Biology Final
A certain restriction enzyme cuts between the C and the G when the following DNA sequence is present: CCGG How many DNA fragments (RFLPs) would be produced using this restriction enzyme in the following strand? ATTACCGGTTATTGCCTTGGATACCGGATTATTGGTATCCATTCCGGATTA
4
An examination of the body after death that includes a dissection of vital organs to determine the cause of death is a (an)
Autopsy
Which body system is most closely associated with transport and delivery to cells?
Circulatory
Which body system is most closely associated with hormones and homeostasis?
Endocrine
What system's main role is waste removal?
Excretory/Urinary
Which body system is most closely associated with protection and temperature regulation?
Integumentary (Skin)
What property of DNA causes it to migrate to the positive pole of the electrophoresis apparatus?
Negative charge of the phosphate groups
Which body system is most closely associated with information assessment?
Nervous
When running a gel electrophoresis, DNA will migrate towards the ________ end because DNA has a __________________ charge.
Positive, negative
DNA is cut at specific nucleotide sequences by using what type of enzyme?
Restriction enzyme
Gel electrophoresis separates small segments of DNA based upon what
Size of DNA fragments
Gel electrophoresis is used to separate the fragments of DNA. The larger pieces of DNA will travel ______________ through the gel.
Slower than the smaller fragments
If the sequence of one side of DNA is ATC GTT ACG AAA, what would its complementary DNA strand be on the other side?
TAG CAA TGC TTT
Blood is found at a crime scene. In order to find the blood type you add anti-A serum and the blood clumps. You then add anti-B serum and the blood clumps. What type of blood did you find?
Type AB blood
The smaller the DNA fragment, the
further it moves down the gel
