Chapter 14
Select all that apply. Which of the following are vectors that have been used for in vivo gene therapy? A. Adenoviruses B. E.coli C. Liposomes D. Mosquitoes E. Lentiviruses
A. Adenoviruses C. Liposomes E. Lentiviruses
The proteome is _____. A. All of a species' proteins B. All of a species' alleles C. All of a species' genes D. All of a species' chromosomes
A. All of a species' proteins
The field of study that relies heavily on computer technologies to analyze genomic and proteomic data is called _____.
A. Bioinformatics
Products made with or derived from transgenic or genetically modified organisms (GMOs) are called _____ products.
A. Biotechnology
The most commonly used method of genome editing is called _____.
A. CRISPR
PCR is a technique used to create copies of a segment of _____ quickly in a test tube.
A. DNA
Recombinant DNA (rDNA) is _____. A. DNA from two or more different sources B. Used as a restriction enzyme C. Sometimes used as a vector
A. DNA from two or more different sources
A modern field which allows scientists to change genomes, and can be used to create biotechnology products or change the organism's characteristics is called genetic _____.
A. Engineering
A technology that can identify and distinguish among individuals based on variation of DNA is called DNA _____.
A. Fingerprinting
DNA microarrays show which _____ are turned on and off in a given cell.
A. Genes
Functional genomics tries to understand the exact role of the _____ in cells or organisms.
A. Genes
Biotechnology products are produced by _____ modified organisms.
A. Genetically
A scientist seeking to study the complete genetic makeup of an organism is studying in the field of _____.
A. Genomics
Select all that apply. Which of the following are applications of transgenic bacteria? A. Help form ice crystals on plants B. Production of growth hormone C. Production of insulin D. Cloning of mammals
A. Help form ice crystals on plants B. Production of growth hormone C. Production of insulin
A major event in scientific history where labs from around the world took 13 years to sequence human DNA is called the _____ _____ _____.
A. Human B. Genome C. Project
During cloning, asexual means are used to produce DNA, cells, or organisms that are genetically _____.
A. Identical
Liposomes, lentiviruses, and inhaled adenoviruses are all examples of vectors used in A. In vivo gene therapy B. Ex vivo gene therapy C. In vitro gene therapy
A. In vivo gene therapy
When RNA sequences that are complementary to the mRNA transcribed by a gene of interest are used to silence the expression of certain alleles it is called RNA _____. A. Interference B. Translation C. Silencing D. Transcription
A. Interference
DNA regions that reside between genes on a chromosome are called _____ sequences.
A. Intergenic
If a segment of non-coding DNA contained a sequence TTAG every 2,000 bases throughout the entire chromosome, you would call this a(n) _____ repeat. A. Interspersed B. Polymorphism C. Tandem D. Trisomy 21 E. Transposoon
A. Interspersed
Repetitive DNA elements that are spread across several regions of a chromosome are called _____ repeats.
A. Interspersed
Gene therapy _____. A. Is an accepted therapy for treatment of a disorder or disease B. Is only used in animals other than humans C. Is another term for gene cloning D. Is a form of PCR except the vector is a virus rather than a bacterium
A. Is an accepted therapy for treatment of a disorder or disease
An enzyme that links DNA fragments together is called DNA _____.
A. Ligase
The production of pharmaceuticals using transgenic animals is known as gene _____.
A. Pharming
The entire collection of proteins resulting from translation of genes is called a(n) _____.
A. Proteome
A segment of DNA containing genes from both mice and humans would be called _____ DNA.
A. Recombinant
PCR works by amplifying short tandem _____ sequences (STRs), sequences of DNA that are repeated many times and are considered noncoding.
A. Repeat
The term used to describe when a sequence of two or more nucleotides is repeated many times along the length of one or more chromosomes is _____ DNA elements.
A. Repetitive
Transposons are _____. A. Specific regions of DNA that can move in and between chromosomes B. Specific proteins that can move in and between chromosomes C. Specific regions of RNA that can move in and between chromosomes
A. Specific regions of DNA that can move in and between chromosomes
A type of repetitive DNA element in which repeats occur one after another on a chromosome is called a(n) _____ repeat. A. Tandem B. Spaced C. Dispersed
A. Tandem
If a segment of non-coding DNA contained a sequence TTAGTTTAGTTTAGT, you would call this a(n) _____ repeat. A. Tandem B. Interspersed C. Polymorphism D. Transposon E. Trisomy 21
A. Tandem
Select all that apply. Which of the following explain why we need a broader definition of gene? A. The end product of some DNA is RNA (not a protein) B. The discoverer of genes was implicated in an ethical accusation C. Some prokaryotes have RNA genes D. Genes can be split across several loci across the genome E. Genes are no longer considered to be functional units of DNA
A. The end product of some DNA is RNA (not a protein) C. Some prokaryotes have RNA genes D. Genes can be split across several loci across the genome
The correction of detrimental DNA mutation by inserting new DNA into the genome is called gene _____.
A. Therapy
DNA sequences able to randomly move from one site to another in the genome are called _____.
A. Transposons
True or false: A gene's final product can be either RNA or protein. A. True B. False
A. True
True or false: In humans, around 95% of a protein coding gene is actually made up of introns. A. True B. False
A. True
True or false: Modern science has been able to successfully clone a mammal. A. True B. False
A. True
True or false: The word "fingerprinting" is used to describe the technology of DNA fingerprinting because like a fingerprint, each human has their own unique DNA pattern. A. True B. False
A. True
Noncoding DNA can be either introns, repetitive sequences, or _____ noncoding DNA.
A. Unique
A plasmid is often used in biotechnology applications as a(n) _____ to transfer foreign genetic material.
A. Vector
What percentage of human chromosomes are made up of protein-coding genes? A. 24% B. 2% C. 20% D. 10% E. 12%
B. 2%
Which answer would be an example of unique noncoding DNA? A. The hemoglobin gene B. ATCGAAATTCGGGCTACCAAC C. ATGGATGGATGGATGGATGG
B. ATCGAAATTCGGGCTACCAAC
Which transgenic organisms are being used to produce insulin, give frost-resistance to plants, confer pesticide resistance to plants, and clean up oil spills? A. Viruses B. Bacteria C. Plants D. Animals
B. Bacteria
Figuring out a person's genetic profile is greatly enhanced with the use of _____ technology. A. Transposon B. DNA microarray C. DNA gel electrophoresis D. Knockout
B. DNA microarray
Organism complexity is _____ related to its proportion of non-gene DNA. A. Not B. Directly C. Indirectly
B. Directly
True or false: Short tandem repeat fingerprinting can be used to identify cancer in humans. A. True B. False
B. False
What specific type of genomic study determines the role of the genome in cells and organisms? A. Comparative genomics B. Functional genomics
B. Functional genomics
Genetic engineering allows scientists to change the _____ of organisms. A. Mitochondria B. Genome C. Evolution
B. Genome
The _____ Project sought to determine the complete sequence of human DNA. A. Biosphere II B. Human Genome C. Human Proteomic D. DNA Microarray
B. Human Genome
Microscopic amounts of DNA sequences on a glass slide, allowing for the visualization of which genes are turned on in specific cells are called DNA _____. A. Electrophoresis B. Microarrays C. Profiles D. Karyotypes
B. Microarrays
An individual's genome, including their mutations is known as their genetic _____. A. History B. Profile C. Family D. Makeup
B. Profile
Select all that apply. Select the choices that may refer to a plasmid. A. Amoeboid movement B. Prokaryotic DNA C. Part of the main chromosome D. .Vector
B. Prokaryotic DNA D. Vector
When small pieces of RNA are used to silence the expression of specific alleles it is called _____ interference. A. Translation B. RNA C. Transcription D. DNA
B. RNA
Which tandem repeat type is used in determining familial relationships? A. Intermediate tandem repeats B. Short tandem repeats C. Long tandem repeats
B. Short tandem repeats
Sequences of DNA that are short, noncoding, and repeated many times in a row are called short _____ repeats. A. Chain reaction B. Tandem C. Fingerprint D. Genomic
B. Tandem
Satellite DNA is also known as a(n) ______. A. Transposon B. Tandem repeat C. Polymorphism D. Trisomy 21 E. DNA microarray
B. Tandem repeat
Genomics is _____. A. The study of proteins B. The study of genomes C. The study of genetics
B. The study of genomes
The function of genome editing is A. To remove or replace sequences of RNA B. To remove or replace sequences of DNA C. To clone an individual
B. To remove or replace sequences of DNA
Repetitive DNA elements make up the _____ of chromosomes and the chromosome ends which are called _____. A. Centromeres; Coding sequences B. Telomeres; Centromeres C. Centromeres; Telomeres D. Telomeres; Coding sequences
C. Centromeres; Telomeres
The production of genetically identical copies of DNA, cells, or organisms through some asexual means is called _____. A. Gene therapy B. A transgenic organism C. Cloning
C. Cloning
Which enzyme is used during recombinant DNA production to link foreign DNA to vector DNA? A. Reverse transcriptase B. Restriction enzyme C. DNA ligase D. Helicase E. Sticky enzyme
C. DNA ligase
Intergenic sequences occur between _____ on DNA strands. A. Chromatid particles B. Heterochromatin particles C. Genes
C. Genes
The process of gene pharming is most often used in transgenic animals to produce _____. A. A fatter animal B. Transgenic bacteria C. Pharmaceuticals D. More transgenic animals E. Cosmetics
C. Pharmaceuticals
Subjecting a protoplast floating in foreign DNA to an electric current is one method of making a genetically modified _____. A. Fungus B. Animal C. Plant D. Bacterium
C. Plant
Which of the following human structures will contain the most functional pieces? A. Chromosomes B. Genome C. Proteome D. Homologous genes
C. Proteome
A plant cell whose cell wall is removed is called a(n) _____. A. Amyloplast B. Chloroplast C. Protoplast D. Plasmid
C. Protoplast
Select all that apply. Which of the following enzymes are needed to make rDNA? A. RNA polymerase B. DNA polymerase C. Restriction enzymes D. DNA ligase E. DNA helicase
C. Restriction enzymes D. DNA ligase
What does the "chain reaction" in the polymerase chain reaction mean? A. Targeted DNA is converted to another type of nucleic acid B. Targeted DNA is attached like a chain C. Targeted DNA is repeatedly replicated
C. Targeted DNA is repeatedly replicated
The human genome is composed of about _____ repetitive DNA elements. A. 1% B. 80% C. 30% D. 50% E. 10%
D. 50%
A new form of genome editing which is being researched to allow pigs to grow additional organs for human transplants is called _____. A. PCR B. Genomics C. Epigenetics D. CRISPR
D. CRISPR
The new technology that acts as a "molecular scalpel", which allows scientists to edit specific gene sequences is called _____. A. PCR B. Epigenetics C. DNA fingerprinting D. CRISPR
D. CRISPR
Which of the following types of repeats is useful in studying the evolution of new genes? A. Intermittent repeats B. Intron repeats C. Intermediate repeats D. Interspersed repeats
D. Interspersed repeats
What is the most complex type of organism science has been able to clone? A. Bacteria B. Sea star/Echinoderm C. Nematode D. Mammal E. Frog/Amphibian
D. Mammal
If the sequence AAGCTTCGTTC is found at five different places on a chromosome it is a(n) _____. A. Copycat mutation B. Transposon C. Single nucleotide polymorphism D. Repetitive DNA element
D. Repetitive DNA element
In order to analyze genomic and proteomic data, bioinformatics relies on _____. A. Cloning B. DNA microarrays C. PCR machines D. Vectors and plasmids E. Computers
E. Computers
