Exam 3
Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?
12
A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is
3' UCA 5'
Where in a DNA molecule can DNA polymerase add new nucleotides?
3' end of new stand
RNA polymerase moves in which direction along the DNA?
3'- 5' along the non-coding (template) strand
At a specific area of a chromosome, the sequence of nucleotides below is present where the chain opens to form a replication fork: 3' C C T A G G C T G C A A T C C 5' An RNA primer is formed starting at the underlined T (T) of the template. Beginning with the underlined T, which of the following represents the appropriate RNA primer sequence?
5' A C G U U A G G 3'
Using the eukaryotic DNA sequence below (introns are bracketed - [xxxxxx]) Which shows the final mRNA? 3'-TACACCTTG[GCAAAGCAT]GTGACCGGACAT[TGTACC]CCTTACACT-5'
5' AUGGAACCACUGGCCUGUAGGAAUGUGA 3'
Which of the following help(s) to stabilize mRNA by inhibiting its degradation in the cytosol?
5' cap and poly (A) tail
Which of the following best describes the addition of nucleotides to a growing DNA chain?
A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.
A particular triplet of bases in the coding sequence of a DNA template is AAA. The anticodon on the tRNA that binds the mRNA codon is
AAA
Which enzyme catalyzes the elongation of a DNA strand in the 5' to 3' direction?
DNA polymerase III
How does active CAP affect expression of the genes of the lactose operon?
It stimulates the binding of RNA polymerase to the promoter
If the gene for telomerase were mutated so that the protein didn't function, what would be the effect on a family lineage?
It would die out due to shortened chromosomes becoming lethal
Which of the following best describes our current understanding of the relationship between a genes and their products?
One gene - one polypeptide
Replication in prokaryotes differs from replication in eukaryotes for which of these reasons?
Prokaryotic chromosomes have a single origin of replication, whereas eukaryotic chromosomes have many.
Why does the DNA double helix have a uniform diameter?
Purines pair with pyrimidines
Which of the following is true for both prokaryotic and eukaryotic gene expression?
RNA polymerase binds to the promoter region to begin transcription.
In which of the following actions does RNA polymerase differ from DNA polymerase?
RNA polymerase can initiate RNA synthesis, but DNA polymerase requires a primer to initiate DNA synthesis
The name of the model that describes the process of DNA replication is...?
Semiconservative model
This is a site in DNA within the promoter of a gene used to align RNA polymerase for transcription:
TATA box
As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?
The tRNA that was in the A site moves into the P site.
Which of the following is true of snRNPs?
They join together to form a large structure called the spliceosome.
Alternative RNA splicing
can allow the production of different proteins from a single gene
In the bacterial operon model, what is responsible for activating a repressor?
co-repressor
A mutation that inactivates the regulatory gene of a repressible operon in an E. coli cell would result in A) irreversible binding of the repressor to the operator. B) complete inhibition of transcription of the gene controlled by that regulator. C) continuous transcription of the gene controlled by that regulator. D) inactivation of RNA polymerase by alteration of its active site. E) continuous translation of the mRNA because of alteration of its structure.
continuous transcription of the gene controlled by that regulator
A frameshift mutation could result from
either an insertion or a deletion of a base
To repair a thymine dimer by nucleotide excision repair, in which order do the necessary enzymes act?
endonuclease, DNA polymerase I, DNA ligase
Which of the following experimental procedures is most likely to hasten mRNA degradation in a eukaryotic cell?
enzymatic shortening of the poly(A) tail
What are the coding segments of a stretch of eukaryotic DNA called?
exons
What kinds of cells have telomerase active?
germ cells
Muscle cells and nerve cells in an animal owe their differences in structure to..?
having different genes expressed
Which of the following separates the two DNA strands during replication?
helicase
What kind of chemical bond is found between paired bases of the DNA double helix?
hydrogen bonds
When this is taken up by the cell, it binds to the repressor so that the repressor no longer binds to the operator:
inducer
Why does eukaryotic DNA polymerase make fewer mistakes than prokaryotic DNA polymerase?
it has proof reading capability
When lactose becomes available in the environment, which below is a response by the lac operon?
lactose binds with the repressor, deactivating it
What amino acid sequence will be generated, based on the following mRNA codon sequence? 5' AUG-UCU-UCG-UUA-UCC-UUG 3' (use amino acid graph)
met-ser-ser-leu-ser-leu
What is the sequence of a polypeptide based on the following DNA sequence? 3' . . . AAAAGAATAACAGAA 5' (use amino acid graph)
phe-ser-tyr-cys-leu
A structure formed when multiple ribosomes are reading a single messenger RNA.
polysome
What might be a difficulty with making eukaryotic proteins in a prokaryote?
prokaryotes cannot remove eukaryotic introns
In a bacterial operon, this can inhibit transcription by blocking the binding of positively acting transcription factors to the DNA:
repressor
This protein is produced by a regulatory gene:
repressor
Transcription in eukaryotes requires which of the following in addition to RNA polymerase?
several transcription factors (TFs)
Which of the following help to hold the DNA strands apart while they are being replicated?
single-strand binding proteins
What does the operon model attempt to explain?
the coordinated control of gene expression in bacteria
The leading and the lagging strands differ in that
the leading strand is synthesized toward the replication fork, the lagging strand is synthesized away from the fork
What dictates the nucleotide sequence of the newly synthesized strand during DNA replication?
the nucleotide sequence of the template strand
From the following list, which is the first event in translation in eukaryotes?
the small subunit of the ribosome recognizes and attaches next to the 5' cap of mRNA
What is the function of topoisomerase?
to nick one strand of the DNA to allow 360 degree rotation to alleviate the over twisting created by helicase activity
The tryptophan (trp) operon is a repressible operon that is
turned off whenever tryptophan is present
Alternative splicing is a term that describes the process of...
using different exons in eukaryotic mRNA processing
