Cell Bio Final
redundant
(adj.) extra, excess, more than is needed; wordy, repetitive; profuse, lush
Cell movement involves the coordination of many events in the cell. Which of the following phenomena is not required for cell motility? (a) Myosin-mediated contraction at the rear of the moving cell. (b) Integrin association with the extracellular environment. (c) Nucleation of new actin filaments. (d) Release of Ca2+ from the sarcoplasmic reticulum.
(d) Release of Ca2+ from the sarcoplasmic reticulum.
diploid
(genetics) an organism or cell having two sets of chromosomes or twice the haploid number
Transcription
(genetics) the organic process whereby the DNA sequence in a gene is copied into mRNA
transcription
(genetics) the organic process whereby the DNA sequence in a gene is copied into mRNA
decorin
-GAG -Chondroitan sulfate -Important for ECM structure as it binds Type I collagen
hairpin loop.
-GC-rich sequence in prokaryotes that RNA polymerase recognizes to terminate transcription
sulfhydryl
-SH
sulfhydryl group
-SH
The Cell Theory
1.All organisms consist of one or more cells. 2.The cell is the basic unit of structure for all organisms. 3.All cells arise only from pre-existing cells.
farnesyl group
15 carbons
geranylgeranyl group
20 carbons
How many fatty acids are linked to a glycerol to make a triglyceride molecule? Answers: 1 2 3 4
3
DNA polymerase adds new bases onto the ____ end of the leading strand, and the _____ end of the lagging strand
3';3'
oligosaccharides
3-10 monosaccharides
What is the sequence of the anticodon carried by the intiator tRNA? Answers: 5'-GUA-3' 5'-UAC-3' 5'-CAU-3' 5'-AUG-3'
5'-CAU-3'
Which of the following codons is complementary to the anticodon 5'-GAA-3'? Answers: 3'-UUC-5' 5'-CTT-3' 5'-UUC-3' 5'-CUU-3'
5'-UUC-3'
•replication fork.
A Y-shaped region on a replicating DNA molecule where new strands are growing.
denature
A change in the shape of a protein (such as an enzyme) that can be caused by changes in temperature or pH (among other things).
DNA
A complex molecule containing the genetic information that makes up the chromosomes.
cartilage
A connective tissue that is more flexible than bone and that protects the ends of bones and keeps them from rubbing together.
•Barr body.
A dense body formed from a deactivated X chromosome.
concentration gradient
A difference in the concentration of a substance across a distance.
lagging strand
A discontinuously synthesized DNA strand that elongates by means of Okazaki fragments, each synthesized in a 5' to 3' direction away from the replication fork.
spindle equator.
A disk formed during metaphase in which all of a cell's chromosomes lie in a single plane at right angles to the spindle fibers
hydroxyl groups
A functional group consisting of a hydrogen atom joined to an oxygen atom by a polar covalent bond. Molecules possessing this group are soluble in water and are called alcohols.
phosphate group
A functional group consisting of a phosphorus atom covalently bonded to four oxygen atoms
cystic fibrosis
A genetic disorder that is present at birth and affects both the respiratory and digestive systems.
proteasome
A giant protein complex that recognizes and destroys proteins tagged for elimination by the small protein ubiquitin.
proteasomes
A giant protein complex that recognizes and destroys proteins tagged for elimination by the small protein ubiquitin.
•glycosidic bond.
A glycosidic bond is a covalent bond in which a carbohydrate binds to another group, which could also be a carbohydrate. A glycosidic bond is found between the two glucose molecules in maltose.
cap-binding complex
A group of proteins in eukaryotes that binds to the 5′ cap and initiates translation. Aids in exporting mRNA from the nucleus to the cytoplasm and promotes the initial (pioneer) round of translation.
microtubule
A hollow rod composed of tubulin proteins that makes up part of the cytoskeleton in all eukaryotic cells and is found in cilia and flagella.
Dynein
A large contractile protein forming the side-arms of microtubule doublets in cilia and flagella.
16S rRNA
A large polynucleotide (~1500 bases) that functions as part of the small subunit of the ribosome of Bacteria and Archaea and from whose gene sequence evolutionary information can be obtained; its eukaryotic counterpart is 18S rRNA
•DNA ligase.
A linking enzyme essential for DNA replication; catalyzes the covalent bonding of the 3' end of a new DNA fragment to the 5' end of a growing chain.
chromatin remodeling.
A mechanism for epigenetic gene regulation by the alteration of chromatin structure.
Uniport
A membrane transport process that carries a single substance.
Antiport
A membrane transport process that carries one substance in one direction and another in the opposite direction.
Symport
A membrane transport process that carries two substances in the same direction across the membrane.
inosine (I).
A modified nucleotide found occasionally in anticodons that can base-pair with uracil, cytosine, or adenine.
ligand
A molecule that binds specifically to another molecule, usually a larger one.
nucleation site
A place that acts as a nucleus for (starting), in a process of formation such as crystals, or bubbles.
polypeptide
A polymer (chain) of many amino acids linked together by peptide bonds.
TATA box
A promoter DNA sequence crucial in forming the transcription initiation complex.
anaphase-promoting complex (APC).
A protein complex that triggers the separation of sister chromatids and orchestrates the carefully timed destruction of proteins that control progress through the cell cycle; the complex catalyzes the ubiquitylation of its targets.
antibody
A protein that acts against a specific antigen
ubiquitin
A protein that attaches itself to faulty or misfolded proteins and thus targets them for destruction by proteasomes
antigen
A protein that, when introduced in the blood, triggers the production of an antibody
glycoprotein
A protein with one or more carbohydrates covalently attached to it.
gene
A segment of DNA on a chromosome that codes for a specific trait
signal transduction
A series of molecular changes that converts a signal on a target cell's surface to a specific response inside the cell.
monomer
A simple compound whose molecules can join together to form polymers
Monosaccharide
A single sugar molecule such as glucose or fructose, the simplest type of sugar.
minor groove
A smaller groove that spirals around the DNA double helix.
codon
A specific sequence of three adjacent bases on a strand of DNA or RNA that provides genetic code information for a particular amino acid
Fluid
A substance that flows
endosymbiosis
A theorized process in which early eukaryotic cells were formed from simpler prokaryotes.
codons
A three-nucleotide sequence of DNA or mRNA that specifies a particular amino acid or termination signal; the basic unit of the genetic code.
Cholesterol
A type of fat made by the body from saturated fat; a minor part of fat in foods.
macromolecules
A very large organic molecule composed of many smaller molecules
Which of the following pairs of codons might you expect to be read by the same tRNA as a result of wobble? a)CAC and CAU b)AAU and AGU c)CUU and UUU d) GAU and GAA
A) CAC and CAU
The nucleotide ___ is required to form polymers of actin and the nucleotide ___ is needed to form polymers of tubulin
ATP, GTP
the nucleotide____ is required to form polymers of actin and the nucleotide ___is needed to form polymers of tubulin
ATP, GTP
translation start sequence
AUG
•wobble hypothesis.
Ability of the tRNAs to recognize more than one codon; the codons differ in their third nucleotide.
permeable
Able to be passed or soaked through
Differential interference contrast
Accentuates diffraction of the light that passes through a specimen; uses two beams of light
purines
Adenine and Guanine
telophase
After the chromosome seperates, the cell seals off, Final Phase of Mitosis.
promoter clearance
After the first bond is synthesized, the RNA polymerase must clear the promoter. During this time there is a tendency to release the RNA transcript and produce truncated transcripts. This is called abortive initiation and is common for both eukaryotes and prokaroytes[7]. Abortive initiation continues to occur until the σ factor rearranges, resulting in the transcription elongation complex (which gives a 35 bp moving footprint). The σ factor is released before 80 nucleotides of mRNA are synthesized[8]. Once the transcript reaches approximately 23 nucleotides, it no longer slips and elongation can occur. This, like most of the remainder of transcription, is an energy-dependent process, consuming adenosine triphosphate (ATP). Promoter clearance coincides with phosphorylation of serine 5 on the carboxy terminal domain of RNA Pol in eukaryotes, which is phosphorylated by TFIIH.
which if the following functional group is nonpolar? a) alkyl b) alcohol c) aldehyde d) amide
Alkyl
mitotic spindle
An assemblage of microtubules and associated proteins that is involved in the movements of chromosomes during mitosis.
a peptidyl transferase
An enzyme in the ribosome responsible for peptide bond formation during translation.
telomerase
An enzyme that catalyzes the lengthening of telomeres in eukaryotic germ cells.
leading strand
An enzyme that joins RNA nucleotides to make the primer using the parental DNA strand as a template.
primase
An enzyme that joins RNA nucleotides to make the primer using the parental DNA strand as a template.
DNA helicase
An enzyme that unwinds the DNA double helix during DNA replication
fibronectin
An extracellular glycoprotein secreted by animal cells that helps them attach to the extracellular matrix.
pore
An opening through which sweat reaches the surface of the skin.
desmosomes
Anchoring junctions that prevent cells from being pulled apart
centromere
Area where the chromatids of a chromosome are attached
Mosaic
Art consisting of a design made of small pieces of colored stone or glass
cohesion
Attraction between molecules of the same substance
domains
Bacteria, Archaea, Eukarya
cell
Basic unit of life
Nucleotides
Basic units of DNA molecule, composed of a sugar, a phosphate, and one of 4 DNA bases
peptide bonds
Bonds between amino acids
phosphodiester bonds
Bonds between phosphate group and pentose sugar in nucleic acids.
covalent bonds
Bonds created by sharing electrons with other atoms.
a--carbon
C 6
methyl
CH3
Acetyl
COCH3
acetyl
COCH3
You have generated antibodies that recognize the extracellular domain of the Ca2+-pump. Adding these antibodies to animal cells blocks the active transport of Ca2+ from the cytosol into the extracellular environment. What do you expect to observe with respect to intracellular Ca2+?
Ca2+ pumps in the endoplasmic reticulum membrane keep cytosolic calcium levels low.
polysaccharides
Carbohydrates that are made up of more than two monosaccharides
Enzymes
Catalysts for chemical reactions in living things
enzymes
Catalysts for chemical reactions in living things
meiosis
Cell division that produces reproductive cells in sexually reproducing organisms
centrioles
Cell organelle that aids in cell division in animal cells only
mitochondrion
Cell organelle that converts the chemical energy stored in food into compounds that are more convenient for the cell to use
Eukaryotes
Cells that contain nuclei
Prokaryotes
Cells that do not contain nuclei
epigenetic modifications
Changes in cell inheritance that are not due to alterations in the sequence of DNA nucleotides.
hydrophilic amino acids
Charged side chains: Histidine, arginine, Lysine, Glutamate, Asparagine
metaphase
Chromosomes line up in the middle of the cell
chromatin
Clusters of DNA, RNA, and proteins in the nucleus of a cell
exons
Coding segments of eukaryotic DNA.
codon specificity
Codon-Anticodon interaction specifies if this tRNA is used during translation. Must only recognise codons for the right amino acid
What kind of 3-dimensional structure does the N-terminal end of the GFP protein adapt? Answers: Sheet structure Helix structure Coil structure All of the above
Coil structure
transcription factors
Collection of proteins that mediate the binding of RNA polymerase and the initiation of transcription.
Biofilms
Colonies of bacteria that adhere together and adhere to environmental surfaces.
glycerol
Combines with fatty acids to make lipids.
hydrocarbons
Compounds composed of only carbon and hydrogen
kinetochore microtubules.
Connects the centrosome with the kinetochore in the centromere region of the chromosome.
microtubule-organizing centers
Contains centrosomes, spindle poles, basal bodies.
nucleus
Control center of the cell
proofreading
Correcting grammar, spelling, and punctuation
cysteine
Cys, C
What peptides can be produced from poly UAUC
Cys-Pro-Lys-Ala
pyrimidines
Cytosine and Thymine
autonomously replicating sequence (ARS)
DNA sequence that confers the ability to replicate; contains an origin of replication
Brightfield
Dark objects are visible against a bright background Light reflected off the specimen does not enter the objective lens
•poles of the mitotic spindle.
During S phase of the cell replication cycle, the two new MTOCs form the
lamellipodium
Dynamic sheetlike extension on the surface of an animal cell, especially one migrating over a surface.
10.5 base pairs
Each turn of the double helix
microfibrillar sheath
Elastin is organized into elastic fibers, which consist of a core region enriched in elastin proteins surrounded by a tough coating called
During which stage of the translation does the peptide bond formation take place between the amino acid(s) carried by the tRNA at the P site and the amino acid carried by the tRNA at the A site? Answers: All of the above Termination Elongation Initiation
Elongation
Lipids
Energy-rich organic compounds, such as fats, oils, and waxes, that are made of carbon, hydrogen, and oxygen.
heterochromatin
Eukaryotic chromatin that remains highly compacted during interphase and is generally not transcribed.
procollagen proteinases
Extracellular enzymes
primary
First or most significant
nucleoplasm
Fluid inside the nucleus
β-sheet
Folding pattern found in many proteins in which neighboring regions of the polypeptide chain associate side by side with each other through hydrogen bonds to give a rigid, flattened structure.
DNA replication.
For a cell to proliferate, it must be able to accurately copy the vast quantity of genetic information carried in its DNA
Ionic bonds
Formed when one or more electrons are transferred from one atom to another
nucleolus
Found inside the nucleus and produces ribosomes
keratin filaments
From Epidermis ensures strength and adhesion to the junction
Ehlers-Danlos syndrome (EDS
Genetic defect in collagen and connective-tissue synthesis and structure
•sickle-cell disease.
Genetic disorder in which red blood cells have abnormal hemoglobin molecules and take on an abnormal shape.
glutamic acid
Glu, E
GDP
Gross Domestic Product- the total market value of all final goods and services produced annually in an economy
•mitotic chromosome.
Highly condensed duplicated chromosome in which the two new chromosomes (also called sister chromatids) are still held together at the centromere. The structure chromosomes adopt during mitosis.
complementary base pairing
In DNA, T pairs with A; G pairs with C; RNA, U pairs with A and G pairs with C
dyneins
In cilia and flagella, a large motor protein extending from one microtubule doublet to the adjacent doublet. ATP hydrolysis drives changes in dynein shape that lead to bending of cilia and flagella.
precursor form
Inactive form in which some enzymes are secreted
Transmembrane proteins
Integral proteins that span the membrane.
transmembrane proteins
Integral proteins that span the membrane.
coiled-coil dimers
Intermediate filament proteins form __________, which then form tetramers
heterotrimers
Laminins consist of three polypeptide subunits wrapped together to form
•core promoter.
Located immediately upstream of the eukaryotic promoter, DNA sequences to which the basal transcription apparatus binds.
filopodium
Long, thin, actin-containing extension on the surface of an animal cell. Sometimes has an exploratory function, as in a growth cone.
lysine
Lys, K
ribosomes
Makes proteins
glycoproteins
Membrane carbohydrates that are covalently bonded to proteins.
Tight junctions
Membranes of neighboring cells are pressed together, preventing leakage of extracellular fluid
Which of the following components is NOT part of a ribosome? Answers: Ribosomal RNA Messenger RNA Small subunit Large subunit
Messenger RNA
methionine
Met, M
Which of the following structures are made from actin filaments? Answers: Microvilli Filopodia Contractile ring that pinch the cytoplasm in two during cell division All of the above
Microvilli
polar
Molecule with partial charges. Mixes with water.
pumps
Molecules are "pumped" by a transport protein to get across the membrane, requiring energy
facilitated diffusion
Movement of specific molecules across cell membranes through protein channels
amide
NH2
introns
Noncoding segments of nucleic acid that lie between coding sequences.
basal and lateral domains
Not facing the gut Passive glucose uniporter
solenoids
Nucleosomes wrapped into higher order coils
negative numbers.
Numbers less than 0.
Proteins
Nutrients the body uses to build and maintain its cells and tissues
proteins
Nutrients the body uses to build and maintain its cells and tissues
hydroxyl
OH-
ribonuceloside triphosphate
One of the two exposed DNA strands then acts as a template for complementary base-pairing with incoming
semidiscontinuous
One strand is continuous (leading), one strand is discontinuous (lagging)
Phosphate
PO4 3-
phosphate
PO4 3-
anaphase
Phase of mitosis in which the chromosomes separate and move to opposite ends of the cell
Phosphoglycerides
Phospholipids with a glycerol backbone
phosphates
Phosphorous-based nutrients commonly found in fertilizers and pesticides.
proline
Pro, P
translation
Process by which mRNA is decoded and a protein is produced
imino
Proline
γ-tubulin ring
Protein complex in centrosomes from which microtubules grow.
membrane transport proteins
Proteins embedded in the membrane of a cell that assist in the transport of large molecules.
transcription factors (TFs
Proteins that bind promoters and are functional in transcription.
cohesins
Proteins that hold sister chromatids together
basal transcription factors.
Proteins, present in all eukaryotic cells, that bind to promoters and help initiate transcription.
Which of the followings describes the correct order of microtubule assembly? Answers: Microtubule elongation --> sheet assembly --> protofilament assembly --> microtubule elongation Sheet assembly --> microtubule elongation --> protofilament assembly Protofilament assembly --> sheet assembly --> microtubule elongation Microtubule elongation --> sheet assembly --> protofilament assembly
Protofilament assembly --> sheet assembly --> microtubule elongation
quaternary
Provide information, management education, government, research
rho protein
RNA binding protein responsible for terminating transcription
Messenger RNA
RNA molecule that carries copies of instructions for the assembly of amino acids into proteins from DNA to the rest of the cell
terminators
RNA sequences that provide the signal to RNA polymerase for stopping transcription
Ribozymes are known to catalyze which of the following reactions in cells?
RNA splicing
Cas9
RNA-guided DNA endonuclease enzyme associated with the CRISPR, produces single strand breaks in DNA
guide RNAs.
RNAs that guide the insertion or deletion of uridine residues into mitochondrial mRNAs
Beta subunits
Regulatory proteins located in transmembrane area and flanking the alpha pore-forming unit
telomeres
Repeated DNA sequences at the ends of eukaryotic chromosomes.
origin of replication (ORC).
Replication begins at a specific site on DNA
Germ cells
Reproductive cells that give rise to sperm and ovum
Collagen assembly is a multi-step process (see steps below). Which of the following describes the correct order? 1. Single collagen polypeptide chain 2. Triple-stranded collagen molecule 3. Collagen fibril 4. Collagen fiber Answers: 2, 3, 1, 4 2, 1, 4, 3 1, 2, 3, 4 3, 1, 2, 4
Selected Answer: 1, 2, 3, 4
Identify the labeled structures of SARS-CoV-2. Answers: 1: RNA genome; 2: envelope; 3: spike proteins 1: DNA genome; 2: envelope; 3: spike proteins 1: RNA genome; 2: spike proteins; 3: envelope 1: DNA genome; 2: spike proteins; 3: envelope
Selected Answer: 1: RNA genome; 2: spike proteins; 3: envelope
How many amino acids are there in a GFP protein? Answers: 15 103 1020 238
Selected Answer: 238
Which of the following can be attributed to water's high specific heat? Answers: All of the above. A lake heats up more slowly than the air around it. Oil and water do not mix well. Ice floats on water. Sugar dissolves in hot tea faster than in iced tea.
Selected Answer: A lake heats up more slowly than the air around it.
Which of the following molecular structures is not seen in an amino acid? Answers: An amino group A ribose The R group A carboxylic acid group
Selected Answer: A ribose
What kind of macromolecule is used as primers to initiate DNA replication inside the cell? Answers: A short fragment of DNA A short fragment of RNA A short fragment of protein A long fragment of protein
Selected Answer: A short fragment of RNA
Where do the subsequent tRNAs bind on the ribosome (one by one) after the initiator tRNA? Answers: P site A site O site E site
Selected Answer: A site
Which of the following codons is NOT a stop codon? Answers: AUG UAG UAA UGA
Selected Answer: AUG
Which of the following cytoskeleton proteins is also known as microfilaments? Answers: All of the above Intermediate filaments Actin filaments Microtubules
Selected Answer: Actin filaments
Which of the following functional groups are nonpolar? Answers: Alkyl Amide Alcohol Aldehyde
Selected Answer: Alkyl
Lipids are a diverse family of molecules includes: __________________. Answers: Phospholipids Steroids All of the above Fats
Selected Answer: All of the above
Which of the following amino acids contain(s) aromatic ring? Answers: Phenylalanine Tyrosine Tryptophan All of the above
Selected Answer: All of the above
Which of the following functional groups is/are commonly used to modify amino acids? Answers: Acetyl group Methyl group Phosphate group All of the above
Selected Answer: All of the above
Which of the following protein filaments form(s) the cytoskeleton? Answers: Intermediate filaments All of the above Actin filaments Microtubules
Selected Answer: All of the above
Which of the following statements describes protein funciton(s)? Answers: Send signals to cells when there is a change in the external environment Catalyze chemical reactions All of the above Transport molecules into and out of the cell across the cell membrane
Selected Answer: All of the above
Which of the followings is/are provided by cytoskeleton proteins in eukaryotic cells? Answers: Movement All of the above Structure Strength
Selected Answer: All of the above
Regarding SARS-CoV-2 infection, which of the following statements is/are correct? Answers: Coronaviruses infect humans and other animals. Coronaviruses enter the body mainly through the mouth or nose. In order for the virus to get inside a human cell, the protein spikes on the virus's envelope attach to specific proteins on the surface of a cell. The viral membrane fuses with the cell's membrane, releasing the virus's genome into the cell. All of the above.
Selected Answer: All of the above.
The genome of SARS-CoV-2 _____________________________. Answers: contains about 30,000 nucleotides. encodes fewer than 30 proteins. is replicated when the virus infect a cell. The replication process is prone to errors and generates mutations. All of the above.
Selected Answer: All of the above.
Which of the following proteins is/are cytoskeletal proteins? Answers: Microtubules Actin filaments Intermediate filaments All of the above.
Selected Answer: All of the above.
Which of the following statements is/are correct? Answers: SARS-CoV-2 is the name of the virus "severe acute respiratory syndrome coronavirus 2". COVID-19 is the name of the disease caused by SARS-CoV-2. Coronaviruses are a family of viruses that includes SARS-CoV-2. All of the above.
Selected Answer: All of the above.
A phospholipid molecule contains a polar head and a non-polar tail. It is therefore a(n) __________ molecule. Answers: Amphipathic Nonpolar Hydrophilic Polar
Selected Answer: Amphipathic
At which phase of mitosis do the sister chromatids separate from each other? Answers: Anaphase Prophase Metaphase Telophase
Selected Answer: Anaphase
Which of the followings is not a tRNA-binding site located on the ribosome? Answers: A site E site P site B site
Selected Answer: B site
What is the predominant secondary structure of the GFP protein? Selected Answer: Beta-barrel Answers: Random-coil Helix-loop-helix Alpha-helix Beta-barrel
Selected Answer: Beta-barrel
GFP contains a region called chromophore. Where is this located? Answers: Chromophore is randomly located around the beta-barrel Outside of the beta-barrel Chromophore serves as a cap and is located on top of the beta-barrel Buried inside of the beta-barrel
Selected Answer: Buried inside of the beta-barrel
The mature fibronectin protein is a dimer. Where are the disulfide bonds located to link the two fibronectin polypeptides together to form the dimer? Answers: N-terminus C-terminus 5' end 3' end
Selected Answer: C-terminus
Which of the following amino acids contains a sulfur in its structure? Answers: Isoleucine Cysteine Histidine Aspartic acid
Selected Answer: Cysteine
During which of the following processes does the plasma membrane divide in two to form two daughter cells? Answers: Anaphase Cytokinesis Prophase Telophase
Selected Answer: Cytokinesis
Intermediate filaments connect cell-cell junctions called ______. Answers: Tight junction Gap junction Desmosome Adherens junction
Selected Answer: Desmosome
Which of the following sites on a ribosome is the exit site for a tRNA that has "handed in" its amino acid? Answers: O site A site P site E site
Selected Answer: E site
Which of the following extracellluar matrix proteins is not a trimer? Answers: Collagen Laminin Fibronectin None of the above
Selected Answer: Fibronectin
Which of the following codons codes for the amino acid valine? Answers: GCG GUG UUU AAU
Selected Answer: GUG
Which amino acid is coded for by the codon GGU? Answers: Stop codon Serine Glycine Proline
Selected Answer: Glycine
During DNA replication, which of the following enzymes is in charge of unwinding DNA double strands? Answers: Helicase Methyltransferase DNA polymerase RNA polymerase
Selected Answer: Helicase
Which one of the following statements about water is false? Answers: The H atoms and the O atom within water share electrons in covalent bonds. Water is polar molecule with a partial positive charge on one end and a partial negative charge on another end. Hydrogen atoms in water are more electronegative than oxygen atoms. Water has a higher specific heat value than methane. Water is neutral molecule containing ten protons and ten electrons.
Selected Answer: Hydrogen atoms in water are more electronegative than oxygen atoms.
__________ play an important role in organizing lipid molecules with long hydrocarbon tails into biological membranes. Answers: Van der Waals attractions Hydrophobic forces Ionic bonds Hydrogen bonds
Selected Answer: Hydrophobic forces
Where does protein synthesis take place? Answers: In the nucleus In the ribosome In the nucleolus In the plasma membrane
Selected Answer: In the ribosome
Which of the following cytoskeleton proteins form nuclear lamina? Answers: Intermediate filaments All of the above Microtubules Actin filaments
Selected Answer: Intermediate filaments
What is the consequence when TATA-binding protein binds DNA in the process of transcription? Answers: It prevents RNA polymerase from binding to DNA It terminates transcription process It serves as a signal for translation It bends DNA backbone by nearly 90 degrees
Selected Answer: It bends DNA backbone by nearly 90 degrees
Which of the DNA strand is replicated as discontinuous short fragments? Answers: Leading strand. Lagging strand. Both leading and lagging strands. First leading strand then lagging strand.
Selected Answer: Lagging strand.
Which of the following extracellular matrix proteins has a cross-shaped structure? Answers: Integrin Fibronectin Laminin Elastin
Selected Answer: Laminin
Which of the following amino acids has a positively charged side chain? Answers: Lysine Aspartic acid Glycine Alanine
Selected Answer: Lysine
Elastin is organized into elastin fibers. What is the structure that surrounds the core region that is rich in elastin proteins? Answers: Fibronectin repeats Heterotrimers Microfibrillar sheath Fibroblast
Selected Answer: Microfibrillar sheath
Which of the following statements regarding intermediate filaments is incorrect? . Answers: Neurofilaments are expressed in the nerve cells. Nestin is not involved in axon growth. Lamins are expressed in the nucleus. Keratins are distributed in epithelial cells.
Selected Answer: Nestin is not involved in axon growth
Which of the followings is the primary function of the intermediate filament lamins? Answers: Nuclear structure and organization Axon growth Sarcomere organization Axon organization
Selected Answer: Nuclear structure and organization
How are the 2 strands of a DNA molecule replicated? Answers: Both strands are replicated continuously. Both strands are replicated discontinuously. One strand is replicated continuously, one strand is replicated discontinuously. All of the above
Selected Answer: One strand is replicated continuously, one strand is replicated discontinuously.
Where does the initiator tRNA sit on the ribosome? Answers: A site E site P site O site
Selected Answer: P site
Cell membranes are primarily made of _________. Answers: Steroids Waxes Phospholipids Fats
Selected Answer: Phospholipids
Which of the following enzymes is in charge of synthesizing primers to prime DNA replication? Answers: Primase Phosphatase Kinase Helicase
Selected Answer: Primase
What is the full name, 3-letter abbreviation, and 1-letter abbreviation for the following amino acid? Answers: Proline, Pro, P Serine, Ser, S Cysteine, Cys, C Tyrosine, Try, Y
Selected Answer: Proline, Pro, P
At which phase of mitosis does the nuclear envelope break down? Answers: Telophase Anaphase Prometaphase Prophase
Selected Answer: Prometaphase
To initiate transcription, a region of DNA is bound by RNA polymerase and the rest of the transcription machinery. What is the name of this specific region of DNA? Answers: TATA-binding Protein Telomere Promoter Start codon
Selected Answer: Promoter
Which of the following enzymes is responsible for transcribing DNA into RNA? Answers: Gyrase Helicase RNA polymerase DNA polymerase
Selected Answer: RNA polymerase
Fats contain only single bonds in the fatty acid tails are called _______. Answers: Saturated fats. Unsaturated fats. Steroids Adipose tissues
Selected Answer: Saturated fats.
At which phase of mitosis does the nuclear membrane reassemble? Answers: Telophase Prophase Anaphase Metaphase
Selected Answer: Telophase
The process of making mRNA from a DNA molecule is called ________. Answers: Mitosis Transcription Translation DNA replication
Selected Answer: Transcription
The process of synthesizing amino acids from a mRNA strand is called ___________. Answers: DNA replication Transcription Translation Mitosis
Selected Answer: Translation
What is the full name, 3-letter abbreviation, and 1-letter abbreviation for the following amino acid? Answers: Leucine, Leu, L Methionine, Met, M Tryptophan, Trp, W Tryptophan, Trp, T
Selected Answer: Tryptophan, Trp, W
Which of the following amino acids is located within the chromophore region? Answers: Phe114 Ala206 Arg168 Val68
Selected Answer: Val68
All nucleotides are composed of _______________________. Answers: mRNA, rRNA, and tRNA a base, a sugar, and a phosphate group. a base, a sugar, and a scaffold. a base, DNA, and amino acids.
Selected Answer: a base, a sugar, and a phosphate group.
Which of the following components is not part of a "nucleoside"? Answers:a five-carbon sugar a nitrogen-containing base a triphosphate None of the above
Selected Answer: a triphosphate
Which of the following bases is a purine? Answers: thymine cytosine uracil adenine
Selected Answer: adenine
Which of the following cell-cell junctions joins the actin bundle in one cell to those in a neighboring cell? Answers: tight junction desmosome gap junction adherens junction
Selected Answer: adherens junction
Choose the answer that best fits the following statement: Cholesterol is an essential component of biological membranes. Although it is much smaller than the typical phospholipids and glycolipids in the membrane, it is a/an __________ molecule, having both hydrophilic and hydrophobic regions. Answers: oxygen-containing polar hydrophobic amphipathic
Selected Answer: amphipathic
The element present in all organic molecules is ________. Answers: hydrogen carbon nitrogen oxygen
Selected Answer: carbon
Which of the following cell-cell junctions joins the intermediate filaments in one cell to those in a neighboring cell? Answers: tight junction hemidesmosome adherens junction desmosome
Selected Answer: desmosome
An atom of carbon will form __________ bonds with other atoms to completely fill its outer shell of electrons. Answers: four ionic four hydrogen three ionic four covalent three covalent
Selected Answer: four covalent
Cells are connected through different cell-cell junctions. Which of the following junctions form channels that allow small, intracellular, water-soluble molecules to pass from cell to cell? Answers: tight junction gap junction hemidesmosome adherens junction
Selected Answer: gap junction
Which of the following cell-cell junctions anchors cells to the basal lamina? Answers: tight junction desmosome gap junction hemidesmosome
Selected Answer: hemidesmosome
Which of the following is broken when water evaporates? Answers:nonpolar covalent bonds ionic bonds hydrogen bonds polar covalent bonds
Selected Answer: hydrogen bonds
What of the following types of RNA molecules is made into protein? Answers: rRNA mRNA miRNA tRNA
Selected Answer: mRNA
hich of the following RNAs is translated into amino acids? Answers: tRNA siRNA rRNA mRNA
Selected Answer: mRNA
What of the following types of RNA molecules is an essential component of ribosomes? Answers: rRNA mRNA miRNA tRNA
Selected Answer: rRNA
Viruses with mutations that help the virus replicate or infect cells have a ___________. These viruses usually become more common in a population over time. Tracking mutations in viruses can help determine where an outbreak started and how it spread. Understanding how virus populations change over time can also help scientists develop treatments and vaccines. Answers: selective advantage selective disadvantage neutral mutations All of the above
Selected Answer: selective advantage
Which of the following contains all noncoding forms of RNA? Answers: siRNA, rRNA, mRNA siRNA, snRNA, miRNA mRNA, tRNA, rRNA tRNA, mRNA, miRNA
Selected Answer: siRNA, snRNA, miRNA
Which of the following molecules carries an amino acid to the ribosome in the process of translation? Answers: tRNA DNA polymerase RNA polymerase mRNA
Selected Answer: tRNA
Which of the following molecules contains an anticodon arm? Answers: tRNA DNA Ribosome mRNA
Selected Answer: tRNA
Most animal fats form a solid at room temperature, while plant fats remain liquid at room temperature. Which of the following is a feature of lipids in plant membranes that best explains this difference? Answers: longer hydrocarbon tails higher levels of sterols unsaturated hydrocarbons larger head groups
Selected Answer: unsaturated hydrocarbons
A compound contains hydroxyl groups as its predominant functional group. Therefore, this compound ________. Answers:lacks an asymmetric carbon and is probably a fat or lipid should dissolve in water should dissolve in a nonpolar solvent will not form hydrogen bonds with water
Selected Answer: should dissolve in water
Which group of three amino acid side chains can form hydrogen bonds with one another
Serine, Glutamic acid, Tyosine
calcium ions
Serves as the actual "trigger" for muscle contraction by removing the inhibition of the troponin molecules
side chain
Side chain is another name for an R group, and is a group of atoms attached to the main part of a molecule and having a ring or chain structure.
Small interfering RNA
Similar to miRNA, but formed from longer, double stranded RNA molecules
microtubule capping protein.
Since distinct α-tubulin and β-tubulin surfaces are exposed at the two microtubule ends, including the luminal side of the tubulin dimers, it would not be surprising that specific factors could recognize the outmost microtubule tips.
Okazaki fragments
Small fragments of DNA produced on the lagging strand during DNA replication, joined later by DNA ligase to form a complete strand.
Microtubules
Spiral strands of protein molecules that form a tubelike structure
microtubules
Spiral strands of protein molecules that form a tubelike structure
polyribosomes
Strings of ribosomes that work together to translate a RNA message.
Disulfide bonds
Strong chemical side bonds that can only be broken by chemical solutions
lariat structure,
Structure that spliced RNA forms
structural polarity
Term referring to the structural asymmetry of certain polymers; e.g. proteins always display an amino group at one end and a carboxyl group at the other end
How can SARS-CoV-2 virus make more virus inside of a host? Choose the incorrect answer. Answers: The virus's ribosomes translate the virus's RNA into proteins, including viral RNA polymerase. The RNA polymerase transcribes the virus's RNA, making more RNA copies that are translated into proteins. It also makes more copies of the virus's whole genome. The new viral genome and proteins combine to make a new virus that is packaged into an envelope formed from the cell's membranes. Newly formed viruses travel to the cell's surface and are released outside the cell.
The RNA polymerase transcribes the virus's RNA, making more RNA copies that are translated into proteins. It also makes more copies of the virus's whole genome.
mechanical strength
The amount of force a tissue can absorb or resist before failure.
guanine
The base that pairs with Cytosine in DNA
cytosine
The base that pairs with Guanine with DNA
adenine
The base that pairs with Thymine in DNA
amino-terminal (N-terminal
The end of a polypeptide chain with a free amino (-NH2) group.
hologenome
The entire set of genes contained in an organism (those of the host along with those of all its symbionts)
apical domain
The exposed free surface of a polarized epithelial cell.
linker histone
The histone protein H1, which binds to the linker DNA adjacent to the nucleosome.
primary transcript
The initial mRNA transcript that is transcribed from a protein coding gene. Also called pre-mRNA.
euchromatin
The less condensed form of eukaryotic chromatin that is available for transcription.
coding sequence.
The part of a gene that specifies the amino acid sequence of a protein. Coding sequences determine the identity, shape, and function of proteins.
active site
The part of an enzyme or antibody where the chemical reaction occurs.
junctional complexes.
The point at which epithelial cells join to one another in very close proximity
head group
The polar, water-soluble region of a phospholipid that consists of a phosphate group linked to one of several small, hydrophilic molecules.
translocation
The process in which a segment of a chromosome breaks off and attaches to another chromosome.
Shine-Dalgarno sequence
The prokaryotic ribosome-binding site on mRNA, found 10 nucleotides 5' to the start codon.
replication factories
The proteins that are responsible for replicating DNA form large complexes in the nucleus
Dynamic instability
The rapid switching between growth and shrinkage shown by microtubules.
dynamic instability.
The rapid switching between growth and shrinkage shown by microtubules.
genetics
The scientific study of heredity
secondary structure
The second level of protein structure; the regular local patterns of coils or folds of a polypeptide chain.
Multicellularity
The state of being composed of many cells that adhere to each other and do not all express the same genes with the result that some cells have specialized functions.
extracellular matrix
The substance in which animal tissue cells are embedded, consisting of protein and polysaccharides.
lamins
The type of intermediate filament found inside the nucleus.
membrane
These molecules are enclosed in a selective barrier
Intermediate filaments
Threadlike proteins in the cell's cytoskeleton that are roughly twice as thick as microfilaments
intermediate filaments
Threadlike proteins in the cell's cytoskeleton that are roughly twice as thick as microfilaments
anticodons
Three-base sequence in a transfer RNA molecule base that pairs with a complementary codon in mRNA
fibrils
Type I collagen fibers grouped in threes
stop codon
UAA, UAG, or UGA).
fecal microbiota transplantation
Used as tx for C. diff when Vanco/Metro fail or if there are multiple recurrent infections
Hydrogen bonds
Very weak bonds; occurs when a hydrogen atom in one molecule is attracted to the electrostatic atom in another molecule
hydrogen bonds
Very weak bonds; occurs when a hydrogen atom in one molecule is attracted to the electrostatic atom in another molecule
hydrophobic
Water fearing
fibroblast
a cell in connective tissue that produces collagen and other fibers.
kinesin-related motor proteins
a class of motor proteins that are able to move along microtubules
dimer
a compound whose molecules are composed of two identical monomers
α-helix
a delicate coil held together by hydrogen bonding between every fourth amino acid
nuclear matrix.
a framework of protein fibers extending throughout the nuclear interior
Proteoglycans
a glycoprotein consisting of a small core protein with many carbohydrate chains attached, found in the extracellular matrix of animal cells.
phospholipid
a lipid that contains phosphorus and that is a structural component in cell membranes
which of the following enzymes removes the phosphate group that is added to a protein to fine-tune the shape of the protein
a phosphatase
which of the following enzymes removes the phosphate group that is added to a protein to fine tune the shape of the protein
a phosphotase
•integrin complexes.
a protein complex composed of an alpha and beta subunit
mutations
a random error in gene replication that leads to a change
rosettes
a round or oval ornament resembling a rose
Clustered regulatory interspaced short palindromic repeats (CRISPR)
a segment of DNA containing short repetitions of base sequences, involved in the defense mechanisms of prokaryotic organisms to viruses.
a single deoxyribonucleotide change in a DNA coding sequence of the hemoglobin gene
a single deoxyribonucleotide change in a DNA coding sequence of the hemoglobin gene
Van der Waals forces
a slight attraction that develops between the oppositely charged regions of nearby molecules
Hydrophobic interactions
a type of weak chemical interaction caused when molecules that do not mix with water coalesce to exclude water
which of the following statements is false? a) RNA polymerase add bases in a 3' to 5' direction; DNA polymerase bases in a 5' to 3' direction b) RNA polymerase does not proofread its work; DNA polymerase does c) RNA polymerase can start making a new molecule without a primer; DNA polymerase cannot d) RNA polymerase catalyzes the linkage of ribonucleotides while DNA polymerase catalyzes the linkage of deoxyribonucleotides
a) RNA polymerase add bases in a 3' to 5' direction; DNA polymerase bases in a 5' to 3' direction
which of the following is not a way that the nucleus protects DNA from environmental dangers while allowing access to the DNA by proteins needed for replication? a) The nucleus assembles the macromolecules necessary for replication within its membrane, thereby limiting access to the DNA b) The nucleus contains two membranes surrounding the DNA in order to limit access to the DNA c) The nucleus limits access to the DNA through the use of nuclear pore complexes. d) The nucleus restricts access to DNA by wrapping in into a chromatin, thereby only allowing parts of it to be replicated and transcribed at a time.
a) The nucleus assembles the macromolecules necessary for replication within its membrane, thereby limiting access to the DNA
which of the following cytoskeletal proteins is NOT assembled by the coiled-coil structure a) microtubules b) microfilaments c) actin filaments d) intermediate filaments.
a) microtubules
3 A bacterium is suddenly expelled from a warm human intestine into the cold outside world which of the following adjustments might the bacterium make to maintain the same level of membrane fluidity? a) produce lipids with hydrocarbon tails that are shorter and have more double bonds b) produce lipids with hydrocarbon tails that are linger and have fewer double bonds c) produce lipids with hydrocarbon tails that are longer and have more single bonds d) randomly adjust the membrane composition
a) produce lipids with hydrocarbon tails that are shorter and have more double bonds
Which of the following events does NOT occur during interphase? a) the nuclear envelope breaks down b) DNA is replicated c) cells grow in size b) the centrosomes are duplicated
a) the nuclear envelope breaks down
Which of the following statements about prokaryotic mRNA molecules is FALSE? a)Ribosomes must bind to the 5' cap before initiating translation b) mRNAs are not polyadenylated c) Ribosomes can start translating an molecules before transcription is complete d) all the above
a)Ribosomes must bind to the 5' cap before initiating translation
which of the following cytoskeletal proteins is NOT assembled by the "coiled-coil" structure? a)microtubules b)actin filaments c) intermediate filaments d) microfilaments
a)microtubules
proteins that cross the membrane usually do so with ____ structure
a-helix
self-replicating
able to generate a copy of itself
what is also known as microfilaments
actin filaments
which of the following cytoskeletal proteins is primarily in charge of the large scale movement in cells
actin filaments
zonula adherens
adhering type junction that occurs as a sheet between cells
microbiome
all of the microorganisms that live in a particular environment, such as a human body
Selectins
allow cells to adhere to carbohydrates on the surfaces of other cells and are most commonly used in the immune system
The Origin of Life
allowed carbon atoms to form covalent bonds with each other
The hydrolysis of the GTP to GDP carried out by tubulin molecules
allows the behavior of microtubules called dynamic instability
an amino acid is made up of an
alpha carbon linked to hydrogen, amino group, carboxylic acid group and a side chain
P site (peptidyl site),
amino acid is removed from its tRNA; added to growing peptide chain
hydrophobic amino acids
amino acids with long alkyl side chains. Alanine, Leucine, Isoleucine, Valine, Phenylalanine. More likely to be found in the interior of proteins
concentration-dependent
aminoglycosides, quinolones, daptomycin
Molecules like phospholipids that both attract and repel water are called
amphipathic
which of the following membrane transport proteins would not be expected to generate a change in voltage by the movement of its substrate across the membrane where it is found
an aquaporin
kinase
an enzyme that catalyzes the transfer of a phosphate group from ATP to a specified molecule.
Linker proteins
anchor the intracellular cytoskeleton to the extracellular matrix
membrane-spanning domain
anchors the receptor in the cell membrane
which of the following membrane transport proteins is used to transport water molecules across the membrane
aquaporins
What is the binding site for the initiator tRNA needed in translation
arginine
Hemidesmosomes
attach epithelial cells to the basement membrane
which statement best accurately defines the extracellular matrix (EMC) a) The EMC consists of bone, cartilage, and other connective tissues in the extracellular space. b) The EMC consists of insoluble glycoproteins and proteoglycans in the extracellular space. c) The EMC consists of integrins and the proteins they bind to in the extracellular space. d) The EMC consists on integrins, cadherins and their ligands in the extracellular space.
b) The EMC consists of insoluble glycoproteins and proteoglycans in the extracellular space.
which of the following does not occur during M phase in animal cells? a) breakdown of nuclear envelope b) growth of the cell c) separation of chromosomes d) attachment of chromosomes to microtubules
b) growth of the cell
which of the following statements about the function of the centrosome is FALSE? a) centrosomes contain hundreds of copies of the y-tubulin ring complex important for microtubule nucleation b) microtubules emanating from the centrosome have alternating polarity such that some have the plus end attached to the centrosome while others have their minus end attached to the centrosome. c)centrosomes are the major microtubule- organizing center in animal cells d) centrosomes typically contain a pair of centrioles
b) microtubules emanating from the centrosome have alternating polarity such that some have the plus end attached to the centrosome while others have their minus end attached to the centrosome.
Which if these are true? a) The origin of replication is the site where transcription of a gene begins b) the basal transcription complex binds to the promotor of a gene c) RNA polymerase is not modified by phosphorylation during transcription
b) the basal transcription complex binds to the promotor of a gene
Which of the following statements about the genetic code is CORRECT? a) All codons specify more than one amino acid b) the genetic code is redundant c) All amino acids are specified by more then one codon d) all codons specify an amino acid
b) the genetic code is redundant
which of the following statements about intermediate filaments is incorrect? a) a separate gene encodes each type of intermediate filament protein b) these filaments are strong yet unstable elements of the cytoskeleton c) laminin and vimentin belong to separate classes of intermediate filaments in mammals d) these filaments help protect animal cells from mechanical stress
b) these filaments are strong yet unstable elements of the cytoskeleton
Which of the following molecules of RNA would you predict to be the most likely to fold into a specific structure as a result of intramolecular base-paring? a)5'UGUGUGUGUGUGUGUGUGUGUGUGUG3' b)5'CCCUAAAAAAAAAAAAAAAUUUUUUUUAGGG3' c) 5'AAAAAAAAAAAAAAAAAAAAAAAAAAAAA3' d) 5' GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGAAGG3'
b)5'CCCUAAAAAAAAAAAAAAAUUUUUUUUAGGG3'
basal
base
Why does every DNA replication fork generate a leading and lagging strand?
because DNA is an antiparallel double helix
A site (aminoacyl site)
binds to incoming tRNA carrying amino acid
Somatic cells
body cells
native
born in a particular place
clamp-loading complex
both fastens and unfastens the sliding clamp to DNA
Amino acids
building blocks of proteins
which of the following proteins cross-links cytoskeletal proteins together? a) HDAC b) Lamin c) Piectin d) Phosphatase
c) Piectin
The ribosome is important for catalyzing the information of peptide bonds. Which of the following statements is TRUE? a) the number of rRNA molecules that make up a ribosome greatly exceeds the number of protein molecules found in the ribosome b) The large subunit of the ribosome is important for binding to the mRNA c) The catalytic site for peptide bond formation is formed primarily from an rRNA d) once the large and small subunits of the assemble, they will not separate from each other until degraded by the proteasome
c) The catalytic site for peptide bond formation is formed primarily from an rRNA
the disorder progeria is caused by defects in which of the following skeletal proteins? a) microfilaments b) actin filaments c) intermediate filaments d) microtubules
c) intermediate filaments
which of the following is not a motor protein a) myosin b) kinesin c) microtubules d) dynein
c) microtubules
which of the following contains all noncoding forms of RNA a)siRNA, rRNA, mRNA b)mRNA, tRNA, rRNA c) siRNA, snRNA, miRNA d) tRNA, mRNA, miRNA
c) siRNA, snRNA, miRNA
you have a piece of DNA that includes the following sequence: 5'ATAGGCATTCGATCCGGATAGCAT3' 3'TATCCGTAAGCTAGGCCTATCGTA5' Which of the following RNA molecules could be transcribed from this piece of DNA? a)5'UACGAUAGGCCUAGCUUACGGAUA3' b)5'UAUCCGUAAGCUAGGCCUAUGCUA3' c)5'AUAGGCAUUCGAUCCGGAUAGCAU3' d) none of the above
c)5'AUAGGCAUUCGAUCCGGAUAGCAU3'
Cadherins
calcium-dependent glycoproteins that hold similar cells together
cadherins
calcium-dependent glycoproteins that hold similar cells together
charge polarity
can attract one another if the positive side of one is closest to the negative side of the other
transmembrane receptor proteins
can pump molecules against their diffusion gradient and are also involved in promoting and regulating chemical reactions in cells
Sugars
carbohydrates found both in food and in the body
which statement best explains why cells are considered the fundamental unit of life
cells are the smallest structure capable of replicating and repairing themselves
The principal microtubule- organizing center in animal cells is the
centrosome
fatty acids
chains of carbon atoms bonded to hydrogen atoms
Oligopeptides
chains of fewer than 10 or 15 amino acids
which of the following membrane lipids does not contain a fatty acid tail
cholesterol
non-overlapping
codons are read one at a time
genetic code
collection of codons of mRNA, each of which directs the incorporation of a particular amino acid into a protein during protein synthesis
dimerize
combine with a similar molecule to form a dimer
secondary
coming after, less important than, or resulting from someone or something else that is primary.
histone H1
connects DNA to the nucleosome core and connects adjacent cores together
nucleosome core particles
contain 147 base pairs of DNA wrapped around an octamer consisting of two molecules each of histones H2A, H2B, H3, and H4.
Adherens junctions
contain plaque, a dense layer of proteins on the inside of the plasma membrane that attaches both to membrane proteins and to microfilaments of the cytoskeleton
myosin motor proteins
convert the potential energy in ATP into the kinetic energy of mechanical work
Topoisomerase
corrects "overwinding" ahead of replication forks by breaking, swiveling, and rejoining DNA strands
topoisomerase
corrects "overwinding" ahead of replication forks by breaking, swiveling, and rejoining DNA strands
which of the following factors impacts cellular membrane fluidity a) the length of the phospholipid tail b) the presence of the cis-unsaturated fatty acid c) the amount of cholesterol d) all the above
d) all the above
which of the following is/are protein functions? a)proteins speed up chemical reactions b) proteins provide structural support cells c) proteins enable signal transduction d) all the above
d) all the above
which of the following molecules is involved in cell migration a) actin filaments b) integrin c) myosin d) all the above
d) all the above
which of the following statements are correct a)cytoskeleton refers to a network of filamentous proteins found in the cytosol of eukaryotic cells b)the cytoskeleton helps in determining the overall shape of the cell c)the cytoskeleton helps the cell to move d) all the above
d) all the above
which of the following structural elements is included in a phospholipid? a) a backbone b) one or two fatty acids c) a phosphate group d) all the above
d) all the above
for both actin and microtubule polymerization nucleotide hydrolysis is important for
decreasing the binding strength between subunits on filaments
nucleoli
dense masses of RNA and protein that manufacture ribosomes, several of these are located in the nucleus.
•R (side chain).
determines the amino acid
downstream
direction in which a river or stream flows from its source to its mouth
upstream
direction opposite the flow of a river; toward the source of a river or stream
what is the primary covalent bond used to hold the 4 polypeptide chains together
disulfide bond
protocells
droplets with membranes that maintained an internal chemistry different from that of their surroundings
an important difference between dyneins and kinesins is
dyneins move cargo toward the minus ends of microtubules; kinesins move cargo toward the plus ends of microtubules
Why are serine, threonine and tyrosine the only amino acids that can be phosphorylated by protein kinases?
each possesses an -OH group which can be reversibly substituted with a phosphate group.
nuclear pore complexes.
embedded in the nuclear envelope regulate the transport of proteins and RNA molecules between the nucleus and cytoplasm
termination
end
lactase
enzyme that breaks down lactose
separase
enzyme that degrades cohesin
non-polar
equal sharing of electrons
diffusion of chemical characteristics that travel fastest to slowest
estrogen, propanol, alanine, sodium
Transmission Electron microscopes
focus a beam of electrons through a specimen
stereochemical orientation
focuses on stereoisomers, which by definition have the same molecular formula and sequence of bonded atoms
reading frames
following a start codon, a consecutive sequence of codons for amino acids
selective filter
for Broadbent, a model of selective attention emphasizing our tendency to separate information on the basis of physical characteristics (e.g., pitch), then focus on one message, while filtering out other ones
Water protect cells
from overheating due to its high specific heat.
connexin
gap junction protein
point mutation
gene mutation in which a single base pair in DNA has been changed
glucose-Na+ symport
glucose and Na+ go from the gut lumen to the intestine cell against its gradient
phosphoglycerates are composed of a
glycerol backbone with two fatty acyl groups
collagen fibril
group of collagen molecules bound together
anticodon
group of three bases on a tRNA molecule that are complementary to an mRNA codon
GTP
guanosine triphosphate
amphipathic
having both a hydrophilic region and a hydrophobic region
Kozak sequence
helps the ribosome identify the start codon in eukaryotes
carriers
heterozygous individuals who carry the recessive allele but are phenotypically normal
Holobionts
hosts and microbes live together and evolve together
The bond that holds two or more H2O molecules together in liquid water is called a/n __________ Answers: ionic peptide hydrogen covalent
hydrogen
the bond that holds two or more water molecules together in liquid water us called
hydrogen
unsaturated fatty acids do not contain the maximal number of ____ to make them saturated
hydrogen
Polar covalent bonds in water molecules result in
hydrogen bonding
motifs
incidents, image s, or ideas which appear frequently
securin
inhibits separase
keratins
intermediate filament proteins found in epithelial cells; contribute to the mechanical integrity of the cell and also function as regulatory proteins; the primary protein that makes up hair and nails
which of the following cytoskeleton proteins form nuclear lamina
intermediate filaments
random coil
irregular arrangement of the polypeptide chain
which best describes a cadherin
it is a transmembrane receptor protein in a cell-cell junction
Which of the following best describes RNA polymerase II (pol II)
it synthesizes messenger RNAs
Water is an excellent coolant due to
its high heat of vaporization
Cells use membranes to help maintain set ranges of ion concentrations inside and outside the cell. Which of the following ions is the most abundant inside a typical mammalian cell?
k+
which is the structure nuclear Lamina primarily composed of
lamins
polymers
large compound formed from combinations of many monomers
Basement membranes
layer of nonliving material that anchors epithelial tissue to underlying connective tissue
nuclear envelope
layer of two membranes that surrounds the nucleus of a cell
Which level of DNA organization do chromosomes become effectively inactive?
level 5
farnesylation refers to a covalent attachment of____ on membrane proteins
liipids
classical cadherins
like E-cadherins; are single pass TM proteins with 5 extracellular cadherin domains - at least 17 types present in humans
catenins
link cadherins to the actin cytoskeleton
Plectin
links to intermediate filaments
symbionts
live together in an intimate, often permanent, association that may or may not be beneficial to them
Sphingolipids
long fatty acid chain polar head group backbone=amino alcohol (not glycerol)
actin cytoskeleton
long fibers of proteins that encircle the cell just inside the cell membrane and contribute to the shape of the cell
Fibrous proteins
long, insoluble, structural proteins.
protofilaments
longitudinally arranged rows of globular subunits of a microtubule that are aligned parallel to the long axis of the tubule
passive carriers
medical and dental personnel who must constantly handle patient materials that are heavily contaminated with patient secretions and blood risk picking up pathogens mechanically and accidentally transferring them to other patients
integrins
membrane proteins; they transmit signals between the ECM and cytoskeleton
ionic
metal and nonmetal
Filopodia and lamellipodia are associated with which cytoskeletal element
microfilaments
microtubule cytoskeleton
microscopic cylinders that support and give the cell shape, maintain cell structure, movement of organelles within the cell
the microtubules nucleation site refers to the site where
microtubule assembly initiates
protofilaments is a term associated with which cytoskeletal element?
microtubules
which if the following cytoskeletal proteins is NOT assembled by the "coiled-coil" structure
microtubules
what is the consequence to the overall structure of the microtubule when the molecule GTP bound to the beta-tubulin subunits of the dimers is hydrolyzed to GDP
microtubules disassembly is favored
•fluid-mosaic model.
model that describes the arrangement and movement of the molecules that make up a cell membrane
deoxyribonucleotides
monomers of DNA
ribonucleotides
monomers of RNA
kinesin
motor proteins in anterograde transport
Kinesins
move chloroplasts in plant leaves as angle of sun changes
What do flippases do?
move phospholipids from one face of a membrane to the other
protein-RNA scaffold
nuclear scaffold
beads-on-a-string
nucleosome
chromatosome
nucleosome + H1 histone
positive numbers
numbers greater than zero
voltage-gated channels
open and close in response to changes in membrane potential
mitosis
part of eukaryotic cell division during which the cell nucleus divides
a molecule moves down its concentration gradient by ___ transport, but requires___ transport to move up its concentration gradient
passive, active
cell adhesion proteins
perform cell to cell attachments
interphase
period of the cell cycle between cell divisions
apical
pertaining to the apex
polypeptides
polymers of amino acids
excitation
process in which nerve action potentials lead to muscle action potentials
Elastin
protein base similar to collagen that forms elastic tissue
condensins
protein complex that helps configure duplicated chromosomes for segregation by making them more compact
Kinetochores
protein complexes associated with centromeres
Actin filaments
protein fibers that play a role in cell division and shape
histone
protein molecule around which DNA is tightly coiled in chromatin
chaperonins
protein molecules that assist the proper folding of other proteins
Tubulin
protein that makes up microtubules
Peripheral membrane proteins
proteins associated with but not embedded within the plasma membrane
Integral membrane proteins
proteins that are at least partially embedded in the plasma membrane
Gap junctions
provide cytoplasmic channels between adjacent animal cells
substrate
reactant of an enzyme-catalyzed reaction
•chromosome territories.
regions of the nucleus preferentially occupied by particular chromosomes
channels
regulate water flow and solutes through membrane
splicing
removal of introns
small nuclear ribonucleoproteins (snRNPs
remove introns and splice exons together
DNA Polymerase I
removes the RNA primer and replaces it with DNA
nucleosome
repeating subunit of chromatin fibers, consisting of DNA coiled around histones
γ-tubulin
required for microtubule nucleation and located in the centrosomes.
Ligand-gated channels
respond to chemical messengers
RNA
ribonucleic acid
which of the following cellular compartments is not involved in protein degradation
ribosomes
sister chromatid separation occurs because _____ are destroyed by the APC/C
securins
which of the following functions of the plasma membrane is possible without membrane proteins
selective permeability
Primary structure
sequence of amino acids
complementary
serving to complete something
polysomes
several ribosomes that are attached to the same mRNA at one time.
•RNA primer.
short segment of RNA used to initiate synthesis of a new strand of DNA during replication
dynamic structures
skeletal muscles
MicroRNA
small single stranded RNA molecules that bind to mRNA and can degrade mRNA or block its translation.
promoter
specific region of a gene where RNA polymerase can bind and begin transcription
Globular proteins
spherical, water-soluble proteins.
globular proteins
spherical, water-soluble proteins.
backbone
spine
single-stranded binding proteins (SSBPs)
stabilize the open conformation
which of the following can most likely diffuse freely across the plasma membrane
steroid hormones
The microtubules in a cell form a structural framework that can have all the following functions except which one?
strengthening the plasma membrane
linker DNA
stretch of DNA separating two nucleosomes
histone tails.
strings of amino acids that protrude from the histone proteins in the nucleosome
collagen
structural protein found in the skin and connective tissue
cytology
study of cells
subunits
subdivisions of an organization
disaccharides
sucrose, lactose, maltose
ribose
sugar in RNA
glycosylation is a way to modify protein function and structure. glycosyation refers to the attachment of ___ to proteins
sugar molecules
gyrase
supercoiling
when tis transporter moves both ions in the same direction across the membrane it is considered a ___ if the ions move in opposite directions the transporter is considered a ___
symport, antiport
•reverse transcription.
synthesis of DNA from an RNA template
DNA polymerase III
synthesizes new DNA only in the 5' to 3' direction
initiator methionine
tRNA unlike the elongator methionine that initiates transcription by binding in the P site
amino terminus
the "beginning" of an amino acid chain, contains NH2 group
which of the following statements about biological membranes is true
the a-helix is the most common secondary structure found in the transmembrane domain of membrane-spanning proteins
inhibitors of proteasomes are now commonly used as anticancer drugs. which scenario would most likely occur if a cancer cell was suddenly unable to sustain the activity of a proteasomes in its cytosol
the accumulation of inactive unfolded proteins in teh cytosol would interfere with nearly all cell functions, leading to cell death
TFIID
the first general transcription factor to bind the promoter, binds to the TATA box through the TATA binding protein (TBP)
carboxyl terminus
the free carboxyl group at one end of a polypeptide
DNA ligase is needed on
the lagging strand only
major groove
the larger of the two grooves in the DNA double helix
emission filters
the light source is directed through two sets of filters
inner dense plaque
the location on the cytoplasmic side of the plasma membrane where desmoplakin attaches to the intermediate filaments of the cell
what does the protein microtubule capping protein do
the microtubule capping protein caps a microtubule and stabilizes it
passive transport.
the movement of substances across a cell membrane without the use of energy by the cell
transcription start point is
the nucleotide where RNA synthesis actually begins
amide plane.
the plane formed by the atoms that form a peptide bond
the transcription bubble
the region of locally unwound DNA that allows for transcription of mRNA
carbohydrates
the starches and sugars present in foods
kinetics
the study of reaction rates
biochemistry
the study of substances and processes occurring in living things
•tortional rotation.
the twisting of an object due to torque
daughter cells
the two new cells that result from mitosis and cytokinesis
Collagen is similar to intermediate filaments in forming relatively stable structures because
their subunits form coiled-coils
collagen is similiar to intermediate filaments in forming relatively stable structures because
their subunits form coiled-coils
why is it significant that two of the three classes of cytoskeletal protein polymers have plus and minus ends
these polymers bind to motor proteins that move toward the plus or minus ends specifically
which of the following most accurately describes tights junctions?
they allow adjacent epithelial cells to control the passage molecules between them
other then the fact that they are both attached to membranes, integral membrane proteins and lipid- anchored membrane proteins share an important property. What is it
they are held together to the membrane by hydrophobic interactions
what property do all six phospholipid head groups share in common
they are hydrophilic
. Prokaryotes do not divide by mitosis
they divide by binary fission
•cell-cell junctions.
they form a cohesive layer via intercellular junctions they provide direct pathways for communication between neighboring cells or between cells and the extracellular matrix generally composed of cell adhesion molecules (CAM)
what property of intermediate filaments makes them so resistant to tensile force (pulling)
they form coiled-coil dimers, which resembles strands in a rope
myosin
thick filament
basal lamina
thin extracellular layer that lies underneath epithelial cells and separates them from other tissues
basal lamina,
thin extracellular layer that lies underneath epithelial cells and separates them from other tissues
Actin
thin filaments
wobble base
third base in a codon
tertiary
third in order or level
chromosomes
threadlike structures made of DNA molecules that contain the genes
how does the cell avoid destroying healthy proteins
through the use of ubiquitin as a signal for protein degradation
X-inactive-specific
transcript (Xist) RNA is a noncoding RNA that plays an essential role in in activating X chromosomes.
Phase-contrast
transforms subtle changes in light waves passing through the specimen into differences in light intensity, best for observing intracellular structures
hemoglobin is classified as a type of___ protein
transport
chromatids
two identical chromosomes that split and contain the same genetic material
dimers
two monomers bonded together
Transfer RNA
type of RNA molecule that transfers amino acids to ribosomes during protein synthesis
Ribosomal RNA
type of RNA that combines with proteins to form ribosomes
Why is elastin elastic?
under no stress it forms a globular protein held together by hydrophobic bonds; when stress is applied, these hydrophobic bonds break, and the protein elongates. When the stress is released, the hydrophobic bonds reform, collapsing the elongated protein in a globule.
All prokaryotic organisms are
unicellular
Fluorescence microscopy
uses a fluorescent dye that emits fluorescence when illuminated with ultraviolet radiation
selective
very careful about choosing or using
filopodia
very fine, tubular outgrowths from the growth cone
aquaporins
water channel proteins
hydrophilic
water loving
Beta clamps
what holds polymerase in place?
Trafficking
when a family sends a child or an adult to a labor recruiter in hopes that the labor recruiter will send money, and the family member will earn money to send home
cooperative interaction.
when people act together to promote common interests or achieve shared goals
nucleation sites
where MTs begin to grow; needed in cells because it is hard to start MTs forming "from scratch"; stabilize the minus-ends of the MTs in cells
transcription bubbles.
where RNA polymerase unzips DNA
the E site (exit site).
where discharged tRNAs leave the ribosome
polypeptide exit tunnel
where growing polypeptide is guided to surface of ribosome and ultimately released
•polypeptide exit tunnel.
where growing polypeptide is guided to surface of ribosome and ultimately released
gene silencing.
whole regions of chromosomes are shut off while the same regions in other cells remain active
Can glycine form hydrogen bonds with other amino acids?
yes, because it contains a C=O bond and an N-H bond
Spliceosomes
•are responsible for splicing the newly synthesized RNAs into their mature form.
a "cap" is added to the 5' end, a poly(A) tail is added to the 3'end and the
•introns are spliced out.
Pol III core enzyme
•made of 3 subunits: alpha (α), epsilon (ε) and theta (ϴ)
