called A) microRNA. B) interfering RNA. C) transfer RNA. D) messenger RNA.

A

113) Transcription factors attach to A) DNA. B) signal molecules. C) plasma membrane receptors. D) mRNA.

A

120) The cloning of Dolly the sheep A) demonstrated that the nuclei from differentiated mammalian cells can retain their full genetic potential. B) demonstrated that differentiated cells contain only a fraction of their full genetic potential. C) demonstrated, for the first time, that eggs are haploid and body cells are diploid. D) revealed that cloned mammals most resemble the egg donor.

A

126) A gene that can cause cancer when present in a single copy in a cell is called a(n) A) oncogene. B) enhancer gene. C) carcinogen. D) proto-oncogene.

A

135) E. coli can synthesize the amino acid threonine or absorb it from the environment. In the thr operon, the repressor is active when it is bound to threonine. If an E. coli bacterium is in an environment where threonine is absent, will transcription of threonine synthesis genes take place? Why or why not? A) Yes, because threonine will not be bound to the repressor, so the repressor will be inactive. B) No, because threonine will not be bound to the repressor, so the repressor will be inactive. C) Yes, because threonine will not be bound to the repressor, so the repressor will be active. D) No, because threonine will not be bound to the repressor, so the repressor will be active.

A

14) The copying mechanism of DNA is most like A) taking a picture of yourself and of your reflection in a mirror. B) mixing flour, sugar, and water to make bread dough. C) dripping water out of a faucet. D) carving a figure out of wood.

A

148) In thinking about their role in cell division, oncogenes are like the ________ of a car, while tumor suppressor genes are like the ________ of a car. A) gas pedal, brakes B) steering wheel, brakes C) gas pedal, headlights D) brakes, gas pedal

A

153) There is a mutation in the operator of the trp operon in a cell such that the trp repressor is unable to bind to the operator. If tryptophan is added to the cell, what will happen? A) Tryptophan will bind to the repressor, and trp enzymes will be produced. B) Tryptophan will bind to the repressor, and trp enzymes will not be produced. C) Tryptophan will not bind to the repressor, and trp enzymes will be produced. D) Tryptophan will bind to the operator, and trp enzymes will be produced.

A

161) In a muscle cell, the contractile protein myosin is present in larger quantities than the structural protein actin. Which of the following qPCR results would support this observation? A) The fluorescent signal for myosin is higher than that of actin. B) The fluorescent signal for actin is higher than that of myosin. C) The fluorescent signals for myosin and actin are equal. D) The fluorescent signal for myosin is large and is zero for actin.

A

162) A scientist hypothesizes that a new drug turns on a certain gene in a skin cell. Which of the following experiments would be the best to test her hypothesis? A) Use qPCR to measure the initial levels of gene expression in skin cells, treat skin cells with the drug and measure the levels of gene expression, and then compare the two measurements. B) Use qPCR to measure the levels of gene expression in skin cells after exposure to the drug. C) Use qPCR to measure the initial levels of gene expression in muscle cells, treat skin cells with the drug and measure the levels of gene expression, and then compare the two measurements. D) Use qPCR to measure the levels of gene expression in skin cells after exposure to the drug and then add another drug to turn off gene expression and use qPCR to measure the levels of expression.

A

163) Which of the following statements regarding the comparison of DNA microarrays and qPCR is false? A) Both methods use fluorescent DNA molecules and cDNA. B) Both methods can determine whether a gene has been turned on or not. C) Both methods use mRNA extracted from cells. D) Both methods can quantify the levels of gene expression in cells.

A

166) The production of multiple identical copies of gene-sized pieces of DNA defines A) gene cloning. B) transformation. C) DNA technology. D) genetic engineering.

A

167) In the process of human gene cloning using plasmids, the bacterial plasmid A) is used as the vector. B) is the source of the gene to be cloned. C) is cultured inside the human cell, which contains the gene to be cloned. D) is used to insert the human gene into the bacterial chromosome.

A

175) After DNA fragments with matching sticky ends are temporarily joined by complementary base pairing, the union can be made permanent by the "pasting" enzyme A) DNA ligase. B) DNA polymerase. C) DNA helicase. D) ATP methylase.

A

176) The ________ approach to gene cloning employs a mixture of fragments from the entire genome of an organism and results in the production of thousands of different recombinant plasmids. A) shotgun B) genetic engineering C) restriction D) cloning

A

18) Why does a DNA strand grow only in the 5' to 3' direction? A) because DNA polymerases can only add nucleotides to the 3' end of the growing molecule B) because DNA polymerases can only add nucleotides to the 5' end of the growing molecule C) because the DNA molecule only unwinds in the 5' to 3' direction D) because DNA polymerase requires the addition of a starter nucleotide at the 5' end

A

183) Which of the following statements about nucleic acid probes is false? A) A nucleic acid probe is a double-stranded section of DNA. B) A nucleic acid probe can be used to find a specific gene. C) A nucleic acid probe binds to a complementary sequence in the gene of interest. D) A nucleic acid probe is usually labeled with a radioactive isotope or fluorescent tag to help identify its location.

A

196) If you commit a crime, you need to make sure that you do not leave even the smallest speck of blood, hair, or other organic matter from your body. If you do, the DNA in this material can be amplified by ________, subjected to genetic analysis, and used to identify you as the perpetrator of the crime. A) PCR B) STR analysis C) RFLP D) restriction digests

A

197) The polymerase chain reaction relies upon unusual, heat-resistant ________ that were isolated from bacteria living in hot springs. A) DNA polymerases B) phages C) restriction enzymes D) plasmids

A

2) One type of virus that infects bacteria is called a A) phage. B) retrovirus. C) rhinovirus. D) coronavirus.

A

201) What is the current standard tool used for DNA profiling by forensic scientists? A) STR analysis B) gene cloning C) genetic engineering D) RFLP analysis

A

204) When genetic variation in one nucleotide is found in at least 1% of the population, it is known as a A) single nucleotide polymorphism. B) short tandem repeat. C) recombinant DNA molecule. D) genomic library.

A

221) TPOX is one of the STRs that is used to compare DNA between different people. Why is TPOX useful for comparing DNA between different people? A) TPOX varies in the number of repeats between different people. B) TPOX varies in sequence between different people. C) TPOX is only present in some people's genomes. D) TPOX is present in different places in different people's genomes.

A

223) When cloning a gene, one of the steps is to use restriction enzymes to insert the gene of interest into a vector. If you separated the empty vector (the vector without the gene of interest) and the cloned vector (the vector that has the gene of interest added) using agarose gel electrophoresis, what do you expect to observe on the agarose gel if both vectors are loaded at the same position at the top of the gel? A) The empty vector would migrate farther down than the cloned vector. B) The cloned vector would migrate farther down than the cloned vector. C) The empty vector would migrate the same distance as the cloned vector. D) It is impossible to know without knowing the identity of the gene of interest.

A

227) Some restriction enzymes do not leave sticky ends when cutting DNA molecules, rather, they cut a restriction site down the middle and leave "blunt-ended" DNA molecules, which do not have any single-stranded nucleotide extensions. Which of the following is not a likely outcome when trying to insert a gene into a plasmid when have both been cut with the same "blunt-ended" restriction enzyme? A) The gene might be inserted into the plasmid by forming hydrogen bonds. B) The gene might be inserted into the plasmid multiple times in a row. C) The gene might insert into the plasmid in the proper (forward) orientation. D) The gene might insert into the plasmid in the wrong (backward) orientation.

A

228) You prepare a genomic library and use this as a source to produce recombinant proteins in E. coli. However, after producing the proteins you find that they are all too long or too short. In fact, you don't find a single protein that is the correct size. What is the best explanation for this result? A) Since a genomic library was used as the source of the genes, the introns were included during transcription and translation. B) Since bacteria were used to produce the proteins, sugar groups were not properly added on to the proteins that were being made. C) Since a genomic library was used as the source, the recombinant bacterial plasmid DNA was likely incorporated into the proteins being made. D) Since bacteria were used to produce the proteins, the native bacterial plasmid DNA was likely incorporated into the proteins being made.

A

230) Gel electrophoresis is normally set up with the negative electrode at the top of the gel and the positive electrode at the bottom of the gel. The DNA products are loaded at the top of the gel, and then a current is applied to separate them. However, when preparing to run a gel, you accidentally switched the locations of the negative and positive electrodes such that the positive electrode is at the top and the negative electrode is at the bottom. You still loaded the DNA products at the top of the gel as normal. What result are you most likely to observe if you apply an electric current to this gel setup? A) All DNA molecules will migrate up the gel toward the positive electrode. B) All DNA molecules will migrate down the gel toward the negative electrode. C) Shorter DNA molecules will move up the gel, and longer DNA molecules will move down the gel. D) Longer DNA molecules will move up the gel, and shorter DNA molecules will move down the gel.

A

235) Below is a figure depicting the whole-genome shotgun method. Which step is most similar to a step used when preparing a genomic library? A) step 1 B) step 2 C) step 3 D) step 4

A

26) Which of the following enzymes catalyzes the production of a strand of RNA from DNA? A) RNA polymerase B) RNA ligase C) a ribozyme D) tRNA

A

31) Which of the following takes place during translation? A) the conversion of genetic information from the language of nucleic acids to the language of proteins B) the conversion of genetic information from DNA nucleotides into RNA nucleotides C) the conversion of genetic information from the language of proteins to the language of enzymes D) DNA replication

A

33) Considering only the steps that take place during translation, which of the following is not needed in order for translation to occur? A) DNA template B) ribosomes C) tRNA D) sources of energy, including ATP

A

38) Any change in the nucleotide sequence of DNA is called A) a mutation. B) a mutagen. C) a base substitution. D) an anticodon.

A

4) The way that genetic material of a bacteriophage enters a bacterium is most like the way that A) a drug is injected with a hypodermic needle. B) a person swallows a pill. C) skin lotion is rubbed onto the hands. D) water soaks into a sponge.

A

46) The envelope of a mumps virus A) helps the virus enter the cell. B) is coded by host genes. C) helps the virus insert its DNA into the host cell genome. D) accounts for viral resistance to antibiotics.

A

47) Which of the following statements about herpesviruses is false? A) Herpesviruses reproduce inside the host cell's mitochondria. B) Herpesviruses acquire their envelopes from the host cell nuclear membrane. C) Herpesviruses may remain dormant for long periods of time while inside the host cell nucleus. D) Herpesviruses may cause cold sores or genital sores to appear during times of physical or emotional stress.

A

58) Conjugation A) is the direct transfer of DNA from one bacterium to another. B) occurs when a bacterium acquires DNA from the surrounding environment. C) is the result of crossing over. D) occurs when a phage transfers bacterial DNA from one bacterium to another.

A

61) When a bacterial cell with a chromosome-borne F factor conjugates with another bacterium, how is the transmitted donor DNA incorporated into the recipient's genome? A) It is substituted for the equivalent portion of the recipient's chromosome by the process of crossing over. B) It circularizes and becomes one of the recipient cell's plasmids. C) The genes on the donor DNA of which the recipient does not have a copy are added to the recipient chromosome the remainder of the donor DNA is degraded. D) The donor and recipient DNA are both chopped into segments by restriction enzymes, and a new, composite chromosome is assembled from the fragments.

A

68) Below are three statements. Which of the following choices properly matches the statements with the correct biological processes? I. This occurs in the nucleus of eukaryotic cells. II. Transfer RNAs bind amino acids in the cytoplasm. III. A polymerase enzyme is required. A) I: replication, II: translation, III: transcription B) I: translation, II: translation, III: replication C) I: transcription, II: translation, III: translation D) I: replication, II: transcription, III: replication

A

69) It is possible to synthesize proteins in vitro (in a test tube) without the use of living cells. If starting from a mature mRNA transcript, which of the following components would not be needed to do this? A) adenine molecules B) amino acids C) tRNAs D) ribosomes

A

7) Which of the following statements regarding RNA is false? A) RNA uses the sugar dextrose. B) RNA uses the nitrogenous base uracil. C) One RNA molecule can include four different nucleotides in its structure. D) RNA molecules have a sugar-phosphate backbone.

A

72) Normal genes have a promoter followed by a start codon. In a mutant gene, the "A" in the start codon has been deleted. Which of the following is not a possible outcome? A) The normal protein will be produced. B) A shorter protein will be produced. C) A longer protein will be produced. D) No protein will be produced.

A

76) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the genetic code below for assistance. A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function differently from protein 1.

A

81) In order to add the gene for human insulin to a bacterial plasmid, the DNA molecules have to be "cut" with enzymes called restriction endonucleases and then pasted back together with enzymes called DNA ligases. Imagine that during this process, the first five nucleotides of the human insulin gene were accidentally cut out before it was pasted into the bacterial plasmid. What is the most likely outcome if this plasmid was added to bacterial cells? A) Transcription would not take place because the RNA polymerase would not recognize the promoter. B) The human insulin protein would be produced as normal. C) The human insulin protein would not be produced because the start codon is missing. D) The human insulin protein would be shorter than normal because it will be missing one amino acid.

A

86) The lac operon in Escherichia coli A) prevents lactose-utilizing enzymes from being expressed when lactose is absent from the environment. B) prevents lactose intolerance. C) prevents lactose-utilizing enzymes from being expressed when lactose is present in the environment. D) promotes the expression of lactose-utilizing enzymes when lactose is absent from the environment.

A

88) The lac operon of E. coli is ________ when the repressor is bound to lactose. A) active B) inactive C) cloned D) unregulated

A

91) A single cell, the zygote, can develop into an entirely new organism with many different specialized cells. Which of the following statements about this process is false? A) Additional genetic information for the formation of specialized cells is passed on to the developing embryo via the mother. B) The descendant cells specialize by a process known as differentiation. C) The zygote contains all of the genetic information required for the development of many different cell types. D) Differentiation of the zygote into a multicellular organism results from selective gene expression.

A

93) The genes for the enzymes of glycolysis A) are active in all metabolizing cells, but the genes for specialized proteins are expressed only in particular cell types. B) are inactive in all metabolizing cells, but the genes for specialized proteins are expressed in all cell types. C) and the genes for all specialized proteins are expressed in all metabolizing cells. D) and the genes for all specialized proteins are expressed in all embryonic cells.

A

1) Which of the following people conducted the experiments that demonstrated that DNA is the genetic material of bacteriophages? A) Watson and Crick B) Hershey and Chase C) Franklin D) Pauling

B

102) The coding regions of a gene are called A) introns. B) exons. C) promoters. D) enhancers.

B

103) Which of the following permits a single gene to code for more than one polypeptide? A) retention of different introns in the final version of the different mRNA strands B) alternative RNA splicing C) genetic differentiation D) addition of different types of caps and tails to the final version of the mRNA strands

B

108) Which of the following statements about fruit fly development is false? A) One of the earliest development events is the determination of the head and tail ends of the egg. B) The location of the head and tail ends of the egg is primarily determined by the location of sperm entry during fertilization. C) Homeotic genes regulate batteries of other genes that direct the anatomical identity of body parts. D) Cascades of gene expression routinely direct fruit fly development.

B

109) A homeotic gene A) determines which end of the egg will become the head and which end will become the tail. B) serves as a master control gene that functions during embryonic development by controlling the developmental fate of groups of cells. C) represses gene transcription and promotes mRNA translation. D) is found only in adult somatic cells.

B

110) Which of the following statements about microarrays is false? A) Microarrays enable scientists to determine the activity of thousands of genes at once. B) Microarrays use tiny portions of double-stranded RNA fragments from a large number of genes. C) Microarrays are used to determine which genes are active in different tissues or in tissues of different states of health. D) Microarrays use fluorescently labeled cDNA molecules to identify particular genes expressed at a particular time.

B

112) To initiate a signal transduction pathway, a signal binds to a receptor protein usually located in the A) nucleus. B) plasma membrane. C) ER. D) cytoplasm.

B

114) A signal outside a cell triggers changes in the transcription and translation inside the cell through A) post-translational editing. B) signal transduction pathways. C) protein activation. D) protein breakdown.

B

115) Yeast are able to communicate with each other A) by close cell-to-cell contact. B) through chemical signaling. C) only if they can touch each other and have merged cell walls. D) with pseudopodia.

B

118) Why can some plants be cloned from a single cell? A) Plant cells do not differentiate even when mature, so any cell can grow into an entire plant. B) Plant cells can dedifferentiate and give rise to all of the specialized cells required to produce an entire plant. C) Plant cells can produce genes to replace those lost during development. D) Plant cells are capable of self-renewal by utilizing cellular components from adjacent cells.

B

119) Which of the following processes occurs when a salamander regenerates a lost limb? A) The homeotic genes of the regenerating limb are expressed. B) Certain cells in the limb dedifferentiate, divide, and then redifferentiate to form a new limb. C) A new salamander develops from the lost limb. D) The homeotic genes of the regenerating cells turn off.

B

122) Which of the following mammals has not yet been cloned and brought through the complete gestation cycle? A) cow B) human C) pig D) cat

B

124) Which of the following statements regarding stem cells is false? A) Embryonic stem cells can give rise to all the different specialized cells in the body. B) Adult, but not embryonic, stem cells can be grown in laboratory culture. C) Adult stem cells are present in adult tissues. D) Adult stem cells are partway along the road to differentiation.

B

129) Cancer of the colon is caused by A) a single somatic cell gene mutation. B) several somatic cell gene mutations. C) a physical rupture of the colon. D) a diet high in fiber and low in fat.

B

130) The development of colon cancer occurs slowly, and colon cancer is more frequently seen in the elderly than the young. This is most likely because A) cancer cells don't have mitochondria, so they grow slowly. B) usually six or more somatic mutations must occur to give rise to the cancer, which takes time. C) cancer cells have to wait until new blood vessels grow into the area, which takes much time. D) most cancer mutations interfere with mitosis, so cell division occurs more slowly.

B

132) Mutations in the p53 gene can lead to cancer by A) causing the production of excessive amounts of relay proteins. B) causing the production of a faulty protein that is no longer able to inhibit cell division. C) promoting the expression of mRNA that can interact with DNA, resulting in new mutations. D) increasing the production of growth hormones, which trigger faster cell cycles.

B

134) Which of the following statements regarding cancer risk factors is false? A) Factors that alter DNA and make cells cancerous are called carcinogens. B) Mutagens are usually not carcinogens. C) X-rays and ultraviolet radiation are two of the most potent carcinogens. D) Eating 20-30 grams of plant fiber daily and reducing the intake of animal fat can reduce your risk of developing colon cancer.

B

137) A normal muscle cell produces the myosin protein, which allows muscles to contract. You discover a single muscle cell that has tRNAs that do not bind to amino acids. Will the myosin gene be expressed in this muscle cell? Why or why not? A) Yes, because all cells in the body express the myosin gene all of the time. B) No, because if the tRNAs do not bind amino acids, then translation cannot occur. C) Yes, because the myosin gene will be transcribed in the muscle cell nucleus. D) No, because the myosin mRNA will likely get broken down in the cytoplasm.

B

138) Scientists are attempting to make a chicken look like a dinosaur ("dino-chicken") by using drugs or proteins to turn on certain homeotic genes during the development of a chicken embryo. If the scientists are successful in creating both male and female "dino-chickens," and then the "dino-chickens" mate together, what type of offspring would the two "dino-chickens" have? A) a male or female "dino-chicken" B) a male or female normal chicken C) You can't know for sure because of random fertilization. D) You can't know for sure because it depends on whether the modified homeotic genes are dominant or recessive.

B

139) A stomach cell is producing pepsin, an enzyme that hydrolyzes proteins. Which of the following events suggests that gene expression of pepsin has been turned off in the cell? A) The pepsin protein is folded properly in the cytoplasm. B) The chromosome with the pepsin gene is tightly coiled. C) The pepsin mRNA leaves the nucleus and enters the cytoplasm. D) Activators and RNA polymerases are abundant in the nucleus.

B

143) There is a mutation in the operator of the lac operon in a cell such that the lac repressor always stays bound to the operator. If lactose is added to the cell, what will happen? A) Lactose will bind to the repressor, and lac enzymes will be produced. B) Lactose will bind to the repressor, and lac enzymes will not be produced. C) Lactose will not bind to the repressor, and lac enzymes will be produced. D) Lactose will bind to the operator, and lac enzymes will be produced.

B

146) What is the proper order of events in the expression of a eukaryotic protein? A) DNA unpacking, mRNA transport through nucleus, mRNA splicing, protein modification B) DNA unpacking, mRNA splicing, translation, protein folding C) transcription, translation, addition of cap and tail to mRNA, DNA unpacking D) transcription, mRNA splicing, protein modification, translation

B

147) During an experiment assessing the development of a fly embryo, a scientist artificially turns on a homeotic gene that controls eye development in somatic cells that develop into the wings. Which of the following is the most likely outcome of this experiment? A) A normal adult fly will develop. B) A mutant adult fly will develop that has eyes on its wings. C) A mutant adult fly will develop that has legs on its head. D) A mutant adult fly will develop that has no eyes on its head but has eyes on its wings.

B

15) When one DNA molecule is copied to make two DNA molecules, the new DNA contains A) none of the parent DNA. B) 50% of the parent DNA. C) 75% of the parent DNA. D) 100% of the parent DNA

B

150) In 2013, an estimated 160,000 people in the United States will die of lung cancer. If the cancer death rate is expected to increase by 1% per decade, approximately how many people will die of lung cancer in the United States in 2033? A) 160,000 B) 163,000 C) 176,000 D) 194,000

B

165) When DNA from two sources is combined into one single piece of DNA, it is known as A) cloned DNA. B) recombinant DNA. C) a vector. D) a plasmid.

B

171) Restriction enzymes A) facilitate nucleotide base pairing. B) cut DNA at specific sites. C) stop transcription and translation. D) bind together strands of DNA.

B

177) Which of the following is the best definition of a genomic library? A) a collection of cloned DNA fragments that includes some parts of organism's genome B) a collection of cloned DNA fragments that includes an organism's entire genome C) a collection of cloned DNA fragments that includes multiple organisms' genomes D) a collection of cloned DNA fragments that includes only exons from an organism's genome

B

179) The enzyme that converts information stored in RNA to information stored in DNA is A) DNA ligase. B) reverse transcriptase. C) a restriction enzyme. D) RNA polymerase

B

182) A nucleic acid probe is A) a virus that transfers DNA to a recipient cell. B) a piece of radioactively labeled DNA that is used to locate a specific gene. C) an enzyme that locates a specific restriction site on RNA. D) a plasmid that recognizes a specific DNA sequence.

B

186) The advantage of being able to clone the gene for human insulin is that A) there are too few cows, pigs, and horses to provide an adequate supply of their insulin. B) human insulin is less likely to cause harmful side effects than cow, pig, or horse insulin. C) cow, pig, or horse insulin cannot keep a diabetic alive for more than three months. D) using human insulin increases the probability that, in the future, the person suffering from diabetes can be weaned from a dependence on insulin.

B

187) A vaccine works by A) inhibiting bacterial replication. B) stimulating the immune system. C) inhibiting viral replication. D) preventing the translation of mRNA.

B

19) Which of the following options best depicts the flow of information when a gene directs the synthesis of a cellular component? A) RNA → DNA → RNA → protein B) DNA → RNA → protein C) protein → RNA → DNA D) DNA → tRNA → mRNA → protein

B

192) Which of the following has not been a significant issue in the creation of genetically modified (GM) organisms? A) the fact that some plants carrying genes from other species might represent a threat to the environment B) the fact that GM organisms cannot be modified to prevent them from reproducing once they pass beyond the experimental stage C) the fact that rogue microbes might transfer dangerous genes into other organisms D) the fact that the protein products of transplanted genes might lead to allergic reactions

B

20) The transfer of genetic information from DNA to RNA is called A) translation. B) transcription. C) initiation. D) elongation.

B

200) Which of the following statements regarding repetitive DNA is false? A) Repetitive DNA is usually found between genes. B) Repetitive DNA is identical in all humans. C) Repetitive DNA is usually repeated multiple times in the genome. D) Repetitive DNA can show great variation among individuals.

B

202) What is the smallest number of cells needed to perform a successful DNA profile? A) 1 B) 20 C) 200 D) 1,000

B

208) The type of repetitive DNA composed of sequences of large repeated units is often associated with A) tandem repeats. B) transposable elements. C) sex-linked genes. D) transcription factors.

B

210) Which of the following statements regarding DNA is false? A) Long stretches of repetitive DNA are prominent at centromeres and ends of chromosomes. B) Human and E. coli genomes contain approximately the same proportions of noncoding DNA. C) Current estimates are that there about 21,000 genes in the human genome. D) Telomeres seem to have a structural function.

B

217) Researchers are trying to make a genetically modified (GM) pig that expresses bovine (cow) growth hormone to make it grow bigger. They isolated the bovine growth hormone gene, cut it and a plasmid with the same restriction enzyme, and mixed them together. They inserted the mixture into pig zygotes, but only normal pigs, not GM pigs, grew. What did they likely do wrong? A) They are trying to make a GM animal, which is impossible. B) They forgot to add DNA ligase after mixing the plasmid and gene together. C) They should have used different restriction enzymes to cut the plasmid and the gene. D) They forgot to use PCR and make multiple copies of the growth hormone gene.

B

222) Cystic fibrosis is a genetic disease that results from a defective CFTR protein that alters ion flow through the cell membrane such that water does not cross the cell membrane. Gene therapy is being used to attempt to help cystic fibrosis patients. Which of the following steps is not needed to develop a gene therapy treatment for cystic fibrosis? A) Clone the normal-functioning CFTR gene and make an RNA version of the gene. B) Make antibodies to the defective CFTR protein to enhance the patient's immune system. C) Remove cells from a patient and infect them with the recombinant virus. D) Insert the RNA version of the CFTR gene into a virus.

B

224) Which of the following is an example of a transgenic organism? A) a fern grown from a single fern root cell B) a rat with rabbit hemoglobin genes C) a cow that has been fed pig growth hormone in its food D) a human given a corrected human blood-clotting gene

B

226) When DNA molecule "A" is cut with the restriction enzyme EcoRI, it is cut into four pieces. When DNA molecule "B," which is exactly identical to DNA molecule "A" except for the presence of one SNP, is cut with EcoRI, it is cut into three pieces. What is the best explanation for this observation? A) The SNP occurs in all EcoRI restriction sites in DNA molecule "B." B) The SNP occurs in a single EcoRI restriction site in DNA molecule "B." C) Not enough EcoRI was used to cut DNA molecule "B." D) An excess of EcoRI was used to cut DNA molecule "A."

B

229) You are trying to produce a cDNA library starting from mRNA in skeletal muscle cells. You add the following components to a tube and let the reaction proceed: skeletal muscle mRNA, free nucleotides, and DNA polymerase. After inspecting the products of the reaction, you do not find any cDNA molecules at all. What is the most likely explanation for this result? A) You used mRNA instead of genomic DNA as the source material. B) You used DNA polymerase instead of reverse transcriptase. C) cDNA libraries can only be made from skin cell mRNA molecules. D) You forgot to add a radiolabeled nucleic acid probe to the tube.

B

231) Which step in this process requires use of restriction enzymes? A) step A B) step B C) step C D) step D

B

233) Use the figure below to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top. Approximately how many bases are in the DNA molecule that the arrow is pointing to? A) 30 bases B) 36 bases C) 40 bases D) 44 bases

B

236) Four decades after the end of the Vietnam War, the remains of an Air Force pilot were discovered and returned to the United States. A search of Air Force records identified three families to which the remains might possibly belong. Each family had a surviving twin of a missing service member. The following STR profiles were obtained from the remains of the pilot and the surviving twins from the three families. In order to match the pilot's remains to the correct family using DNA profiling, A) the majority of the STR bands must match. B) each of the 13 STR bands must match. C) the bands for site 13 must match. D) bands 5 and 7 must match.

B

241) A scientist produced a batch of recombinant DNase I in E. coli cells and a batch in mammalian cells. She placed 0.1 mg of the E. coli-derived DNase I in a vial containing a solution of DNA, and she placed 0.1 mg of the mammalian cell-derived DNase I in a separate vial containing the same solution of DNA. The initial viscosity of the DNA solutions was identical. What do you expect the viscosity of the DNA solutions to be after ten minutes have passed, and why? A) The viscosity of the mammalian cell DNase I vial will be lower than that of the E. coli DNase I vial because the mammalian cell DNase I will be functional and able to degrade the DNA. B) The viscosity of the mammalian cell DNase I vial will be higher than that of the E. coli DNase I vial because the mammalian cell DNase I will be functional and able to degrade the DNA. C) The viscosity of the E. coli DNase I vial will be lower than that of the mammalian cell DNase I vial because the E. coli DNase I will be functional and able to degrade the DNA. D) The viscosity of the E. coli DNase I vial will be higher than that of the mammalian cell DNase I vial because the E. coli DNase I will be functional and able to degrade the DNA.

B

30) Which of the following statements about eukaryotic RNA is true? A) Introns are added to the RNA. B) Exons are spliced together. C) A small cap of extra nucleotides is added to both ends of the RNA. D) The modified RNA molecule is transported into the nucleus.

B

40) Consider the following sentence: "The dog did not eat." Which of the following variations of this sentence is most like a frameshift mutation? A) The did dog not eat. B) The dod idn ote at. C) The did not eat. D) The dog did dog did not eat.

B

43) Which of the following statements characterizes the lytic cycle of a viral infection? A) The cycle typically ends when the host bacterium divides. B) The cycle typically leads to the lysis of the host cell. C) The virus reproduces outside of the host cell. D) The viral genes typically remain inactive once they are inside the host cell.

B

45) Viral DNA incorporated into host cell DNA is known as a(n) A) capsid. B) prophage. C) envelope. D) phage.

B

5) The monomers of DNA and RNA are A) monosaccharides. B) nucleotides. C) fatty acids. D) nucleic acids.

B

51) What kind of virus is HIV? A) a paramyxovirus B) a retrovirus C) a complex virus D) a provirus

B

54) How do viroids harm the plants that are infected with them? A) by increasing the plants' metabolic rate B) by altering the plants' growth C) by reducing the plants' seed production D) by destroying the root system

B

6) Which of the following statements regarding DNA is false? A) DNA uses the sugar deoxyribose. B) DNA uses the nitrogenous base uracil. C) One DNA molecule can include four different nucleotides in its structure. D) DNA molecules have a sugar-phosphate backbone.

B

62) In many bacteria, genes that confer resistance to antibiotics are carried on A) factors. B) R plasmids. C) transposons. D) exons.

B

65) What is the transcription product of the sequence GCTAGCGATGAC? A) CGTUCGCUTCUG B) CGAUCGCUACUG C) CAGTAGCGATCG D) CGUTCGCUTCUG

B

66) A eukaryotic cell has a nuclear envelope that allows tRNA molecules, but not mRNA molecules, to leave the nucleus. Which of the following processes will not be able to take place in this cell? A) DNA replication B) tRNAs binding to codons C) RNA being made from DNA D) tRNAs binding to amino acids

B

79) Imagine that a pharmaceutical company was successful at producing a drug based on the CCR5 gene product that is effective at preventing the contraction of AIDS. However, shortly after the drug has been in use, patients and doctors report that the drug is not as effective as it once was. What is the most likely explanation for this result? A) The people taking the drug have built up a tolerance to the drug. B) Some HIV viruses have genetic variations in the RNA genome that provide resistance to the actions of the drug. C) The HIV virus gained mutations in its DNA genome in order to become resistant to the actions of the drug. D) The DNA of white blood cells of the people taking the drug have mutated to become resistant to the drug.

B

82) Suppose that the human insulin protein that was produced by the bacteria was much shorter than it should be. Upon further investigation, it was found that the DNA of the human insulin gene had a mutation while in the bacterial cells. What type of mutation could not result in these observations? A) nucleotide insertion B) silent mutation C) nucleotide deletion D) nonsense mutation

B

85) In a prokaryote, a group of genes with related functions, along with their associated control sequences, defines A) an allele. B) an operon. C) a locus. D) a transposon.

B

92) The basis of cellular differentiation is A) the operon. B) selective gene expression. C) cloning. D) mutation.

B

94) Which of the following statements regarding DNA packing is false? A) A nucleosome consists of DNA wound around a protein core of eight histone molecules. B) DNA packing tends to promote gene expression. C) Highly compacted chromatin is generally not expressed at all. D) Prokaryotes have proteins analogous to histones.

B

10) The shape of a DNA molecule is most like A) a set of railroad tracks. B) a wooden ladder. C) a twisted rope ladder. D) beads on a string.

C

101) RNA splicing involves the A) addition of a nucleotide "cap" to the molecule. B) addition of a nucleotide "tail" to the molecule. C) removal of introns from the molecule. D) removal of exons from the molecule.

C

106) All of the following mechanisms are used to regulate protein production except A) protein activation. B) protein breakdown. C) DNA replication. D) the breakdown of mRNA.

C

117) In plants, most differentiated cells retain A) only a tiny fraction of their original set of genes. B) a complete set of their genes but lose the ability to express most of those genes. C) a complete set of their genes and retain the ability to express those genes under certain circumstances. D) the ability to dedifferentiate but then cannot return to their original differentiated state.

C

12) DNA replication A) occurs through the addition of nucleotides to the end of the parental DNA molecule. B) results in the formation of four new DNA strands. C) uses each strand of a DNA molecule as a template for the creation of a new strand. D) begins when two DNA molecules join together to exchange segments.

C

128) Which of the following is not a factor that contributes to normal cells becoming cancerous? A) the conversion of a proto-oncogene to an oncogene B) damage to a tumor-suppressor gene C) the production of more effective tumor-suppressor gene products D) excessive replication of proto-oncogenes

C

144) Two yeast cells, one of type a and the other type α, are in proximity to each other. The a yeast cell has a mutation in the gene for the α factor receptor protein such that the receptor does not translocate to the surface of the a cell. If both cells secrete their respective a and α factors, which of the following outcomes is most likely to occur? A) The a and α cells will grow toward each other. B) The a cell will grow towards the α cell. C) The α cell will grow toward the a cell. D) The a and α cells will not grow toward each other at all.

C

156) The figure below shows a normal cell transduction pathway. If the receptor wasn't there, which of the following is the most likely outcome? A) Cell division will occur normally. B) Cell division will not occur at all. C) Cell division will be increased. D) Cell division will be decreased.

C

158) All apples in the United States, regardless of variety or where they're purchased, are produced by cloning. For more than 2,000 years, apple growers around the world have used a type of cloning called grafting to produce larger, better-tasting apples. Why has cloning become the primary method of apple growing? Apples grown from seeds usually don't produce apples with the same taste and appearance as that of the parent tree because there's a high degree of genetic variability among the seeds. Making identical genetic copies of the preferred fruit is the only way to get reliable apple quality. In grafting, the shoots and branches of the desired fruit, called a scion, are attached onto the trunk and root system of a previously existing tree, called the rootstock. Both components of the graft are needed because the rootstock controls gene expression in the scion, triggering production of apples that match the cloned scion. Grafting research can be used to produce some interesting tree combinations that are beneficial for intensive agriculture. For example, if you graft the root of a small tree variety, such as the crab apple, onto the shoot from a larger apple tree, such as the Gala, you can produce Gala apples on a much smaller tree. Other scientists are trying to create disease-resistant varieties that would need fewer pesticides. This is beneficial for the environment and also lowers the price of apples in the grocery store. Half the trees in an orchard were derived from rootstock "A" and half from rootstock "B," but all the trees had the same scion. If the trees grafted onto rootstock "A" were infected by a parasite that causes blossom rot, the trees grafted onto rootstock "B" A) would be less likely to become infected because they're grafted onto different rootstocks. B) would be more likely to become infected, since the pathogen would spread through the soil to the roots of other trees. C) would be very likely to become infected, because the remaining scions are genetically identical to those that are already infected. D) There's no way to determine the likelihood of infection, since genetic variability gives all the trees different characteristics.

C

16) Multiple origins of replication on the DNA molecules of eukaryotic cells serve to A) remove errors in DNA replication. B) create multiple copies of the DNA molecule at the same time. C) shorten the time necessary for DNA replication. D) assure the correct orientation of the two strands in the newly growing double helix.

C

160)While DNA microarrays can be used to determine whether or not a gene is expressed in a cell, quantitative polymerase chain reaction (qPCR) can be used to measure the extent of gene expression in cells and tissues. To perform qPCR, mRNA is extracted from cells and reverse transcribed to complementary DNA (cDNA). Using fluorescent DNA molecules that recognize specific gene sequences and DNA polymerase, copies of the gene sequence of interest are made. After the copies are made, a fluorescent detector measures the intensity of the fluorescent signal, which is proportional to the number of mRNA transcripts in the cell and corresponds to the level of gene expression in the cell. A pancreatic cell normally produces low levels of the protein insulin, but after a meal it produces large levels of insulin before returning to its initial state. Which of the following figures would represent qPCR data obtained from a pancreatic cell that went through this cycle?

C

164) Biotechnology A) is a modern scientific discipline that has existed for only a few decades. B) is strictly concerned with the manipulation of DNA. C) has been around since the dawn of civilization. D) is generally considered more harmful than valuable to society.

C

168) DNA ligase binds A) recombinant DNA to transformed bacterial cells. B) recombinant DNA to recombinant proteins. C) nucleotides in the DNA backbone together. D) nucleotide base pairs together.

C

169) When plasmids are used to produce a desired protein, A) the plasmids are inserted into the bacterial chromosome. B) the plasmids multiply and produce the protein outside of the bacterium. C) the desired gene is inserted into the plasmid, and the plasmid is returned to the bacterium by transformation. D) the bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene (often the cell of a plant or animal).

C

174) The feature of "sticky ends" that makes them especially useful in DNA recombination is their ability to A) bind to DNA and thereby activate transcription. B) bind to ribosomes and thereby activate translation. C) form hydrogen-bonded base pairs with complementary single-stranded stretches of DNA. D) allow plasmids to attach to the main bacterial chromosome.

C

184) The type of recombinant bacteria most often used to mass-produce genes is A) Pseudomonas aeruginosa. B) Agrobacterium tumefaciens. C) Escherichia coli. D) Saccharomyces cerevisiae.

C

185) The only cells that can correctly attach sugars to proteins to form glycoprotein products are A) yeast cells. B) E. coli cells. C) mammalian cells. D) algal cells.

C

188) Which of the following statements about DNA technology is false? A) DNA technology is now used to mass-produce human insulin. B) DNA technology is now used to mass-produce human growth hormone. C) DNA technology is now used to create cells that can identify and kill cancer cells. D) DNA technology is now used to produce vaccines that are harmless mutants of a pathogen.

C

189) Golden Rice is golden in color because it is rich in A) vitamin A. B) vitamin C. C) beta-carotene. D) chromium picolinate.

C

190) A transgenic animal is A) an animal that is the first of its kind to bear a particular allele. B) an animal in which a genetic defect has been corrected using recombinant DNA therapy. C) an animal containing a gene from another organism, typically of another species. D) an animal containing genes from three or more species.

C

191) Which of the following genetically modified organisms has not been developed by genetic engineers (at least, not yet)? A) transgenic rice with genes for milk proteins B) transgenic salmon with a growth hormone gene that allows them to grow more quickly C) transgenic corn with the gene for human insulin D) transgenic pigs with a roundworm gene that allows them to make more omega-3 fatty acids

C

194) Genetically modifying ________ cells may directly affect future generations. A) bone marrow B) somatic C) gamete-forming D) photoreceptor

C

195) What is the preferred name of the technique used to determine if DNA comes from a particular individual? A) DNA technology B) DNA analysis C) DNA profiling D) DNA microarrays

C

205) Which of the following statements about genome sequencing is false? A) The genomes of nearly 7,000 species have been completely sequenced. B) The first eukaryotic organism to have its genome sequenced was yeast. C) Most of the genomes that have been sequenced to date are eukaryotes. D) The genome of a mouse has been sequenced.

C

207) Approximately what percentage of human DNA is noncoding? A) 49% B) 79% C) 98.5% D) 99.9%

C

209) Segments of eukaryotic DNA that can move or be copied from one site to another in the genome are called A) exons. B) plasmids. C) transposable elements. D) vectors.

C

21) The "one gene-one polypeptide" theory states that A) the synthesis of each gene is catalyzed by one specific enzyme. B) the synthesis of each enzyme is catalyzed by one specific gene. C) the function of an individual gene is to dictate the production of a specific polypeptide. D) the function of each polypeptide is to regulate the synthesis of each corresponding gene.

C

211) Why is the whole-genome shotgun method currently the tool of choice for analyzing genomes? A) It is extremely accurate. B) Multiple genomes can be analyzed simultaneously. C) It is fast and inexpensive. D) It is very labor-intensive.

C

212) Which of the following statements regarding proteomics is true? A) Proteomics is the study of protein interaction within a cell. B) Proteomics involves the complete analysis of the prokaryotes. C) Proteomics is the systematic study of the full set of proteins encoded by a genome. D) Proteomics and genomics allow scientists to study life in an ever-increasing reductive approach.

C

214) Genome sequence analysis suggests that Neanderthals A) never interbred with humans. B) are more closely related to chimpanzees than humans. C) at least sometimes had pale skin and red hair. D) could not speak.

C

216) The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? A) two B) three C) four D) five

C

22) Experiments have demonstrated that the "words" of the genetic code (the units that specify amino acids) are A) single nucleotides. B) two-nucleotide sequences. C) three-nucleotide sequences. D) nucleotide sequences of various lengths.

C

225) The restriction enzyme BamHI recognizes the DNA sequence GGATCC and always cuts between the two G nucleotides. How many bases long is the sticky end of a DNA molecule that has been cut with BamHI? A) two B) three C) four D) five

C

23) The directions for each amino acid in a polypeptide are indicated by a codon that consists of ________ nucleotides in an RNA molecule. A) five B) four C) three D) two

C

232) Which step in the creation of cDNA involves the use of reverse transcriptase? A) step 1 B) step 2 C) step 3 D) step 4

C

234) Use the figure below to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top. CS, crime scene: (S1) suspect 1, (S2) suspect 2, (S3) suspect 3. Which suspect is likely to have committed the crime? A) suspect 1 B) suspect 2 C) suspect 3 D) suspect 1 or 2

C

24) We would expect that a 15-nucleotide sequence that includes a stop codon at the end (as part of the 15-nucleotide sequence) will direct the production of a polypeptide that consists of A) two amino acids. B) three amino acids. C) four amino acids. D) five amino acids.

C

27) Which of the following occurs when RNA polymerase attaches to the promoter DNA? A) elongation of the growing RNA molecule B) termination of the RNA molecule C) initiation of a new RNA molecule D) initiation of a new polypeptide chain

C

28) ________ marks the end of a gene and causes transcription to stop. A) A stop codon B) RNA ligase C) A terminator D) Methionine

C

29) Where do transcription and translation occur in prokaryotic cells? A) on the plasma membrane B) in the nucleus C) in the cytoplasm D) in chromatophores

C

3) When a T2 bacteriophage infects an Escherichia coli cell, which part of the phage enters the bacterial cytoplasm? A) the whole phage B) only the RNA C) only the DNA D) the protein "headpiece" and its enclosed nucleic acid

C

35) Which of the following statements is false? A) Translation consists of initiation, elongation, and termination. B) During polypeptide initiation, an mRNA molecule, the first amino acid attached to its tRNA, and the two subunits of a ribosome are brought together. C) The start codon can be different depending on what kind of protein is to be translated. D) During the first step of initiation, an mRNA molecule binds to a small ribosomal subunit.

C

36) Which of the following options most accurately lists the sequence of events in translation? A) codon recognition → translocation → peptide bond formation → termination B) peptide bond formation → codon recognition → translocation → termination C) codon recognition → peptide bond formation → translocation → termination D) codon recognition → peptide bond formation → termination → translocation

C

41) A physical or chemical agent that changes the nucleotide sequence of DNA is called a(n) A) terminator. B) transposon. C) mutagen. D) anticodon.

C

42) A protein coat enclosing a viral genome is known as a(n) A) capsule. B) envelope. C) capsid. D) prophage.

C

49) Which of the following statements regarding viral diseases is false? A) RNA viruses tend to have an unusually high rate of mutation because their RNA genomes cannot be corrected by proofreading. B) New viral diseases often emerge when a virus infects a new host species. C) Very few new human diseases have originated in other animals because the genetic differences are too great. D) AIDS was around for decades before becoming a widespread epidemic.

C

50) The 2009 H1N1 flu virus A) was an avian flu virus. B) was spread by mosquitoes. C) evolved through the genetic reshuffling of viruses that infect humans, birds, and pigs. D) killed over 50 million people worldwide.

C

52) Which of the following enzymes does HIV use to synthesize DNA on an RNA template? A) ligase B) RNA polymerase C) reverse transcriptase D) DNA convertase

C

56) In the 1920s, Frederick Griffith conducted an experiment in which he mixed the dead cells of a bacterial strain that can cause pneumonia with live cells of a bacterial strain that cannot. When he cultured the live cells, some of the daughter colonies proved able to cause pneumonia. Which of the following processes of bacterial DNA transfer does this experiment demonstrate? A) transduction B) conjugation C) transformation D) transposition

C

57) Transduction A) is the direct transfer of DNA from one bacterium to another. B) occurs when a bacterium acquires DNA from the surrounding environment. C) occurs when a phage transfers bacterial DNA from one bacterium to another. D) requires DNA polymerase.

C

70) If Hershey and Chase had used radioactive oxygen in their experiments instead of phosphorus and sulfur, what results would they have likely obtained? A) They would have observed a radioactive signal in the pellet only. B) They would have observed a radioactive signal in the liquid only. C) They would have observed a radioactive signal in both the pellet and the liquid. D) They would have not observed radioactivity anywhere.

C

73) What nucleotide sequence would be found on the partner DNA strand: ACTGT? A) ACTGT B) UGAGA C) TGACA D) TGUGU

C

74) If the left end of the daughter strand indicated by the arrow in the figure is being synthesized in one continuous piece, then A) the DNA at point A is being synthesized in one continuous piece. B) the DNA at point B is being synthesized in small pieces. C) the DNA at point C is being synthesized in one continuous piece. D) the DNA at point D is being synthesized in one continuous piece.

C

78) Which of the following shows the steps of a viral infection in the proper order? A) virus locates host cell → enters nucleus → alters host cell DNA → destroys cell membrane B) virus locates host cell → alters host cell DNA → host cell produces copies of virus → copies enter host cell nucleus → nucleus leaves cell C) virus locates host cell → penetrates cell membrane → enters nucleus → alters host cell DNA → host cell produces copies of virus D) virus locates host cell → forms hydrogen bonds → changes DNA to RNA→ host cell produces copies of virus

C

83) The term "gene expression" refers to the A) fact that each individual of a species has a unique set of genes. B) fact that individuals of the same species have different phenotypes. C) process by which genetic information flows from genes to proteins. D) flow of information from parent to offspring.

C

87) Proteins that bind to DNA and turn on operons by making it easier for RNA polymerase to bind to a promoter are called A) regulators. B) operators. C) activators. D) repressors.

C

89) The expression of the tryptophan operon is controlled by A) a repressor that is active when it is alone. B) a repressor that is inactive when it binds to lactose. C) a repressor that is active when it binds to tryptophan. D) an activator that turns the operon on by binding to DNA.

C

90) Which of the following is likely to occur in E. coli cells that are grown in skim milk? A) The lac operon is shut off, and the cells will not produce lactose-utilizing enzymes. B) The trp repressor is activated, and the cells will produce lactose-utilizing enzymes. C) The trp operon is turned on, but the bacteria will not produce lactose-utilizing enzymes. D) The trp operon and the lac operon are both switched off.

C

95) The relationship between DNA and chromosomes is most like A) an egg yolk inside of an egg. B) a spoon cradling some peas. C) thread wrapped around a spool. D) the candy shell surrounding the chocolate in a piece of M&M candy.

C

97) The tortoiseshell pattern on a cat A) usually occurs in males. B) is the result of a homozygous recessive condition. C) results from X chromosome inactivation. D) is a result of alleles on the Y chromosome.

C

98) Both prokaryotic and eukaryotic cells use ________ to turn certain genes on or off. A) RNA transcriptase B) intron segments C) proteins D) nucleosome packing

C

99) Enhancers are A) adjacent to the gene that they regulate. B) required to turn on gene expression when transcription factors are in short supply. C) DNA sequences to which activator proteins bind. D) required to facilitate the binding of DNA polymerases.

C

105) RNA interference (RNAi) can be used by A) researchers to induce the production of more mRNA. B) researchers to artificially turn on gene expression. C) viruses to stop the production of new proteins. D) cells to prevent infections from double-stranded RNA viruses.

D

107) Which of the following mechanisms of controlling gene expression occurs outside of the nucleus? A) adding a cap and tail to RNA B) DNA packing/unpacking C) RNA splicing D) translation

D

11) Which of the following statements regarding a DNA double helix is true? A) The amount of adenine is equal to the amount of uracil, and the amount of guanine is equal to the amount of cytosine. B) The amount of adenine is equal to the amount of guanine, and the amount of thymine is equal to the amount of cytosine. C) The amount of adenine is equal to the amount of cytosine, and the amount of guanine is equal to the amount of thymine. D) The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine.

D

111) In multicellular organisms, the coordination of cellular activities relies on A) cell receptors that detect transcription factors. B) the availability of certain "key" nutrients as cells divide. C) operons. D) cell-to-cell signaling and signal transduction pathways.

D

116) Signal transduction pathways A) are found strictly in multicellular organisms which require cell-to-cell communication. B) are limited for use in sexual identification. C) originally evolved in vertebrates. D) are mechanisms of communication that probably evolved in ancient prokaryotes.

D

121) The use of cloning to produce special embryonic stem cells is called A) regenerative cloning. B) transplantational cloning. C) reproductive cloning. D) therapeutic cloning.

D

123) Which of the following possible uses of reproductive cloning is still considered by most to be an unresolved ethical issue? A) the production of genetically identical animals for experimentation B) cloning mammals for the production of potentially valuable drugs C) the production of organs in cloned pigs for transplant into humans D) the reproductive cloning of humans

D

125) Adult stem cells have limited therapeutic potential A) because they are fully differentiated. B) because they lack a complete set of genes. C) due to their excessive numbers in tissues. D) because their developmental potential is limited to certain tissues.

D

127) Which of the following statements about proto-oncogenes is false? A) Proto-oncogenes are normal genes with the potential to become oncogenes. B) Many proto-oncogenes code for growth factors. C) A mutation must occur in a cell's DNA for a proto-oncogene to become an oncogene. D) If a proto-oncogene's gene product is produced in smaller quantities, a cell may become cancerous.

D

13) If one strand of DNA is CGGTAC, then the corresponding strand would be A) GCCTAG. B) GCCAUC. C) TAACGT. D) GCCATG.

D

131) Mutations in the proto-oncogene ras and the tumor suppressor gene p53 A) increase protein synthesis by the cell. B) can improve the chance of avoiding cancer as one ages. C) can enhance further mutations, which can develop into cancer. D) disrupt normal regulation of the cell cycle.

D

133) The carcinogen known to cause the most cases and types of cancer is A) X-rays. B) ultraviolet light. C) alcohol. D) tobacco.

D

136) There is a mutation in a promoter next to a gene such that RNA polymerase can never bind. What steps must occur for the gene to be transcribed? A) An activator protein must bind an enhancer. B) The DNA must physically bend so that the activator is close to the promoter. C) Transcription factors must bind to the activator and promoter. D) Transcription will never take place in this specific example.

D

140) In terms of gene regulation, what do eukaryotes and prokaryotes have in common? A) operons such as the lac operon and the trp operon B) elaborate packing of DNA into chromosomes C) activator proteins that bind to DNA D) promoters that bind RNA polymerases

D

141) A cell has a mutation in both alleles of its p53 gene that causes the p53 protein to be three times as effective as normal. What do you predict would happen to this cell? A) The cell would divide three times as fast and would lead to cancer. B) The cell would divide into six daughter cells instead of two and would lead to cancer. C) The cell would divide with mutated DNA and would lead to cancer. D) The cell would divide normally or possibly not at all.

D

142) Which of the following molecules are not required to express a gene in eukaryotic cells? A) RNA polymerase B) DNA-bending protein C) activator protein D) repressor protein

D

145) Which of the following statements regarding skin cells and muscle cells in your body is true? A) Muscle cells contain information about muscle proteins but not about skin color. B) Skin cells contain information skin color but not about muscle proteins. C) Muscle cells contain information about skin color but not about muscle proteins. D) Skin cells and muscle cells each contain information about both muscle proteins and skin color.

D

149) Melanoma (skin cancer) can develop after several mutations occur in skin cells. If a woman is diagnosed with melanoma and becomes pregnant, what are the chances that her offspring will inherit melanoma? A) The offspring will certainly be born with melanoma. B) There is a chance, but it depends on how serious the mother's melanoma is. C) There is a chance, but it depends on whether or not the father has melanoma. D) It is unlikely that the offspring will be born with melanoma.

D

151) What is the correct order of structures in a chromosome from smallest to largest? A) nucleotide, nucleosome, histone, supercoil, tight helical fiber, chromosome B) nucleosome, nucleotide, histone, tight helical fiber, supercoil, chromosome C) nucleotide, histone, tight helical fiber, nucleosome, chromosome, supercoil D) nucleotide, histone, nucleosome, tight helical fiber, supercoil, chromosome

D

152) A cell is expressing the mutant form of ras, but one of the downstream relay proteins is not present because of another mutation. How will cell division be affected in this scenario? A) Cell division will decrease because the mutant form of ras decreases cell division. B) Cell division will increase because the mutant form of ras increases cell division. C) The cell will divide normally. D) The cell will not divide at all unless other proteins that stimulate cell division are present.

D

154) In this drawing of the lac operon, which molecule is an inactive repressor? A) molecule A B) molecule B C) molecule C D) molecule D

D

155) Which structure in this figure shows one complete nucleosome? A) structure A B) structure B C) structure C D) structure D

D

157)All apples in the United States, regardless of variety or where they're purchased, are produced by cloning. For more than 2,000 years, apple growers around the world have used a type of cloning called grafting to produce larger, better-tasting apples. Why has cloning become the primary method of apple growing? Apples grown from seeds usually don't produce apples with the same taste and appearance as that of the parent tree because there's a high degree of genetic variability among the seeds. Making identical genetic copies of the preferred fruit is the only way to get reliable apple quality. In grafting, the shoots and branches of the desired fruit, called a scion, are attached onto the trunk and root system of a previously existing tree, called the rootstock. Both components of the graft are needed because the rootstock controls gene expression in the scion, triggering production of apples that match the cloned scion. Grafting research can be used to produce some interesting tree combinations that are beneficial for intensive agriculture. For example, if you graft the root of a small tree variety, such as the crab apple, onto the shoot from a larger apple tree, such as the Gala, you can produce Gala apples on a much smaller tree. Other scientists are trying to create disease-resistant varieties that would need fewer pesticides. This is beneficial for the environment and also lowers the price of apples in the grocery store. Why don't the grafted hybrids produce apples with a blend of traits from the scion and the rootstock? A) The rootstock suppresses activation of the scion genes, which alters fruit production. B) The rootstock is unable to perform photosynthesis and so can't produce fruit. C) Transplanted nuclei from scion cells regulate gene expression in the rootstock. D) The rootstock regulates gene expression in the scion but contributes no genetic information for fruit production.

D

159) All of the trees in an orchard were derived from the same rootstock, but half had scion "A" grafted and the other half had a different scion, scion "B," grafted. The trees that were grafted with scion "A" developed large fruits. What characteristics do you think the fruit from the trees that were grafted with scion "B" will have and why? A) The fruits will be large because the trees share the same rootstock. B) The fruits will be large because all scions produce the same kind of fruits. C) The fruits will be small because the trees share the same rootstock. D) There is not enough information to know what the fruit will look like

D

17) Which of the following enzymes catalyzes the elongation of a new DNA strand? A) helicase B) ligase C) single-stranded binding protein D) DNA polymerase

D

170) _____________ are a major source of restriction enzymes. A) Plant cells B) Human cells C) Archaea cells D) Bacterial cells

D

172) Restriction enzymes specifically recognize and cut short sequences of DNA called A) introns. B) exons. C) sticky ends. D) restriction sites.

D

173) "Sticky ends" are A) produced by the action of DNA ligase. B) produced by PCR. C) always long sequences of a single nucleotide. D) DNA fragments with single-stranded ends.

D

178) Genomic libraries can be constructed using either bacterial plasmids or what other vector? A) ribosomes B) tRNA C) human chromosomes D) bacteriophages

D

180) A cDNA library differs from a genomic library in that A) the cDNA was constructed from introns only. B) genomic libraries are only stored in bacterial cells. C) cDNA libraries are more stable. D) cDNA libraries only contain information from genes that have been transcribed.

D

181) An advantage of using reverse transcriptase to prepare a gene for cloning is that A) reverse transcriptase is more efficient than RNA polymerase. B) the resulting DNA strand will lack exons. C) reverse transcriptase is more efficient than DNA polymerase. D) the resulting DNA strand will lack introns.

D

193) In order for gene therapy to be permanent in the patient being treated, A) the defective gene must first be removed from all somatic cells. B) the normal gene must be added to the germ line cells. C) the normal gene must first be treated with UV radiation to ensure noninfectivity. D) the normal gene must be transferred to somatic cells that can continuously multiply.

D

198) Gel electrophoresis sorts DNA molecules on the basis of their A) nucleotide sequence. B) ability to bind to mRNA. C) solubility in the gel. D) size.

D

199) During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples according to their size. A) sample mixture B) positively charged electrode C) negatively charged electrode D) agarose gel

D

203) Which of the following pieces of evidence would be considered the best for establishing biological relatedness? A) birth certificates B) pictures from family reunions C) testimony from relatives D) a very close match in the DNA profile

D

206) Which of the following statements about genomics is false? A) The first complete genome to be sequenced was a prokaryote. B) Whole sets of genes and their interactions are studied in the field of genomics. C) Genes from different species that have analogous sequences suggest similar function. D) DNA technology limits genomic studies to prokaryotes.

D

213) The number of proteins in humans A) is approximately equal to the number of genes. B) cannot be determined because the human genome is too complex. C) is less than half the number of genes. D) is much greater than the number of genes.

D

215) Approximately what percentage of the human genome is identical to that of a chimpanzee? A) 50.0% B) 62.3% C) 92.0% D) 98.8%

D

218) Which of the following is an example of a genetically modified organism but not a transgenic organism? A) Flavr Savr peaches (peaches that express larger quantities of a peach stability enzyme) B) Golden Rice (rice that expresses daffodil and bacteria beta-carotene synthesis enzymes) C) AquAdvantage salmon (Atlantic salmon that expresses Chinook salmon growth hormone) D) Roundup Ready soybeans (soybeans that express bacterial pesticide enzymes)

D

219) You are setting up a PCR reaction and add a primer for one end of the target sequence, but you forget to add the primer for the other end of the target sequence. If you added the other necessary components, what do you expect to observe after running the PCR reaction for 40 cycles? A) The PCR reaction will produce billions of copies of the target DNA. B) The PCR reaction will produce millions of copies of the target DNA. C) The PCR reaction will produce one copy of the target DNA. D) The PCR reaction will produce zero copies of the target DNA.

D

220) Biotechnology companies sell kits that allow you to do PCR to amplify STR regions from human blood samples that you have collected. What components would you expect to find in the kit in order to be able to do successful PCR reactions? A) human DNA polymerase, primers that flank STR regions B) heat-stable DNA polymerase, primers that flank STR regions C) human DNA polymerase, primers that flank STR regions, free nucleotides D) heat-stable DNA polymerase, primers that flank STR regions, free nucleotides

D

237) Based on analysis of the STR sites shown, does the missing pilot belong to any of these three families? A) No, none of the families match. B) Yes, family 1 matches. C) Yes, family 2 matches. D) Yes, family 3 matches.

D

238) Based on analysis of the STR sites shown, which family is the missing pilot least likely to belong to? A) family 1 B) family 2 C) family 3 D) Family 1 and family 2 are equally unlikely.

D

239) Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing and frequent lung infections. Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death). If you wanted to produce a recombinant form of DNase I, what cell type should you use? A) E. coli B) yeast C) mammalian D) plant

D

25) In the genetic code, A) some codons specify more than one amino acid. B) some codons consist of two nucleotides. C) some amino acids are not specified by any codons. D) many amino acids are specified by more than one codon.

D

32) Which of the following is a function of a tRNA molecule? A) recognizing the appropriate anticodons in Mrna B) transferring nucleotides to rRNA C) helping to translate codons into nucleic acids D) joining to only one specific type of amino acid

D

34) Which of the following statements about ribosomes is false? A) A ribosome consists of two subunits. B) Ribosomal subunits are made of proteins and ribosomal RNA. C) The ribosomes of prokaryotes and eukaryotes are the exactly the same in structure and function. D) Each ribosome has two binding sites for tRNA molecules.

D

37) Which of the following statements regarding the flow of genetic information is false? A) Polypeptides form proteins that determine the appearance and function of the cell and organism. B) Eukaryotic mRNA is processed in several ways before export out of the nucleus. C) Transcription occurs in the cytoplasm of eukaryotic cells. D) Ribosomes function as factories that coordinate the functioning of mRNA and tRNA.

D

39) Consider the following sentence: "The dog did not eat." Which of the following variations of this sentence is most like a base substitution mutation? A) The dog did not et. B) The dog dog did not eat. C) The did dog not eat. D) The doe did not eat.

D

44) Which of the following statements is false? A) Some prophage genes can cause the transformation of a nonpathogenic bacterium into a form that causes human disease. B) Sometimes an environmental signal can trigger a switchover from the lysogenic to the lytic cycle. C) The lysogenic cycle always occurs inside of host cells. D) The lysogenic cycle typically results in the rapid lysis of all infected cells.

D

48) Which of the following statements about plant viruses is false? A) Once in a plant, a virus can spread from cell to cell through plasmodesmata. B) The genetic material in most plant viruses is RNA. C) Preventing infections and breeding resistant plants can control viral infection in plants. D) There are many successful ways to rid infected plants of a virus.

D

53) HIV does the greatest damage to A) the adrenal glands. B) pancreatic cells. C) nervous tissue. D) white blood cells.

D

55) Which of the following statements about treatment or prevention of a prion infection is true? A) Antibiotic therapies such as penicillin are very effective cures. B) High doses of anti-inflammatory drugs such as ibuprofen reduce the symptoms of prion infections. C) Preventative vaccines have recently been shown to be effective in preventing prion infections. D) There is no known treatment or cure for prion infections.

D

59) Conjugation, transformation, and transduction are all ways that bacteria A) reduce their DNA content. B) increase the amount of RNA in the cytoplasm. C) increase their genetic diversity. D) alter their oxygen requirements.

D

60) A friend accidentally sends an email to you that contains a computer virus from his computer. Without knowing it, you infect your computer with the virus when you open the email. This process of spreading the computer virus via email is most like which of the following processes? A) binary fission B) conjugation C) transduction D) transformation

D

63) Conjugation between a bacterium that lacks an F factor (F-) and a bacterium that has an F factor on its chromosome (F+) could produce which of the following results? A) The F- bacterium ends up carrying one or more plasmids from the F+ bacterium the F+ bacterium is unchanged. B) The F+ bacterium ends up with a recombinant chromosome that carries some genes from the F- bacterium, and the F- bacterium ends up with an unaltered chromosome. C) The F+ bacterium ends up with a recombinant chromosome that carries some genes from the F- bacterium, and the F- bacterium ends up with a chromosome that lacks those genes. D) The F- bacterium ends up with a recombinant chromosome that carries some genes from the F+ bacterium, and the F+ bacterium ends up with an unaltered chromosome.

D

64) Which of the following human activities has contributed to an increase in the number of bacteria having R plasmids? A) nitrogen fixation by genetically engineered plants B) improper use of restriction enzymes in research and medical facilities C) increased carcinogen exposure from excessive fossil fuel burning D) heavy use of antibiotics in medicine and in agriculture

D

67) A single base mutation occurs in a gene that codes for a protein due to an error in DNA replication. Which of the following outcomes would possibly not occur? A) The mutation results in improved, the same, or diminished protein function. B) The mutation results in a longer or shorter protein or a protein of the same length. C) The mutation results in a human disease such as sickle-cell disease. D) The mutation results in mRNA being made from the protein.

D

71) You are interested in designing an experiment to test the hypothesis that frogs use the same genetic code as humans. Which of the following experiments would not give you useful data to test this hypothesis? A) Purify tRNAs from frog cells and human cells and compare their structures. B) Insert a human gene into a frog cell and see if the correct protein is produced. C) Insert a frog gene into a human cell and see if the correct protein is produced. D) Compare nucleotide sequences of promoters from similar frog and human genes.

D

75) Using the genetic code below, what protein sequence does the RNA sequence CUAGCUCGAUAUCUC code for? A) Asp - Ala - Arg - Ile- Leu B) Val - Arg - Ala - Phe - Stop C) Leu - Gly - Tyr - Ala — Leu D) Leu - Ala - Arg - Tyr - Leu

D

8) How would the shape of a DNA molecule change if adenine paired with guanine and cytosine paired with thymine? A) The DNA molecule would be longer. B) The DNA molecule would be shorter. C) The DNA molecule would be circular. D) The DNA molecule would have irregular widths along its length.

D

84) A gene operon consists of A) a transcribed gene only. B) a promoter only. C) a regulatory gene only. D) transcribed genes, an operator, and a promoter.

D

9) Which of the following statements regarding the structure of DNA is false? A) The DNA molecule has a uniform diameter. B) In a DNA molecule, adenine bonds to thymine and guanine to cytosine. C) Watson and Crick received a Nobel Prize for their description of the structure of DNA. D) The sequence of nucleotides along the length of a single DNA strand is restricted by the base-pairing rules.

D

96) In female mammals, the inactive X chromosome in each cell A) can be activated if mutations occur in the active X chromosome. B) is broken down, and its nucleotides are degraded and reused. C) is absorbed and used in energy production. D) becomes a Barr body.

D

Diabetes mellitus is a metabolic disease that is characterized by the buildup of glucose in the blood, or hyperglycemia. Diabetes results either from the pancreas not being able to produce the hormone insulin (type 1 diabetes) or if the body's cells become resistant to insulin (type 2 diabetes). Insulin is a protein that binds to receptors on cell surfaces to allow glucose to enter the cell. In order to manage the disease, type 1 diabetics require frequent insulin injections. Until the 1970s, insulin was obtained from processing the pancreases of large mammals such as cows and pigs, it was then purified for medicinal use. This all changed in the 1970s with the advent of recombinant DNA technology, which allows scientists to insert genes from other species into bacterial plasmids and have bacteria produce proteins from these other species' genes. In 1978, the gene that codes for human insulin was added to a bacterial plasmid and bacteria were used to produce human insulin. These bacteria acted as mini-factories that produced human insulin for type 1 diabetes patients. Today, the production of human insulin from bacteria is commonplace and is a multibillion dollar market for pharmaceutical companies. 80) In order for bacterial cells to be able to produce the human insulin protein, which of the following do not have to be true? A) Bacteria and humans have to use the same genetic code. B) Bacterial RNA polymerases have to recognize human promoters. C) Bacterial ribosomes have to recognize human start and stop codons. D) Bacteria have to have a gene for a bacterial form of insulin.

D

Exposure to the HIV virus doesn't necessarily mean that a person will develop AIDS. Some people have genetic resistance to infection by HIV. Dr. Stephen O'Brien from the U.S. National Cancer Institute has recently identified a mutant form of a gene, called CCR5, that can protect against HIV infection. The mutation probably originated in Europe among survivors of the bubonic plague. The mutated gene prevents the plague bacteria from attaching to cell membranes and, therefore, from entering and infecting body cells. Although the HIV virus is very different from the bacteria that causes the plague, both diseases affect the exact same cells and use the same method of infection. The presence of the mutated gene in descendants of plague survivors helps prevent them from contracting AIDS. Pharmaceutical companies are using this information as the basis for a new approach to AIDS prevention. This could be very important in areas of the world where the mutation is scarce or absent, such as Africa. 77) The most likely method by which the mutated CCR5 gene prevents AIDS is by A) covering the cell membrane. B) rupturing the nuclear membrane. C) attacking and destroying the HIV virus particles. D) coding for a protective protein in the cell membrane.

D