Exams
Explain why the 3 other methods listed that you did not choose in Q3 do have the potential to eliminate SARS-CoV-2 on fomites. (Why/how would each method specifically destroy SARS-CoV-2?)
-Chlorine will denature the PROTEIN CAPSID of the virus. -Phenolics will dissolve the LIPID ENVELOPE of the virus. -Irradiation will damage the (RNA) GENOME of the virus.
identify the metabolic process that the drug inhibits in the pathogen. (How does the antimicrobial agent harm the pathogen?
-Sulfa drugs: Inhibit folic acid synthesis -Inhibits peptidoglycan synthesis. -AZT: Inhibits reverse transcriptase
Methicillin-resistant Staphylococcus aureus (MRSA) strains are resistant to all beta-lactam drugs. Which of the following cannot be used to treat MRSA because it is a beta-lactam drug?
-cephalosporin -penicillin -oxacillin
Shingles is a latent infection. A latent infection is defined as one that is asymptomatic for a period of time, but symptoms manifest (appear) if the infection is activated or re-activated under particular circumstances. Identify the pathogen(s) listed below that also cause latent infections.
-herpes simplex I and II viruses - HIV
Humans are the only reservoir for all of the following EXCEPT:
-legionellosis -plague
Gamma irradiation CAN be used to destroy which TWO of the following microbes in food products, because the dose required is low enough that the food is still palatable (something you would still want to eat).
-protists -molds
Identify which of the following diseases is/are zoonotic. Zoonotic diseases are transmitted directly or indirectly from animals to humans.
-rabies virus -H5N1 flu virus -E. coli O157:H7
Congenital transmission is associated with which of the following diseases to the developing fetus and/or the newborn?
-syphilis -toxoplasmosis -hep B
Indicate if each of the following is found in the cell walls of only Gram-positive bacteria only Gram-negative bacteria both Gram-positive and Gram-negative bacteria neither Gram-positive nor Gram-negative bacteria
-teichoic acids: gram positive cell walls only -n-acetylglucosamine (NAG) and n-acetylmuramic residues (NAM): both Gram-positive and Gram-negative bacteria -lipopolysaccharide (LPS): gram-neg only -peptidoglycan: both -Plasma membrane: neither
A retrovirus employs which of the following in its replication?
-virus-associated reverse transcriptase -virus-associated integrase
A negative sense single-stranded RNA virus employs which of the following in its replication?
-virus-coded replicase -virus-associated transcriptase
Oxygen gas (O2) is in a fully ___________ state and serves as an electron _________ in __________
1. oxidized 2. acceptor 3. aerobic respiration and often in chemosynthesis
Nitrate (NO3-) is in a fully ____ state and serves as an electron _____ in __________.
1. oxidized 2.acceptor 3. anaerobic respiration
Pyruvate (C3H4O3) is not in a fully _______ state and serves as an electron __________ in _________.
1. reduced 2. acceptor 3. fermentation
Glucose (C6H12O6) is in a fully ______ state and serves as an electron ________ in ________
1. reduced 2. donor 3. aerobic and anaerobic respiration and fermentation
Water (H20) is in a fully _______ state and serves as an electron _____ in _______
1. reduced 2. donor 3. photosynthesis
Hydrogen sulfide (H2S) gas is in a fully _____ state and serves as an electron ______ in ___________.
1. reduced 2. donor 3. chemosynthesis
transformation
A bacterial cell takes up DNA released from another bacterium (often when it dies).
transduction
A bacteriophage transfers DNA from one bacterium to another.
DNA replication: DNA polymerase
Adds complementary bases to the new DNA strand
Which one of the methods listed below has NO potential for destroying SARS-CoV-2 on fomites?
Antibiotics that inhibit protein synthesis.
Explain why HTLV-1 DNA might be present in the bone-marrow of the mummies and how it got there
Because HTLV-1 is a retrovirus, the viral DNA will be inserted in the human DNA. The virus uses reverse transcriptase to make complementary viral DNA which is then inserted into the human DNA by the viral enzyme integrase.
Polymyxin B is a cationic surface agent that binds to LPS in the cell, which results in increased permeability and cell death. Gram-positive bacteria are more resistant to polymyxin B than Gram-negative bacteria for all of the following reasons EXCEPT:
Gram-positive bacteria possess a cell wall and Gram-negative bacteria do not.
The anti-HIV drug AZT has a chemical structure similar to thymine. Viral replication is inhibited when AZT is substituted for thymine during ___ synthesis.
HIV DNA
Explain why the following statement is incorrect from a microbiology point of view. "We also routinely were given antibiotics for ear aches. It now turns out that this did not hasten recovery, and in fact may have made us, and the population in general, more resistant to antibiotics."
Humans do not become more resistant to antibiotics. Misuse of antibiotics may select for bacteria that are more resistant.
Honey is not recommended for infants under 12-months-old because ingestion of this food has been associated with infant botulism.
Infants consume bacteria in the honey, which germinate in aerobic regions of the intestine. The bacteria multiply and produce a/an neurotoxin , which causes symptoms of the disease.
DNA replication: DNA ligase
Joins Okazaki fragments in the lagging DNA strand
Contamination with Listeria monocytogenes is a concern in the type of cheese identified in your previous answer.
Listeriosis is a food infection that can be prevented by killing the bacteria .
conjugation
One bacterium donates a copy of DNA to another bacterium.
Which (if any) of the following statements regarding pasteurization is correct?
Pasteurization reduces the total number of microbes in the product, increasing its shelf-life.
Toxoplasmosis is caused by a protozoan, and protozoa are eukaryotic.
Penicillin, bacitracin, cephalosporins, and vancomycin all target peptidoglycan synthesis. Peptidoglycan is found only in bacterial cell walls. Sulfa drugs target folic acid synthesis. Toxoplasma gondii is a protozoan, but like many bacteria, it synthesizes folic acid and is susceptible to sulfa drugs.
Explain why the characteristic you chose in your previous answer determined that T. namibiensis is not a protozoan.
Peptidoglycan is found only in bacterial cell walls. By definition, protozoa do not have cell walls at all, but if they did, the cell wall would not be composed of peptidoglycan
Based on the information provided above, which of Koch's postulates did Marshall fulfill with his 'personal' experiment? Select all correct answers.
Postulate 2: The pathogen can be obtained from the diseased host and grown in pure culture. Postulate 3: The pathogen from the pure culture must cause the disease when inoculated into a healthy, susceptible host.
Provide one reason why azithromycin is more toxic to bacterial cells than to human cells.
Prokaryotic cells possess 30S and 50S ribosomal sub-units, while human cells posses 40s and 60S cytoplasmic ribosomal sub-units.
Explain why L. monocytogenes contamination is a greater concern in the type of cheese you identified in Q6 than in the other 2 cheeses listed.
Queso fresco is an unripened cheese, which means that it has a high moisture content and a nearly neutral pH. These conditions allow for growth of bacterial pathogens, such as Listeria monocytogenes, if present. Cheddar and Romano cheeses are both ripened (aged), and therefore have a low moisture content and a slightly more acidic pH.
The therapeutic index is the ratio of the therapeutic dose (the amount of drug necessary to benefit the host) to the toxic dose (the amount of drug that will damage the host). The larger the therapeutic index, the less toxic to the host and the better the chemotherapeutic agent. Which one of the following drugs is the MOST toxic to a human host, meaning that it has the smallest therapeutic index?
Salvarsan Salvarsan contains an arsenic derivative. Arsenic targets aerobic respiration because it inhibits the enyzme pyruvate dehydrogenase, which is required to convert pyruvate to acetyl co-enzyme A. Acetyl co-enzyme A enters the Kreb's (TCA or citric acid) cycle.
DNA replication: RNA primase (polymerase)
Synthesizes RNA primers on the leading and lagging DNA strands
a. Explain why the answer you chose above could NOT be the alien agent. b. Explain why the alien agent could be any one of the 4 microbes you did not choose. Be sure to address all 4 remaining microbes in your response
The agent could NOT be a prion, because prions are composed only of protein and have no genome at all. No DNA would be present in the sample. Fungi, protists, and bacteria are all cellular organisms and all possess a DNA genome. DNA viruses posses a DNA genome. (RNA viruses have an RNA genome).
Vancomycin-resistant Staphylococcus aureus (VRSA) infections, which are always methicillin-resistant, are a rare but serious public health concern. Which of the following results in vancomycin resistance?
The bacterium modifies the composition of its peptidoglycan.
Explain why the method you chose in the previous question will not destroy SARS-CoV-2 on fomites.
The reason I chose antibiotics in my previous question is mainly because SARS-CoV-2 is a virus, not a bacteria. Therefore, an antibiotic will not work against the virus.
reassortment
Two viruses infecting the host cell accidentally exchange genetic material.
Identify the role(s) CO2 plays in each of the metabolic pathways listed.
aerobic respiration- by product fermentation (alcoholic)- by-product chemosynthesis- carbon source photosynthesis- carbon source autotrophic methanogenesis- electron acceptor and carbon source
In August 2015, three people who had eaten at a Qdoba Mexican Grill in Firestone, Colorado were diagnosed with typhoid fever. Two were hospitalized, but all three patients recovered. The source of the outbreak was
an employee who was an asymptomatic incubatory carrier of typhoid fever
To which domain does T. namibiensis belong?
bacteria
What type of microbe produces acetic acid from alcohol?
bacterium
TATAAT
binds RNA
AGGA
binds to ribosome
DNA replication: single stranded binding protein
binds to the separated DNA strands to hold them apart
The The Food and Drug Administration (FDA) requires which one of the following products to contain specific levels of microbial inhibitors or acidifying agents such as phosphoric or citric acid to prevent production of Clostridium botulinum toxin in the product?
bottle herb-flavored oil
Fluoroquinolones are antibiotics that inhibit ___ by targeting bacterial topoisomerases. a. protein synthesis b. mRNA transcription c. DNA replication d. reverse transcription e. All of the above
c. DNA replication
This step eliminated which of the following as the mechanism by which the toxin gene was transferred.
conjugation Conjugation is eliminated because there are no bacteria in the filtrate and conjugation requires contact between two live bacteria.
Cheese manufacturers worry about bacteriophages contaminating the cheese cultures for all of the following reasons EXCEPT:
consumption of the phage can cause illness.
Chlorox (chlorine) bleach is more effective against noroviruses than Lysol (phenol). Chlorine primarily target amino acids (proteins) and phenols primarily target lipid membranes. Based on that information, you know that noroviruses ______.
don't possess an envelope
Generally speaking, it may be more difficult to make an antiviral drug against which of the following virus types without damaging the host, because this type of virus may be able to replicate using only host cell "machinery" (polymerases, ribosomes, amino acids, nucleotides, etc.)?
ds DNA virus
herpes simplex II virus
during vaginal delivery only
glucose --> pyruvate
either aerobic or anaerobic
Ham is a common source of staphylococcal food intoxication because the bacteria grow well in this particular food item. Based on this information, you would describe staphylococci as ___ based on their environmental preferences?
facultative halophiles
Is food-borne illness caused by E. coli 0157:H7 a food infection or a food intoxication?
food infection
Listeriosis is acquired by
ingestion of bacteria
vCJD is acquired by
ingestion of prions
Pulmonary anthrax is acquired by
inhalation of the endospores
AUG
initiates translation
CO2 (carbon dioxide)
inorganic
H2O (water)
inorganic
H2S (hydrogen sulfide gas)
inorganic
NO3- (nitrate)
inorganic
O2 (oxygen gas)
inorganic
Foodborne (adult) botulism is a food
intoxication
In May 2011, a food-borne outbreak in Europe was first thought to be caused by ingestion of organic cucumbers contaminated with E. coli 0157:H7. People were advised that washing the cucumbers was not sufficient to prevent disease and that the cucumbers had to be cooked to be safe for consumption because cooking will ...
kill the bacteria
Identify the nucleic acid strand on which each of the following is located AND is functional.: AGGA
mRNA
Identify the nucleic acid strand on which each of the following is located AND is functional.: AUG
mRNA
Identify the nucleic acid strand on which each of the following is located AND is functional.: GCCGACUCCGUCGGCUUUUUU
mRNA
Identify the nucleic acid strand on which each of the following is located AND is functional.: UAG, UAA, or UGA
mRNA
Which, if any, of the following is NOT true of methicillin?
methicillin inhibits PBP2a (penicillin-binding protein 2A)
Identify the nucleic acid strand on which each of the following is located AND is functional: TATAAT
non-template DNA
Hep A
not associated with congenital infections
Rabies virus
not associated with congenital transmission
H5N1 flu virus
not associated with congential transmission
ethanol --> acetic acid
only aerobic
C3H4O3 (pyruvate)
organic
Acetic acid is formed when ethanol is
oxidized by the loss of hydrogen atoms and addition of oxygen atoms
Due to its large relative size (in the microbial world) Thiomargarita namibiensis, was first assumed to be a protozoan, but this turned out not to be true because it
possesses peptidoglycan in the cell wall
In one episode, CDC scientist Edwin Jenner is seen working with a microscope capable of viewing DNA from a "zombie" sample. This result means the disease cannot be caused by a _____.
prion
T. namibiensis is
prokaryotic
Which of the following types of cheese is not allowed to be made commercially using unpasteurized milk in the U.S.?
queso fresco-unripened, soft cheese
Imagine that the year is 1905, and you are talking to a person who is repeatedly sneezing and coughing. You would be potentially at risk for contracting which one of the following diseases from that person?
smallpox
Based on what you know about Toxoplasma gondii and the following antibacterial drugs, which ONE of the following would you recommend for treatment of a toxoplasmosis infection?
sulfa drugs
GCCGACUCCGUCGGCUUUUUU
terminates transcription
UAG, UAA, or UGA
terminates translation
Malaria is acquired by
the bite of an Anopheles mosquito that carries the virus .
These results proved that the ctx gene was transferred from the highly pathogenic strain of V. cholerae to the non-pathogenic strain by which of the following methods?
transduction
The filtrate was then treated with DNase, an enzyme that degrades DNA that is not surrounded by protein. The DNase treated filtrate was still able to transfer the ctx toxin gene to the previously non-pathogenic strain. This eliminated which of the following as the mechanism of transmission?
transformation Transformation is eliminated because the "naked DNA" would be destroyed by DNase.
You may have heard of Z-Paks, which contain 3-5 doses of Zithromax (azithromycin). This antibiotic binds to the 50S ribosome. Which ONE of the following processes does azithromycin inhibit?
translation
HIV
transplacental, during delivery, and thru breast milk
Recently, two Japanese researchers used DNA sequences from HTLV-I viruses to determine the origin of humans who migrated to the New World. HTLV-I is a retrovirus that causes adult leukemia in a small percentage of the infected population. What type of genome does HTLV-1 possess?
two identical copies of ss positive sense RNA
DNA replication: DNA helicase
uncoils and separates complementary DNA strands
The shingles vaccine is recommended for people 60-years-old and older. The vaccine contains weakened ___.
varicella zoster (chicken pox) virus
A positive sense single-stranded RNA virus employs which of the following in its replication?
virus-coded replicase
People have long known that drinking beer might be safer than drinking water because pathogens can't survive in beer. Which, if any, of the following does NOT prevent the growth of pathogens in beer?
yeast
What type of microbe typically ferments glucose to alcohol?
yeast
