Biology Chapter 4,10

Events of Transcription: the cellular process that involves the transfer of information from DNA to a molecule of messenger RNA (mRNA)

1). RNA polymerase binds to a promoter on DNA, initiating transcription. 2). RNA polymerase peels open the double helix DNA, which one strand serving as a template for the formation of RNA. 3). The RNA transcript is processed to remove segments that do not encode for amino acids and to splice together those that do

What mitochondrial feature enhances cellular respiration?

Cristae. These folds increase the surface area of the membrane, allowing more proteins to be embedded and thus enhancing the ability of the mitochondrion to produce ATP.

The structural framework in a cell is the...

Cytoskeleton. It is the structural framework in a cell.

Which one of the following does not play a role in translation?

DNA. It contains the instructions for making proteins, but these instructions are transcribed to RNA before translation occurs.

What component of the cell membrane connects signals from the outside of the cell with the inside of the cell and vice versa?

Integrins. It spansM the membrane and integrate signals, transmitting information between the extracellular matrix and the cytoskeleton of the cell.

Where in a cell is ATP made?

Mitochondria. Where ATP is made

Where is a bacterial cell's DNA found?

Nucleoid region. Bacteria lack a nucleus; their DNA is found in the nucleoid region.

Which of the following is a function of the central vacuole?

Storing compounds produced by the cell.

Which of the following catalyzes the linkage between nucleotides to form RNA?

The enzyme responsible for transcription is RNA polymerase.

The site of translation is...

Translation occurs at ribosomes in the cell cytoplasm.

Most animal cells are.....

embedded in an extracellular matrix.

Light microscopes.

use light and glass lenses to magnify an image

Which of the following events occurs during transcription?

A molecule of RNA is formed based on the sequence of nucleotides in DNA. During transcription, RNA nucleotides line up with their complementary DNA partners, transcribing the information in DNA into RNA.

Which of the following organelles break down worn-out organelles?

Lysomes. It contains digestive enzymes and break down worn out organelles.

The cells of a person with adrenoleukodystrophy (ALD) swell with a buildup of fatty acids. In other words, fatty acids are not being broken down. Which organelle is most likely failing to function correctly?

Lysosome. This organelle functions to remove unwanted or unneeded material from the cell.

Which plant cell organelle converts chemical fuel into packets of chemical energy that can power the cell?

Mitochondrion In both plant and animal cells, it's the mitochondria that converts chemical fuel into packets of chemical energy that can power the cell.

The structure that regulates the passage of material into and out of this bacterial cell is indicated by the letter _____.

Plasma membrane (not the outter membrane) is selectively permeable.

What structure acts as a selective barrier, regulating the traffic of materials into and out of the cell?

Plasma membrane. It surrounds the cell and regulates the movement of materials into and out of cell.

Pancreatic cells produce large amounts of proteins. About how many ribosomes would you expect there to be in a pancreatic cell?

Several million. There are several million ribosomes in cells, such as the cells in the pancreas that produce digestive enzymes.

Where are lipids made in the cell?

Smooth endoplasmic reticulum (ER).

Which of the following describes the function of the chloroplast?

The chloroplast converts light energy to chemical energy to make food.

GPCRs are receptor proteins found in the plasma membrane that are important for cellular communication. What cellular structure makes GPCRs?

The rough endoplasmic reticulum

What do the rough endoplasmic reticulum, Golgi apparatus, and lysosomes have in common?

They are constructed of interrelated membranes. Each of these organelles is a member of the endomembrane system and is constructed of the same type of membrane.

When elongated, tube-shaped cells from the lining of the intestine are treated with a certain chemical, the cells sag and become rounded. The internal structures disrupted by this chemical are probably __________.

microtubules. They are cytoskeletal components, and the shape of a cell is determined by its cytoskeleton.

The protein measured in the cells was likely synthesized by________.

ribosomes.

One of the ways smooth endoplasmic reticulum (ER) differs from rough endoplasmic reticulum is that rough ER is covered by ____.

ribosomes. ribosomes dock on the rough ER, and proteins are completed inside the rough ER.

____ are surface appendages that allow a bacterium to stick to a surface.

Fimbriae. It enable bacterial cells to stick to a surface.

A 100 mm x 100 mm x 100 mm cell has a surface area that is _____ and a volume that is _____. When this volume is broken into many smaller cells, that are 10 mm x 10 mm x 10 mm, the sum of the surface areas of the smaller cells is _____ than the surface area of the initial cell.

60,000 mm2 ... 1,000,000 mm3 ... larger The smaller cell has a larger surface (600 mm2) to volume (1,000 mm3) ratio. This accounts for why most cells are microscopic.

Which of the following statements about the cytoskeleton is false?

Answer: Once laid down, the elements of the cytoskeleton are fixed and remain permanently in place. ------------ Others... The cytoskeleton plays an important role in amoeboid motion. The cytoskeleton is composed of three types of fibers: microfilaments, microtubules, and intermediate filaments. The cytoskeleton helps to support cells.

What is the transcription product of the sequence GCTAGCGATGAC?

CGAUCGCUACUG

What name is given to the rigid structure, found outside the plasma membrane, that surrounds and supports the bacterial cell?

Cell wall. It is a rigid supporting structure.

______are found only in plant cells, but_______are found in both plant and animal cells.

Central vacuoles; ribosomes. Central vacuoles are found only in plant cells. Ribosomes are found in both plant and animal cells.

The complex of proteins and DNA in a non-dividing cell is called.

Chromatin.

The function of tRNA during protein synthesis is to _____.

Deliver amino acids to their proper site during protein synthesis. Each tRNA molecule is used repeatedly, picking up its designated amino acid in the cytosol, depositing this cargo at the ribosome, and leaving the ribosome to pick up another load.

The primary role of _____ is to bind animal cells together.

Desmosomes. Known as (anchoring junctions) is to bind cells together.

Studies of the endomembrane system often involve the use of a protein that can emit a green fluorescence (glow). A researcher wants to make a video of cell behavior, so she initially tags the outer nuclear envelope of a cell with the fluorescent tag and records for several hours. Later, she sees that the tag is part of a secretory vesicle. The ability to stain protein molecules with a fluorescent dye would most clearly allow researchers to go beyond what they could previously detect with a microscope by allowing them to......

Detect ribosome activity.

_____ aid in the coordination of the activities of adjacent animal cells.

Gap (communicating) junctions allow for the passage of material between cells, thus facilitating communication between these cells.

Which of the following is part of the endomembrane system?

Golgi apparatus. The endomembrane system includes the ER, the golgi apparatus, lysomes, and vasicles. It manufactures, processes, and transports lipids and proteins. The golgi apparatus processes and packages proteins.

After an RNA molecule is transcribed from a eukaryotic gene, portions called __________ are removed and the remaining __________ are spliced together to produce an mRNA molecule with a continuous coding sequence.

Introns (intervening sequences) are removed, and the exons (expressed sequences) are spliced together.

A virus infects a cell and randomly inserts many short segments of DNA containing a stop codon throughout the organism's chromosomes. This will probably cause _____.

Manufactured proteins to be short and defective. Alterations that change an existing codon or insert a stop codon cause a premature termination of the polypeptides.

Know difference of prokaryotes and eukaryotes organelles.

Mitochondria and chloroplasts are organelles that perform vital functions in living cells. Mitochondria in plant cells and animal cells help convert chemical energy from sugar into ATP that the cell can more easily use. This process is called cellular respiration. Chloroplasts are found only in the cells of plants and some algae. Chloroplasts help turn sunlight into sugar in a process called photosynthesis. The sugars generated in photosynthesis can be used by the plant itself during its own cellular respiration, or by animals that eat the plant.

Where is the genetic information of the cell stored?

Nucleus. DNA is the genetic information of the cell, and it is stored in the nucleus.

The _____ is the bacterial structure that acts as a selective barrier, allowing nutrients to enter the cell and wastes to leave the cell.

Plasma membrane. Selectively permeable.

Consider the following sequence and explain what effect the mutation has on the protein that is translated. UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type) UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

Prematurely stops the translation of the protei. The mutation causes the insertion of a stop codon, and this would prematurely terminate the translation of the protein.

What is the function of a bacterium's capsule?

Protection

How does RNA polymerase know where to start transcribing a gene into mRNA?

RNA polymerase binds to the gene's promoter.

One of the ways smooth endoplasmic reticulum (ER) differs from rough endoplasmic reticulum is that rough ER is covered by

Ribosomes dock on the rough ER, and proteins are completed inside the rough ER.

In a bacterium, where are proteins synthesized.

Ribosomes. It is involved in the manufacture of polypeptides (proteins).

Trace the movement of proteins through the endomembrane system and out of cell.

Start----->End Manufacturing at rough ER, transportation of vesicles from ER, Processing of golgi apparatus, transportation of vesicle from golgi, secretion from plasma membrane.

One function of the central vacuole in plant cells is facilitating cell growth: the central vacuole absorbs water and increases in size, expanding the volume and size of the plant cell while doing so. Animal cells, however, do not grow by this method. What is an essential difference between animal and plant cells that could explain how a plant cell can withstand this expansion of the central vacuole?

The plant cell wall provides a more rigid structures. The plant cell can use the central vacuole for growth because the cell wall is rigid.

Which of these cell junctions form a barrier to the passage of materials?

Tight junctions form a barrier that prevents fluids from moving between cells.

Which of the following processes takes place in the cytoplasm of eukaryotic cells?

Translation occurs in the cytoplasm. The processed mRNA molecule leaves the nucleus through a nuclear pore to be translated on a ribosome located in the cytosol.

Which of the following clues would tell you whether a cell is prokaryotic or eukaryotic?

Whether or not the cell is partitioned into compartments by internal membranes. Prokaryotic cells lack an internal membranous compartmentalization whereas eukaryotic cells have membrane-bound organelles.

A scientist wants to examine living cells lining the respiratory tract to determine how the cells use tiny hairs to move dirt and mucus away from the lungs. Which of the following instruments would be best, and why?

a light microscope, because it allows observations of whole, live cells.

The plant cell wall is...

is a protective structure made of cellulose fibrils.

Which of the following does not occur during RNA processing?

mRNA attaches to the small subunit of a ribosome at the beginning of translation.

Which of the following is a correct statement about mRNA?

mRNA undergoes RNA processing in the nucleus and then moves to the cytoplasm for translation.

What carries instructions for making proteins from the nucleus into the cytoplasm?

mRNA. mRNA is the messenger that carries genetic instructions from the nucleus to the cytoplasm.

Chloroplasts are found in ____.

plant cells and some protists. chloroplasts are lens-shaped organelles found in leaves and other green organs of plants and photosynthetic protists.