Extra Test 1, Test 2, Test 3 pt.1, Test 3 pt.2, Test 4

Board Review Question: The osmolal gap is defined as measured Osm/kg minus the calculated Osm/kg. The average osmolal gap is near 6 2 0 4

0

A person has a serum alcohol level of 0.20% at 3 hours after drinking. After 1 hour, what is the range of expected results? No change (0.20%) Absent after 1 h 0.1982% to 0.1985% 150 to 165 mg/dL

0.1982% to 0.1985%

The ratio of glucose in the CSF relative to serum is 1:1. 0.66:1. 2:1. 1:2.

0.66:1.

Creatinine levels are usually: 0.1-0.6 mg/dL. 0.8-1.2 mg/dL. 1.5-2.5 mg/dL. 3.0-5.0 mg/dL.

0.8-1.2 mg/dL.

Which of the following compounds promote osteoclast formation? Bisphosphonate 1, 25-dihydroxy Vitamin D3 Calcitonin Osteoprotegerin {OPG}

1, 25-dihydroxy Vitamin D3

Approximately how many nephrons does each kidney contain? 1 1,000 100,000 1,000,000

1,000,000

Approximately how many nephrons does each kidney contain? 1 1,000 100,000 1,000,000

1,000,000

The path of the electrical impulse of the heart is: ? right and left bundle branch ? Purkinje fibers ? sinoatrial node (SA node) ? atrioventricular node (AV node)

1. sinoatrial node (SA node) 2. atrioventricular node (AV node) 3. right and left bundle branch 4. Purkinje fibers

Board Review Question: If the total bilirubin is 3.1 mg/dL and the conjugated bilirubin is 2.0 mg/dL, the unconjugated bilirubin is 2.2 mg/dL 1.1 mg/dL 5.1 mg/dL 0.5 mg/dL

1.1 mg/dL

Mary's total protein is 7.5 g/dL and her albumin is 4.2 g/dL. What is her A/G ratio? 1.1 1.3 1.5 1.8

1.3

If a total bilirubin is 4.0 mg/dL and the conjugated bilirubin is 2.5 mg/dL, the unconjugated bilirubin is: 1.0 mg/dL. 1.5 mg/dL. 2.0 mg/dL. mg/Dl.

1.5 mg/dL.

Board Review Question: A patient's values are as follows: T4 = 4ug/dL(ref range5-12 ug/dL) T3 uptake = 40% (ref range 25-35%) What is the patient's free thyroxine index? 36.0 0.1 10.0 1.6

1.6

How much of our body water is found in extracellular fluid, including plasma? 1/3 1/2 2/3 3/4

1/3

How many essential amino acids do infants require? 6 8 10 20

10

When does the embryo become a fetus? 2 weeks after conception 6 weeks after conception 10 weeks after conception 12 weeks after conception 13 weeks after conception

10 weeks after conception

Board Review Question: A 45-yr old male of average height and weight was admitted to the hospital for renal function studies. He had the following lab results: urine creatinine = 120mg/dL serum creatinine= 1.5 mg/dL total urine volume in 24 hours = 1800 mL Calculate the creatinine clearance in mL/min 144 156 225 100

100

Board Review Question: If a fasting glucose were 90 mg/dL, which of the following 2-hour postprandial glucose results most closely represent normal glucose metabolism? 100 mg/dL 180 mg/dL 260 mg/dL 55 mg/dL

100 mg/dL

Board Review Question: The following results were obtained urine creatinine = 90 mg/100 mL serum creatinine = 0.90 mg/100 mL patient's total body surface = 1.73 m3 total urine volume in 24 hr = 1500 mL Given the above data, calculate the patient's creatinine clearance in mL/min 104 124 144 150

104

The creatinine clearance test is routinely used to assess the glomerular filtration rate. Given the following information for an average size adult, calculate a creatinine clearance. Urine creatinine: 120 mg/dLPlasma creatinine: 1.2 mg/dL24h urine volume: 1520 ml 10.6 mL/min 15.2 mL/min 63.3 mL/min 94.7 mL/min 105.6 mL/min

105.6 mL/min

A kidney is approximately ________ long, ________ wide, and ________ in depth.

12 cm, 6 cm, 2.5 cm

Serum urea nitrogen and serum creatinine determinations are frequently requested together so that their ratio may be evaluated. What is the range of the normal ratio of urea nitrogen to creatinine? 1/1 and 10/1 12/1 and 20/1 15/1 and 20/1 20/1 and 30/1 25/1 and 30/1

12/1 and 20/1

What is the normal glomerular filtration rate (GFR)? <60 mL/min 120-125 mL/min 100-120 for males, 120-140 in females It cannot be measured, only calculated.

120-125 mL/min

Board Review Question: Given the following values: 100, 120, 150, 140, 130. What is the mean? 100 128 130 640

128

Calculate the anion gap given the following data: Sodium = 143 mmol/L; chloride = 105 mmol/L; and HCO 3 = 25 mmol/L. 13 mmol/L -13 mmol/L 63 mmol/L 273 mmol/L

13 mmol/L

The therapeutic index is defined as the LD 50/ED 50. Calculate the index for a drug that has an LD 50 of 30 mg and an ED 50 of 2 mg. 30 1 15 0.0666

15

What is the total volume of CSF in an adult and what is the rate of turnover? 150 mL for both 150 mL present and 500 mL turnover per day 150 mL present and 500 mL turnover per week 500 mL present and 150 mL turnover per day

150 mL present and 500 mL turnover per day

Protein is approximately _______ nitrogen. 10% 12% 16% 20% 22%

16%

Which of the following 2-hour glucose results would be classified as impaired glucose tolerance? 125 mg/dL 135 mg/dL 160 mg/dL 210 mg/dL

160 mg/dL

A 52-year-old man went to his doctor for a physical examination. The patient was overweight and had missed his last two appointments because of business dealings. His blood pressure was elevated, his cholesterol was 250 mg/dL, and his triglyceride was 170 mg/dL. A high-density lipoprotein (HDL) cholesterol test was performed and the result was 30 mg/dL (20-60 mg/dL). Which of the following would be this patient's calculated low-density lipoprotein (LDL) cholesterol value? 157 mg/dL 186 mg/dL 200 mg/dL Cannot be determined from the information given

186 mg/dL

After 4 tubes of cerebrospinal fluid have been collected and numbered consecutively from 1 to 4, which tubes should be sent to which laboratory? 1: microbiology, 2: cytology, 3: chemistry, 4: hematology 1: microbiology, 2: chemistry, 3: hematology, 4: cytology 1: cytology, 2: chemistry, 3: microbiology, 4: hematology The order is not important.

1: microbiology, 2: cytology, 3: chemistry, 4: hematology

Board Review Question: The formula for calculating serum osmolality that incorporates a correction for the water content of plasma is: 2 Na x (Glucose/20) x (BUN/3) 2 Na + Glucose/20 + (BUN/3) Na + [(2 x Glucose)/20] x (BUN/3) 2 Na + Glucose/3 + (BUN/20)

2 Na + Glucose/20 + (BUN/3)

How soon after conception is human chorionic gonadotropin abnormal? 1 day 1 week 10 days 2 weeks

2 weeks

Normal values for urea are generally expressed as urea nitrogen. If it is necessary to convert urea nitrogen values to urea, the concentration may be calculated easily by multiplying the urea nitrogen value by: 0.47. 1.47. 2.14. 28. 60.

2.14.

Board Review Question: If the total bilirubin is 4.3 mg/dL and the conjugated bilirubin is 2.1 mg/dL, the unconjugated bilirubin is 4.2 mg/dL 1.1 mg/dL 2.2 mg/dL 6.3 mg/dL

2.2 mg/dL

The results of a precision study are shown below. What is the percent coefficient of variation for the study? Mean = 100 mg/dL Standard deviation = 2.5 mg/dL 1.5% 2.0% 2.5% 6.25%

2.5%

How much of our body water is found in intracellular fluid? 1/3 1/2 2/3 3/4

2/3

A protein can be made up of a maximum of _________ amino acids. 5 10 20 100

20

A protein can be made up of a maximum of _________ different amino acids. 5 10 20 100

20

Of the following blood glucose levels, which would you expect to result in glucose in the urine? 70 mg/dL 100 mg/dL 120 mg/dL 200 mg/dL

200 mg/dL

The BORDERLINE range for cholesterol levels as determined by NCEP is: below 200 mg/dL. 200-240 mg/dL. over 240 mg/dL. over 300 mg/dL.

200-240 mg/dL.

Board Review Question: At blood pH 7.40 what is the ratio between bicarbonate and carbonic acid? 25:1 20:1 15:1 30:1

20:1

What is the normal ratio of bicarbonate to dissolved CO 2 in arterial blood? 1:5 1:10 20:1 40:1

20:1

Board Review Question: Which of the following 2-hour post-prandial glucose values demonstrates unequivocal hyperglycemia diagnostic for diabetes mellitus? 125 mg/dL 135 mg/dL 160 mg/dL 210 mg/dL

210 mg/dL (or 200 mg/DL)

Board Review Question: An adult diabetic with renal complications has the following results sodium 133mEq/L BUN 84 mg/dL Glucose 487 mg/dL Creatinine 5 mg/dL On the basis of these results the calculated serum osmolality is: 266 mOsm/kg 304 mOsm/kg 709 mOsm/kg 290 mOsm/kg

304 mOsm/kg

Board Review Question: An adult diabetic with renal complications has the following results: Na 133mEq/L BUN 84 mg/dL glucose 487 mg/dL creatinine 5 mg/dL On the basis of these results, the calculated serum osmolality is: 709 mOsm/kg 266 mOsm/kg 304 mOsm/kg 290 mOsm/kg

304 mOsm/kg

The melting temperature (Tm) of the DNA sequence given below is:5' TAACCTATGCGA 3'3' ATTGGATACGCT 5' 12°C 24°C 34°C 38°C

34°C

The following data are given for serum AFP among a healthy cohort of pregnant women: 8, 10, 15, 17, and 19. What is the absolute AFP cutoff concentration if the lab establishes it at 2.5 times the multiple of the median? 34.5 37.5 38 42.5

37.5

How many pyrrole rings are there in a porphyrin structure? 5 4 2 1

4

How much DNA would be contained in 200 µm of a sample that has an absorbance at 260 nm of 0.40 and an absorbance 280 nm of 0.20? 4 µm 6 µm 8 µm 10 µm

4 µm

Board Review Question: Which percentage of total serum calcium is nondiffusible protein bound? 80 -90% 51 - 60% 40 - 50% 10 - 30%

40 - 50%

During the first trimester of a normal pregnancy, hCG levels doubles every 48 to 72 hours. If the first hCG is 1000 IU/L (day 1), what is the hCG level on day 7? 1000-2000 IU/L 2000-4000 IU/L 4000-8000 IU/L 8000-16,000 IU/L

4000-8000 IU/L

Board Review Question: Following overnight fasting, hypoglycemia in adults is defined as a glucose of 55 mg/dL 70 mg/dL 45 mg/dL 60 mg/dL

45 mg/dL

A polypeptide has to have more than ______ amino acids. 2 5 10 100

5

Board Review Question: I the fasting state, the arterial and capillary blood glucose concentration varies from the venous glucose concentration by approximately how many mg/dL? 5 mg/dL higher 12 mg/dL lower 2 mg/dL higher 10 mg/dL lower

5 mg/dL higher

Board Review Question: The chemical composition of HDL cholesterol corresponds to: 85% triglycerides; 5% cholesterol; 2% protein 5% triglycerides; 15% cholesterol; 50% protein 60% triglycerides; 15% cholesterol; 10% protein 10% triglycerides; 45% cholesterol; 25% protein

5% triglycerides; 15% cholesterol; 50% protein

Board Review Question: A healthy person with a blood glucose of 80 mg/dL would have a simultaneously determined cerebrospinal fluid glucose value of: 100 150 25 50

50

Free ionized calcium normally represents approximately what percentage of the total serum calcium? 5% 40% 50% 80%

50%

What is the correct distribution of the various calcium forms in blood? Equal parts of ionized, protein-bound, and bound to anions Majority protein-bound, with 10% free and 10% bound to anions 50% ionized, 40% protein-bound, 10% bound to anions Majority free, with 10% bound to proteins and 10% bound to anions

50% ionized, 40% protein-bound, 10% bound to anions

Board Review Question: A 24-hr urine specimen (total volume = 1136 mL) is submitted to the laboratory for quantitative urine protein. Calculate the amount of protein excreted per day if the total protein is 52 mg/dL 487 mg 282 mg 591 mg 220 mg

591 mg

What percentage of serum cholesterol is present in the form of esters? 10-20% 20-40% 60-75% 80-95%

60-75%

The glucose concentration in normal cerebrospinal fluid is: Usually less than 30 mg/dL. 60-75% of the plasma glucose concentration. Equal to the plasma glucose concentration. Usually greater than 100 mg/dL.

60-75% of the plasma glucose concentration.

Board Review Question: The following results were obtained in a creatinine clearance evaluation urine concentration = 84 mg/dL urine volume = 1440 mL/24 hr serum concentration = 1.4 mg/dL body surface area = 1.60 m3 The creatinine clearance in mL/min is 22 60 6 65

65

If a patient's serum glucose is 100 mg/dL, what would you expect the cerebrospinal fluid glucose to read? 45 mg/dL 68 mg/dL 85 mg/dL 95 mg/dL

68 mg/dL

Board Review Question: The normal range for the pH of arterial blood measured at 37C is: 7.28 - 7.34 7.33 - 7.37 7.45 - 7.50 7.35 - 7.45

7.35 - 7.45

Board Review Question: Normally the bicarbonate concentration is about 24 mE/L and the carbonic acid concentration is about 1.2; pK = 6.1. Using the equation pH = pk + log [salt]/[acid] calculate the pH 7.40 7.28 7.42 7.38

7.40

How many essential amino acids do adults require? 6 8 10 20

8

Board Review Question: The glycosylated hemoglobin value represents a time average of glucose concentration during the preceding 16-20 weeks 1-3 weeks 8-12 weeks 4-5 weeks

8-12 weeks

In distribution statistics, what percentage of the data is included in the mean +/- 2SD? 68% 95% 99% 100%

95%

Board Review Question: A mean value of 100 mg/dL and a standard deviation value of 1.8 mg/dL were obtained from a set of glucose measurements. The 95% confidence interval in mg/dL would be: 94.6 - 105.4 96.4 - 103.6 97.3 - 102.7 98.2 - 101.8

96.4 - 103.6

The National Cholesterol Education Program ATP III goal for desirable HDL cholesterol is: < 100 mg/dL. > 60 mg/dL. < 200 mg/dL. > 40 mg/dL.

> 60 mg/dL.

Board Review Question: Night blindness is associated with deficiency of which of the following vitamins? thiamine C niacin A

A

Which of the following are the most common cause(s) of acute pancreatitis? Gallstones or obstructing tumor Abdominal trauma Acute alcohol ingestion or drug use Chronic alcohol use A and C

A and C

Which of the following is an alternate definition of disease? Some who has an abnormal condition but is not suffering from it Neoplasia or tumor A condition that can be caused by a genetic defect A condition that can be caused by trauma

A condition that can be caused by a genetic defect

Electrolyte exclusion effect is characterized as which of the following? A falsely low serum chloride in a grossly lipemic specimen A falsely low serum sodium result in an icteric specimen A falsely low serum sodium result in a hemolyzed specimen A falsely low serum sodium result in a grossly lipemic specimen.

A falsely low serum sodium result in a grossly lipemic specimen.

Hemochromatosis is a disease best described as which of the following? A disease characterized by an iron overload without associate tissue injury. A genetically related disease in which the body accumulates excess amounts of iron A genetically related disease in which the body develops an iron deficiency A disease characterized by an accumulation of porphyrins in the blood.

A genetically related disease in which the body accumulates excess amounts of iron

A sneaky diabetic tried to lower her glucose by working out and watching her diet 1 or 2 days before her appointment. The rest of the time she spent the day in front of the television and eating chocolates. What test could the doctor order to detect this type of behavior? A glucose tolerance test A glycosylated hemoglobin Daily urine glucose A hospital admission so he could watch her daily

A glycosylated hemoglobin

BUN is increased with: A high protein diet. A low protein diet. A high carbohydrate diet. It is not affected by diet

A high protein diet.

A test menu is: A listing of all the reagents on-board the analyzer. A listing of preventative maintenance tasks that needs to be performed. A listing of all of the tests or analytes that the instrument is capable of measuring. A listing of consumables used by the analyzer.

A listing of all of the tests or analytes that the instrument is capable of measuring.

Diagnostic sensitivity, as related to tumor markers, is defined as which of the following? The probability that a laboratory test will be positive in the presence of disease The probability that a laboratory test will be negative in the absence of disease A measure of how often the assay system detects the biomarker when the disease is present The probability that a disease is present when the test is positive or that a disease is absent when a test is negative

A measure of how often the assay system detects the biomarker when the disease is present

A person with argyria will exhibit which of the following? Mottling or blotching of the skin A permanent bluish-grey discoloration of the skin A copper or copper tone discoloration of the skin A yellow appearance in the skin especially in the sclera of the eyes

A permanent bluish-grey discoloration of the skin

Automating laboratory testing has resulted in which of the following? Inconsistent sample processing errors A reduction in the number of laboratory errors Increased turnaround time Increased repetitive injuries

A reduction in the number of laboratory errors

The best test for pancreatitis in the presence of mumps is: Virus isolation. A serologic test for mumps. A urine amylase test. A serum lipase test.

A serum lipase test.

An increase in temperature will result in a change to hemoglobin-oxygen dissociation curve. This change reflects which of the following? A shift in the curve to the left A shift in the curve to the right A downward shift in the curve An upward shift in the curve

A shift in the curve to the right

What is the difference between an embolus and a thrombus? A piece of an embolism breaks off and forms a thrombus at a distant location. A piece of a thrombus breaks off and forms an embolus at a same location. A thrombus occurs in the vein; an embolus occurs in an artery. A thrombus occurs in an artery; an embolus occurs in the vein.

A thrombus occurs in the vein; an embolus occurs in an artery.

Which of the following statements best defines a metalloenzyme? A trace element that is associated with an enzyme to serve as an inhibitor of an enzyme reaction. A trace element that is associated with an enzyme to serve as a nonessential component or cofactor. A trace element that is associated with an enzyme to serve as a catalyst for the enzyme reaction. A trace element that is associated with an enzyme to serve as an essential component or cofactor.

A trace element that is associated with an enzyme to serve as an essential component or cofactor.

Board Review Question: Which of the following hemoglobins has glucose -6-phosphate on the amino-terminal valine of the beta chain? C A2 A1c S

A1c

Which of the following is an anterior pituitary hormone? Thyrocalcitonin Serotonin Glucagon ACTH

ACTH

Angiotensin II stimulates ADH secretion and thirst the heart to beat faster the kidneys to produce more urine Na secretion by the kidneys

ADH secretion and thirst

Which hormone stimulates water reabsorption? ADH/vasopressin Growth hormone Cortisol Oxitocin

ADH/vasopressin

Which of these enzyme methodologies uses the Bowers and McComb method? AST ALT ALP GGT

ALP

Which of these enzyme methodologies uses the same reaction as the LD method? AST ALT ALP GGT

ALT

Board Review Question: Which of the following enzymes are used in the diagnosis of acute pancreatitis? AMY and LIP 5'N and GGT AST and LD AST and ALT

AMY and LIP

Board Review Question: Which of the following enzymes are used in the diagnosis of acute pancreatitis? AST and LD AMY and LIP AST and ALT 5'N and GGT

AMY and LIP

Which of these enzyme methodologies uses the Karmen method? AST ALT ALP GGT

AST

Tubular reabsorption, with the active transport of molecules, requires: ATP a carrier molecule a concentration gradient ATP and a carrier molecule a carrier molecule and a concentration gradient

ATP and a carrier molecule

A 30-year-old male with ALA-dehydratase deficient porphyria (ADP) may present with which of the following clinical features: Severe chest pain, shortness of breath, and rapid heart rate (tachycardia) Abdominal pain and neurological dysfunction Photosensitivity and cutaneous lesion Bulging eyes, goiter in the neck, and heat intolerance

Abdominal pain and neurological dysfunction

What is the best method for determining carbon monoxide exposure in a patient? Blood gas analysis Pulse oximetry Absorption spectroscopy (co-oximetry) Carbon monoxide smoke detector

Absorption spectroscopy (co-oximetry)

Select the four correct pharmacological parameters that determine serum drug concentration. Absorption, anabolism, bioactivation, excretion Equilibration, biotransformation, reabsorption, elimination Absorption, distribution, metabolism, excretion Ingestion, conjugation, metabolism, elimination

Absorption, distribution, metabolism, excretion

Ethanol metabolizes to which of the following acids? Formic Acetic Glycolic Hydrochloric

Acetic

Which is false regarding the functions of the pancreas? The exocrine pancreas is involved with digestion. The endocrine pancrease is involved with glucose regulation. Acinar cells release glucagon. Insulin is produced from the islets of Langerhans.

Acinar cells release glucagon.

A patient with a rapid onset of symptoms that indicate renal damage, following a group A strep infection, would most likely have: Acute glomerulonephritis Chronic glomerulonephritis Nephrotic syndrome Pyelonephritis

Acute glomerulonephritis

_______________ is the most common leukemia found in children and adolescents. Acute lymphocytic leukemia Acute myelogenous leukemia Chronic lymphocytic leukemia Chronic myelogenous leukemia

Acute lymphocytic leukemia

Which disease is characterized by greater than 20% nucleated cells of the bone marrow? Acute lymphocytic leukemia Acute myelogenous leukemia Chronic lymphocytic leukemia Chronic myelogenous leukemia

Acute myelogenous leukemia

Board Review Question: Which of the following is an organ specific autoimmune disease? progressive systemic sclerosis myasthenia gravis rheumatoid arthritis Addison's disease

Addison's disease

_______________ is characterized by a low sodium level and a high potassium level. Addison's disease Renal disease Cushing's disease Hyperthyroidism

Addison's disease

Which hormone is not produced by the placenta? Estriol Human chorionic gonadotropin (hCG) Adrenocorticotropin hormone (ACTH) Progesterone

Adrenocorticotropin hormone (ACTH)

Which statement about the brain is TRUE? Brain damage is always premanent Adults can grow new neurons in their brain The cerebral circulation runs throughout the entirety of the brain In the brain, grey matter is made of myelinated neurons.

Adults can grow new neurons in their brain

Ranson's Indicators of Severity in Acute Pancreatitis include all of the following tests EXCEPT: Glucose. Lactate dehydrogenase. BUN. Alanine transaminase.

Alanine transaminase.

Bromcresol Green (BCG) may be used in the dye-binding assay of: Lipoprotein. Cholesterol. Albumin 17-ketosteroids. Estrogen.

Albumin

During the early stages of acute inflammation, there is a stimulus to produce proteins known as acute phase reactants. Accommodating new protein production comes at the expense of decreasing the production of other proteins. Which of the following is down-regulated, i.e., provides the substrate for producing antiinflammatory proteins? α1-Antitrypsin Albumin Complement C3 C-reactive protein

Albumin

_____________ is the most common cause of acute pancreatitis. Uncontrolled diabetes Alcohol use Liver cancer E.coli infection

Alcohol use

What type of hypoglycemia is exhibited 6 hours after a meal? Reactive Fasting Alimentary None of the above

Alimentary

Heat inactivation and chemical inhibition are two methods used to measure which of the following analytes? Acid phosphatase isoenzymes Alkaline phosphatase isoenzymes Creatine kinase isoenzymes Osteocalcin

Alkaline phosphatase isoenzymes

Which of the following will shift the oxygen dissociation curve to the left? Alkalosis Anemia Hypercapnia Anemia

Alkalosis

Primary hypothyroidism may be due to which of the following? Damage to the thyroid gland Inherited conditions Removal or ablation of the thyroid gland All of the above

All of the above

The adrenal cortex releases which of the following? Corticosteroids Mineralosteroids Androgens All of the above

All of the above

Unconjugated estriol may be decreased in which of the following? Fetal anencephaly Fetal death Molar pregnancy All of the above

All of the above

Urine adulteration test strips are designed to detect which of the following Bleach Nitrites Creatinine All of the above

All of the above

Urine adulteration test strips are designed to detect which of the following? Bleach Nitrites Creatinine All of the above

All of the above

Which of the following conditions may be characterized by an increased anion gap? Salicylate intoxication Diabetes mellitus Lactate acidosis All of the above

All of the above

Which of the following is usually NOT considered to be a function of a lipid? Lipids are used as a efficient reserve for energy production Lipids are structural elements for cell membranes Lipids are a important part of vitamins and hormones. Lipids aid in digestion of other fats in the GI tract All of the above are true of lipids

All of the above are true of lipids

Which is a true statement regarding carbohydrates? Can serve in a structural capacity Carbohydrates are an important source for immediate energy usage General formula is (CH2O)n Can be classified as a poly-saccharide. All of the above are true.

All of the above are true.

Which statement regarding glycosylated hemoglobin is true? It has a sugar attached to the N-terminal valine of the B-chain of the hemoglobin molecule. Is dependent upon the time averaged blood glucose over the lifespan of the RBC. Levels below 7% indicate adequate regulation for 8-12 weeks prior to sampling. All of the above.

All of the above.

Which of these are drugs of abuse? methamphetamines cocaine barbiturates all of these

All of these

Alkaline phosphatase can be used as a tumor marker for bone cancer. liver cancer. hepatic metastasis. All of these are correct.

All of these are correct.

Pathology is the study of dead people. the study of why people get disease. the study of laboratory tests that detect disease. All of these are correct.

All of these are correct.

Which factors mediate respiratory distress syndrome? Inflammation Free radical attack Vasoconstriction All of these are correct.

All of these are correct.

Which of the following can reduce the incidence of hepatocellular carcinoma? Abstinence from alcohol Hepatitis B vaccine Anti-retroviral therapy for hepatitis C All of these are correct.

All of these are correct.

_________ affects creatinine levels. Age Diet Gender All of these are correct.

All of these are correct.

_____________ can cause infertility. Presence of antisperm antibodies in the man Presence of antisperm antibodies in the woman Presence of anti-ovarian antibodies in the man All of these are correct.

All of these are correct.

Which of the following protein deficiencies causes liver cirrhosis? Haptoglobin Complement C3 and C4 Alpha-1-antitrypsin Transferrin

Alpha-1-antitrypsin

Elevated blood levels of lead will result in a deficiency of which of the following enzymes? Alanine aminotransferase Aldolase Amino levulinic acid dehydratase Alkaline phosphatase

Amino levulinic acid dehydratase

___________ is not used as an antiepileptic. Phenytoin Lamotrigine Amitriptyline Clonazepam

Amitriptyline

What are the products of amino acid deamination by the liver? Proteins Ammonia and urea Immunoglobulins Uric acid

Ammonia and urea

Which types of plaques are observed in Alzheimer disease? Cholesterol Amyloid Tau protein Amyloid and tau protein

Amyloid and tau protein

Which is true regarding fetal lung maturity tests? A normal result has high predictive value for lung maturity at birth. A normal result has high predictive value for predicting respiratory distress syndrome. An abnormal result has high predictive value for lung maturity at birth. An abnormal result has high predictive value for predicting respiratory distress syndrome.

An abnormal result has high predictive value for lung maturity at birth.

Vitamin E toxicity has been associated with which of the following? Atherosclerosis Clotting deficiencies An affliction of premature infants who have been exposed to high oxygen therapy and later developed retinopathy of prematurity (formerly retrolental fibroplasias) Hepatoma

An affliction of premature infants who have been exposed to high oxygen therapy and later developed retinopathy of prematurity (formerly retrolental fibroplasias)

A patient with a toxic level of blood alcohol would cause which of the following? A decreased osmolal gap An increased osmolal gap An osmolal gap of zero No change in the osmolal gap

An increased osmolal gap

Your CK test could not be read on the analyzer and you need to do a 1/10 dilution, which phase of testing does this fall into?

Analytical

The following statement best describes which of the terms listed below? The pathological condition that develops when iron intake falls below the amount required for red blood cell production and iron reserves become depleted. Anemia Hemochromatosis Porphyria Acute intermittent porphyria

Anemia

Which of the following has a large amount of aluminium present? Baking soda Saline Antacids Radiator fluid

Antacids

Which of the following substances when ingested can lead to an excessive amount of aluminum in blood and tissue? Antacids and astringents Wine Aspirin Citrus fruit

Antacids and astringents

TSH is secreted by which of the following? Anterior pituitary Posterior pituitary Hypothalamus Thyroid gland

Anterior pituitary

Which test is the most specific for rheumatoid arthritis? C-reactive protein Erythrocyte sedimentation rate Rheumatoid factor Anti-cyclic citrullinated peptide antibody

Anti-cyclic citrullinated peptide antibody

Which of the hepatitis B antibodies is short-lived? Anti-hepatitis B surface antibody Anti-hepatitis B IgM core antibody Anti-hepatitis B total core antibody Anti-hepatitis B e antibody

Anti-hepatitis B IgM core antibody

Carbamazepine, primidone, and valproic acid are all examples of: Anitarrhythmic drugs. Antidepressant drug. Antibiotics. Antiepileptic drugs.

Antiepileptic drugs.

Which drug can be used to combat the effect of a type I hypersensitivity reaction? Antihistamine Antianalgesic Antibiotic Antiarrhythmic

Antihistamine

Mr Smith has a uric acid level of 9 mg/dL, this is due to: cytotoxic chemotherapy gout radiation therapy any of the above

Any of the above

Transferrin circulates as which of the following? Lipotransferrin-Fe2+ Apotransferrin-Fe2+ Apotransferrin-Fe3+ Prototransferrin-Fe3+

Apotransferrin-Fe3+

Which laboratory test is most useful for evaluating congenital heart diseases? B-type natriuretic peptide Arterial blood gases with co-oximetry Cardiac troponin D-dimer

Arterial blood gases with co-oximetry

Which of the following represents two primary functions of the GI tract? Assimilation of nutrients and elimination of waste Anaerobic respiration and bicarbonate excretion Release of hypothalamic factors and maintenance of blood pressure Detoxification of drugs and transmethylation of drug metabolites

Assimilation of nutrients and elimination of waste

Which of the following instruments can measure calcium, magnesium, and phosphorus in blood samples? Fluorometer Osmometer Atomic absorption spectrometer Refractometer

Atomic absorption spectrometer

Trace elements in biological fluids can be measured using which of the following instrumentation techniques? Reflectometry Enzyme immunoassay Atomic absorption spectrometry Osmometry

Atomic absorption spectrometry

Thyroid peroxidase autoantibodies are most sensitive for detecting which thyroid disease or condition listed below? Hypothyroidism Autoimmune thyroid disease (e.g., Hashimoto's thyroiditis) Thyroid adenoma Thyroid carcinoma

Autoimmune thyroid disease (e.g., Hashimoto's thyroiditis)

Which nervous system contains nerves that control involuntary responses? Sympathetic Parasympathetic Autonomic Sympathetic and parasympathetic

Autonomic

Board Review Question: Antibodies are produced by mast cells B cells marrow stem cells killer cells

B cells

Which cells make antibodies? B-cells or B-lymphocytes T-cells or T-lymphocytes macrophages natural killer cells (NK cells)

B-cells or B-lymphocytes

The pregnancy test checks for the presence of which hormone? B-hCG estrogen growth hormone progesterone

B-hCG

Board Review Question: Humoral antibodies are produced by which cells? neutrophils T-lymphocytes B-lymphocytes macrophages

B-lymphocytes

____________ is the most widely used marker for diagnosis of heart failure. C-reactive protein B-natriuretic peptide Cardiac troponin Lactate dehydrogenase

B-natriuretic peptide

Match these drugs with their proprietary name: Carbamazepine FK 506 Valproic Acid Phenytoin

B. Tegretol A.Tacrolimus C.Depakote D.Dilantin

Match the hormone with its pituitary source. Growth Hormone ADH TSH FSH Oxytocin Prolactin ACTH A. posterior pituitary B.anterior pituitary

BABBABB

Board Review Question: A patient with glomerulonephritis would present the following serum results; BUN increased calcium increased phosphorus decreased creatinine decreased

BUN increased

Board Review Question: What battery of tests is most useful in evaluating an anion gap of 22 mEq/L? glucose, CK, myoglobin, and cryoglobulin AST, ALT, LD and amylase BUN, creatinine, salicylate, and methanol Ca++, Mg++, PO-4, and pH

BUN, creatinine, salicylate, and methanol

_____________ can sometimes occur among college students living in dormitories. Encephalitis Subdural hematoma Bacterial meningitis Parkinson disease

Bacterial meningitis

Which is true concerning the difference between malignant and benign tumors? Benign tumors are not encapsulated. Benign tumors are well-differentiated cells. Malignant tumors invade local tissues. Malignant tumors are often actively dividing.

Benign tumors are well-differentiated cells.

Valium and librium are examples of which of the following classes of drugs? Opiates Benzodiazepines Barbiturates Amphetamines

Benzodiazepines

Which of the following classes of compounds has a sedative effect and used to treat anxiety? Amphetamines Opiates Cannabinoids Benzodiazepines

Benzodiazepines

Which disorder is associated with vitamin B1 (thiamin) deficiency? Rickets Beriberi Pellagra Pernicious anemia

Beriberi

Which of the following is described as a nervous system ailment because of a deficiency of thiamine? Pellagra Multiple sclerosis Beriberi Parkinson disease

Beriberi

What is the best test to assess a patient who has been exposed to beryllium? Belgium leukocyte proliferation test (BeLPT) Beryllium leukocyte proliferation test (BeLPT) Beryllium lymphocyte proliferation test (BeLPT) Belgium lymphocyte proliferation test (BeLPT)

Beryllium lymphocyte proliferation test (BeLPT)

Which of the following mechanisms can cause metabolic acidosis? Hyperventilation Accumulation of volatile acids excessive retention of dissolved CO2 Bicarbonate deficiency

Bicarbonate deficiency

Which of the following mechanisms is responsible for metabolic acidosis? Bicarbonate deficiency Diminished production of fixed acids Rapid and efficient elimination of organic acids Increased retention of HCO3-

Bicarbonate deficiency

Taurocholate and cholylglycine are examples of which of the following acids? Fatty acids Bile acids Carboxylic acids Amino acids

Bile acids

The term δ-bilirubin (delta) refers to: Water-soluble bilirubin. Free unconjugated bilirubin. Bilirubin tightly bound to albumin. Direct-reacting bilirubin.

Bilirubin tightly bound to albumin.

Pyridinoline, carboxy, amino-terminal cross-linked telopeptide of type I collagen, and tartrate-resistant acid phosphatase are all examples of which of the following? Biomarkers of osteoblast conversion to osteroclast Biomarkers of formation Biomarkers of resorption Cancer antigens associated with bone tumors

Biomarkers of resorption

Patients with Graves disease have anti-thyrotropoin-receptor antibodies and anti-thyroglobulin antibodies. What is the mechanism for hyperthyroidism? T cells producing thyroid hormone B cells producing thyroid hormone Blocking thyroxine receptors thereby blocking negative thyroid feedback mechanisms Thyroid hypersensitivity

Blocking thyroxine receptors thereby blocking negative thyroid feedback mechanisms

What section of the clinical chemistry laboratory is most likely to adopt a new chemistry test? Routine chemistry Special chemistry Body fluids Blood gas analysis

Blood gas analysis

Uric acid may be determined with: The enzyme urease. The enzyme uricase. Formation of a blue color with phosphotungstic acid. Formation of a red color with diazotized sulfanilic acid. Both B and C

Both B and C

Which of these statements about diabetic ketoacidosis and hyperosmolal hyperglycemic nonketotic coma is NOT true? Both are associated with metabolic acidosis and ketosis. Both have high osmolality. Both occur with undiagnosed diabetes. Both are associated with thirst.

Both are associated with metabolic acidosis and ketosis.

Which of the following is true regarding antibody tests for celiac disease such as anti-gliadin antibodies? Tests are highly specific for celiac diseases. Tests are highly sensitive for celiac diseases. Both are true. Neither is true.

Both are true.

Which of the following chemical mediators of vasodilation is not involved in acute inflammation? Histamine Bradykinins Cytokines Leukotrienes

Bradykinins

Kernicterus is the abnormal accumulation of bilirubin in: Heart tissue. Brain tissue. Liver tissue. Kidney tissue. Blood.

Brain tissue.

____________________ is not a mechanism by which inflammation causes cancer. Oxidative damage to genetic material Proliferation of cell growth Angiogenesis (growth of blood vessels) Breakdown in DNA repair mechanisms

Breakdown in DNA repair mechanisms

Uric acid is the product of the Breakdown of amino acids. Breakdown of pyrimidine bases. Breakdown of purine bases. Breakdown of ribosomes.

Breakdown of purine bases.

___________ can result in hypercapnia. Taking drugs that increase the respiration rate Breathing into a paper bag Hyperventilating Placing an individual on a ventilator

Breathing into a paper bag

Which of the following compounds functions as a chelating agent used as a treatment modality for ingestion of trace element? Sodium EDTA Sodium heparin Copper sulfate British anti-Lewisite (BAL)

British anti-Lewisite (BAL)

An antibiotic that kills many gram-negative and gram-positive bacteria is termed Broad spectrum Narrow spectrum Nosocomial Bacteriostatic

Broad spectrum

A 40-year-old male patient with hemochromatosis often presents to his clinician with which of the following triad of symptoms? Bronzing of the skin, cirrhosis, and diabetes Polyuria, polydypsia, and polyphagia Yellowing of the sclera of the eyes, shortness of breath, and chest pain Abdominal pain, chest pain, and grayish-blue lips

Bronzing of the skin, cirrhosis, and diabetes

Board Review Question: Scurvy is associated with deficiency of which of the following vitamins? thiamine C niacin A

C

Scurvy is associated with deficiency of which of the following vitamins? Vitamin A Vitamin C Thiamine Niacin

C

Which vitamin is a potent antioxidant? A B C D

C

Board Review Question: Which of the following serum proteins migrates with the beta-globulins on cellulose acetate at a pH of 8.6? haptoglobin C3 complement hemoglobin ceruloplasmin

C3 complement

Which of the following biomarkers is elevated in nonmucinous epithelial ovarian cancer? CA 15-3 CA 19-9 CA 125 CEA

CA 125

Which of the following biomarkers are elevated in advanced stages of breast cancer? Total and free PSA CEA and alpha-fetoprotein CA 15-3 and CA 549 DUPAN-2 and Gastrin

CA 15-3 and CA 549

Which of the following is a sialylated Lewis blood group antigen associated with colorectal cancer? CA 125 CA 15-3 PSA CA 19-9

CA 19-9

Which of these biomarkers is used to monitor pancreatic cancer? CA 15-3 CA 19-9 CA 125 CA 27-29

CA 19-9

The marker for colorectal and pancreatic carcinoma is: CA 19-9. CA 15-3. CA 27-29. CA-125.

CA 19-9.

Which of these biomarkers can be used to monitor colorectal cancer? AFP ALP CEA B-HCG

CEA

Which creatine kinase isoenzyme is found in cerebral tissue? CK-MM CK-MB CK-BB Mitochondrial CK

CK-BB

Board Review Question: The presence of which of the following isoenzymes indicates acute myocardial damage? CK-MB CK-MM CK-BB none of the above

CK-MB

Board Review Question: The presence of which of the following isoenzymes indicates acute myocardial damage? none of these CK-MM CK-BB CK-MB

CK-MB

Board Review Question: A person suspected of having metabolic alkalosis would have which of the following laboratory findings? CO2 content decreased and pH elevated CO2 content, PCO2, and pH decreased CO2 content and PCO2 elevated, pH decreased CO2 content and pH elevated

CO2 content and pH elevated

Nonsteroidal antiinflammatory drugs reduce the production of arachnidonic acid and series 4 leukotrienes by inhibiting COX-1. COX-2 and 5-LOX. glucagon. insulin.

COX-2 and 5-LOX.

Which statement about CSF is FALSE? CSF is found around the brain and spinal cord CSF cushions the brain and protects it CSF is produced by the choroid plexuses CSF is found between the dura mater and the arachnoid mater. 1 points

CSF is found between the dura mater and the arachnoid mater.

Which of the following is a xanthene that potentially could interfere with the determination of theophylline? Uric acid Caffeine Nicotine N-acetylprocainamide

Caffeine

____________ is the major waste product that the lungs eliminate. Oxygen Carbon dioxide Carbon monoxide Alcohol

Carbon dioxide

_______________ enables visualization of coronary arteries. Electrocardiogram Cardiac catheterization Echocardiogram Encephelogram

Cardiac catheterization

Which of the following statements is true about cTnI? Cardiac forms are never expressed in skeletal muscle Cardiac forms are expressed in skeletal muscle In fetal development, the cardiac and skeletal forms are co-expressed in skeletal and cardiac tissues It is the same as cardiac troponin C (cTnC)

Cardiac forms are never expressed in skeletal muscle

Which of the following muscles are involuntary (i.e., the consciousness does not control contraction)? Skeletal muscle Cardiac muscle Smooth muscle Cardiac muscle and smooth muscle

Cardiac muscle and smooth muscle

____________, one marker of a heart attack, is a structural protein and not an enzyme. Lactate dehydrogenase Creatine kinase Aspartate aminotransferase Cardiac troponin

Cardiac troponin

Which of the cardiac biomarkers is currently the most widely used? Cardiac troponins CK-MB Myoglobin Aspartate aminotransferase

Cardiac troponins

A glucose result is falsely elevated and it was discovered that the previous sample on the sample carousel has abnormally high serum glucose. Which of the following can cause this error? Pipetting an extra volume of diluents into the sample with the falsely elevated glucose Carryover A leak in the reagent-dispensing probe Double pipetting of the sample with the elevated glucose result

Carryover

Which of the following classes of compounds are derived from tyrosine and includes epinephrine, norepinephrine, and dopamine? Steroids Androgens Catecholamines Estrogens

Catecholamines

Which of the following is not an objective of the clotting system following invasion of an infectious agent? Providing a "trellis" as the basis for repair Preventing migration of infectious organisms systemically Causing thrombosis Causing vasodilation

Causing vasodilation

Which of the following GI disorders is characterized by a modified gut immune function? Celiac disease Carcinoid tumor Achalasia Zollinger-Ellison syndrome

Celiac disease

A disruption of which of the following, but not to the extent of cell death, can result in the release and abnormal accumulation of metabolites and other small molecules? Nucleus Cell membrane Mitochondria Golgi apparatus

Cell membrane

Board Review Question: 90% of the copper present in plasma is bound to Transferrin Ceruloplasmin Albumin Immunoglobulin

Ceruloplasmin

Which of the following proteins incorporates copper into its structure? Ceruloplasmin Transferrin Haptoglobin Albumin

Ceruloplasmin

Which of the following proteins is a copper transport protein that migrates in the alpha 2-globulin region? Haptoglobin Hemoglobin Ceruloplasmin Transferrin

Ceruloplasmin

British anti-Lewisite (BAL) and succimer are two examples of compounds that are used to treat patients that ingest a large amount of certain trace metals. These compounds: Reduce trace metals. Sulphonate trace metals Chelate trace metals. Form glucuronides with trace metals

Chelate trace metals.

In the blood, bicarbonate leaves the red blood cell and enters the plasma through an exchange mechanism with which of the following ions? Sodium Potassium Chloride Phosphate

Chloride

The anion with the highest extracellular concentration is: Protein. Bicarbonate. Chloride. Phosphate.

Chloride.

Bile acids are synthesized in the liver from which lipid? Triglycerides Cholesterol Fatty acids Phospholipids

Cholesterol

__________ is used to oxidize cholesterol in the enzymatic assay for total cholesterol. Cholesterol oxidase Cholesterol kinase Cholesterol esterase Peroxidase

Cholesterol oxidase

Which of the following tests would be included in a routine lipid profile? Cholesterol, LDL-cholesterol, HDL cholesterol Cholesterol, triglycerides, phospholipids Triglycerides, fatty acids, LDL-cholesterol Cholesterol, LDL-cholesterol, HDL cholesterol, triglycerides

Cholesterol, LDL-cholesterol, HDL cholesterol, triglycerides

Levels of this enzyme are useful in the diagnosis of a genetic defect, which leads to increased apnea (difficulty breathing) after surgery using succinyl choline. Cholinesterase Aldolase Leucine aminopeptidase 5' nucleotidase Acid phosphatase

Cholinesterase

__________ improves glucose metabolism. Arsenic Zinc Chromium Copper

Chromium

Intracellular Chromium binds to which of the following proteins? Chromodulin Chromoglobulin Microalbumin Glucuronide

Chromodulin

The most common cause of chronic pancreatitis is: Pregnancy. Gall stone obstruction. Chronic alcohol abuse. Mumps.

Chronic alcohol abuse.

A patient presenting with edema, fatigue, hypertension, anemia, proteinuria and decreased urine output, would most likely have: Acute glomerulonephritis Chronic glomerulonephritis Nephrotic syndrome Pyelonephritis

Chronic glomerulonephritis

A patient presenting with hypertension and an autoimmune disease would most likely have: Acute glomerulonephritis Chronic glomerulonephritis Nephrotic syndrome Chronic kidney disease

Chronic kidney disease

Which lipid particles contain the highest triglyceride content? HDL LDL Chylomicrons VLDL

Chylomicrons

The lipoprotein fraction that has the highest ratio of lipid to protein is: Chylomicrons. VLDL. LDL. HDL.

Chylomicrons.

Which condition is associated with fusion of the β-ϒ bridging? Cirrhosis Acute pancreatitis Myocardial infarction Nephrotic syndrome

Cirrhosis

What is the end product of both the intrinsic and extrinsic pathways? Clot Degranulation of mast cells Microorganism trapping Kinin release

Clot

Which of the following metals is an example of a trace element? Potassium Cobalt Calcium Magnesium

Cobalt

Identification of the urinary metabolite benzoylecgonine would be useful in determining the presence of which of the following compounds? Codeine Cocaine Amphetamine Acetaminophen

Cocaine

Freezing point depression is one of the: Colligative properties of a solution. Isoelectric point of a solution. Physical properties of an ice cube. Principle temperatures on the Kelvin scale.

Colligative properties of a solution.

Which defense system is best able to lyse foreign bacteria? Complement Clotting Vascular permeability Cytokine

Complement

Which of the following is false concerning assays for complement proteins? The CH50 test measures total complement activity. C3 and C4 are measured by immunoassays and immunonephelometry. Complement C3 and C4 provide differential information and are not redundant. Only increased levels provide clinical significance.

Complement C3 and C4 provide differential information and are not redundant.

A technologist obtains a BUN value of 28 mg/dL and a serum creatinine value of 1.1 mg/dL. The BUN/Creat ratio indicates Kidney stones Congestive Heart Failure Uremia Nephrotic Syndrome

Congestive Heart Failure

In which of the following diseases is measurement of brain type natriuretic peptide (BNP) is most useful? AMIs Tachycardia Congestive heart failure Pericarditis

Congestive heart failure

Which of the following diseases causes transudate-type pleural effusion? Acute pancreatitis Congestive heart failure Systemic lupus erythematosus Headache

Congestive heart failure

Which of the following would be classified as prehepatic jaundice? Hepatitis Congestive heart failure Rotor syndrome Cancer of the bile ducts

Congestive heart failure

Acyl-cholesterol acyltransferase: Esterifies free cholesterol from the outer layer of the lipoprotein followed by a shift of the esterified cholesterol to the core of the chylomicrons. Hydrolyzes triglycerides on the surface of chylomicrons to glycerol and fatty acids. Converts free cholesterol to esterified cholesterol for storage. Converts cholesterol to esterified cholesterol.

Converts free cholesterol to esterified cholesterol for storage.

Ceruloplasmin is an α 2-globulin that contains: Zinc. Manganese. Iron. Copper

Copper

Ingesting of large amounts of molybdenum creates a deficiency of which of the following trace elements? Copper Zinc Lead Boron

Copper

Cushing's syndrome is characterized by which of the following? Excess secretion of pituitary ACTH Adrenal insufficiency Corticosteroid excess (in blood) Low plasma levels of cortisol.

Corticosteroid excess (in blood)

Pituitary secretion of ACTH is inhibited by elevated levels of: Aldosterone. Cortisol. Estradiol. Progesterone.

Cortisol.

Transmural inflammation is associated with: Zollinger-Ellison syndrome. Bile salt malabsorption. Celiac disease. Crohn's disease.

Crohn's disease.

Which of the following conditions is NOT associated with hyponatremia? Cushing's disease Addison's disease Diuretic therapy Diarrhea

Cushing's disease

Which is false regarding exposure of drugs and toxins to the skin? Absorption favors lipid-soluble compounds. Cuts provide a direct route to the bloodstream. Absorption is faster than through the lungs. In general, the skin is protective towards toxin

Cuts provide a direct route to the bloodstream.

Vitamin B 12 is also named: Cyanocobalamin Riboflavin Retinol Tocopherols

Cyanocobalamin

Board Review Question: Gas chromatography with the nitrogen phosphorus detector is the most commonly used technique for the analysis of Digoxin Cyclic antidepressants Ethyl alcohol Acetylsalicylic acid

Cyclic antidepressants

Cholesterol is a: Glycerol ester. Cyclopentanoperhydrophenanthrene nucleus. Fatty acid. Phospholipid.

Cyclopentanoperhydrophenanthrene nucleus.

Which of the following compounds selectively inhibits proliferation and activation of CD4+ T cells (immunosupressant)? Digoxin Beta hCG Progesterone Cyclosporine A

Cyclosporine A

Elevated sweat chloride is associated with which disease? Multiple sclerosis Muscular dystrophy Cystic fibrosis Lupus diseases

Cystic fibrosis

Which disorder is related to mucus accumulation, recurrent infection with unusual pathogens, and increased inflammation in the lungs? Acute pancreatitis Chronic pancreatitis Cystic fibrosis Pancreatic cancer

Cystic fibrosis

____________ has a genetic basis, requiring that all newborns be tested. Cystic fibrosis Chronic obstructive pulmonary disease Pulmonary edema Pneumonia

Cystic fibrosis

Laboratory evidence of which protein is diagnostic of cystic fibrosis? Cystic fibrosis transmembrane conductance regulator protein Cystic fibrosis regulator protein Cystic fibrosis sweat protein All of the above

Cystic fibrosis transmembrane conductance regulator protein

Which of the following cytochromes plays a major role in the metabolism of drugs in the liver? Cytochrome P650 Cytochrome P490 Cytochrome P250 Cytochrome P450

Cytochrome P450

Which of the following is an endogenous pyrogen? Cytokines Complement proteins Fibrinogen Gram-negative bacteria

Cytokines

Following cell death, proteins from which subcellular location appear in blood first? Cytoplasm Nucleus Mitochrondria All are released simultaneously.

Cytoplasm

Board Review Question: Rickets is associated with deficiency of which of the following vitamins? D B1 C niacin

D

Which test is used for detecting malabsorption? Oral glucose tolerance test D-xylose test Hemoglobin A1c Schilling test

D-xylose test

Giving Gentamicin over the minimum toxic concentration can cause ______________ in newborns. Deafness Kidney failure Liver failure Brain damage

Deafness

Which of the following compensatory mechanisms is correct for a patient in respiratory acidosis? Decrease respiration rate Increase the movement of electrolytes such as Na+ and H+ out of the cells and into the blood while increasing K+ from blood into cells. Decrease whole blood pCO2 Decrease plasma bicarbonate concentration

Decrease whole blood pCO2

Aceruoplasminemia is associated with which of the following? Decreased blood ceruloplasmin, increased copper deposition in the liver, and increased zinc deposition in tissues. Decreased blood ceruloplasmin, decreased copper deposition in the liver, and increased iron deposition in tissues. Increased blood ceruloplasmin, increased copper deposition in the liver, and increased iron deposition in tissues. Decreased blood ceruloplasmin, increased copper deposition in the liver, and increased iron deposition in tissues.

Decreased blood ceruloplasmin, increased copper deposition in the liver, and increased iron deposition in tissues.

A person with Menke's syndrome will have which of the following laboratory results? Decreased blood arsenic Increased blood zinc Increased blood copper Decreased blood copper

Decreased blood copper

What is the effect of cold temperatures on enzyme function? Increased reaction rate Decreased or absent reaction rate Unpredictable effect No effect

Decreased or absent reaction rate

Which of the following sets of laboratory results is associated with Wilson's disease? Decreased plasma copper and plasma ceruloplasmin Decreased plasma copper and increased plasma ceruloplasmin Increased plasma copper and decreased plasma ceruloplasmin Increased plasma copper and increased plasma ceruloplasmin

Decreased plasma copper and plasma ceruloplasmin

Which of the following is not part of the pathophysiology of glomerulonephritis from streptococcal infection? Formation of immune complexes Stimulation of an antibody response Increased capillary permeability Decreased production of antidiuretic hormone

Decreased production of antidiuretic hormone

Which of the following is not a variable of aging affecting a drug's pharmacokinetics and pharmacodynamics? Decreased renal clearance Decreased rate of metabolism Decreased respiratory rate and pulmonary clearance Increased volume of distribution with increased adipose tissue

Decreased respiratory rate and pulmonary clearance

A patient with suspected protein-losing enteropathy (PLE) would have which of the following laboratory results? Decreased serum protein and albumin No change in serum protein or albumin Decreased serum protein and increased albumin Elevated serum protein and albumin

Decreased serum protein and albumin

A patient with syndrome of inappropriate secretion of antidiuretic hormone (SIADH) would present with which of the following laboratory results? Increased serum sodium, osmolality, chloride, and increased urine sodium, Decreased serum sodium, osmolality, chloride, and increased urine sodium Decreased serum sodium, increased osmolality, chloride, and increased urine sodium Increased serum sodium, osmolality, decreased chloride, and increased urine sodium

Decreased serum sodium, osmolality, chloride, and increased urine sodium

Which of the following laboratory results best represents a patient with Paget's disease? Decreased urinary hydroxyproline, increased serum alkaline phosphatase Increased urinary hydroxyproline, decreased serum alkaline phosphatase Normal urinary hydroxyproline, normal serum alkaline phosphatase Decreased urinary hydroxyproline, decreased serum alkaline phosphatase

Decreased urinary hydroxyproline, increased serum alkaline phosphatase

A patient with megaloblastic anemia would show which of the following? Elevated vitamin B12, elevated folic acid Elevated vitamin B12, decreased folic acid Decrease vitamin B12, elevated folic acid Decreased vitamin B12, decreased folic acid

Decreased vitamin B12, decreased folic acid

Changes in vitamin B 12 are most dramatic in tissues with the greatest rate of cell turnover because: Deficiencies result in impaired RNA synthesis in any cell where chromosomal replication and division takes place. Deficiencies result in impaired excretion of metabolic waste products from the cells' cytosol. Deficiencies result in impaired function of cytochrome P450. Deficiencies result in impaired DNA synthesis in any cell where chromosomal replication and division takes place.

Deficiencies result in impaired DNA synthesis in any cell where chromosomal replication and division takes place.

Which of the following characterizes diabetes insipidus? Deficiency in vasopressin release Terminal stage of diabetes mellitus Excessive water intake (psychogenic polydipsia) Sugar in the urine

Deficiency in vasopressin release

Which of the following is a cause of hyperhomocysteinemia? Deficiency of one of the B complex vitamins, folate in particular Excess of one the B complex vitamins, folate in particular Deficiency of calcium Deficiency of sodium

Deficiency of one of the B complex vitamins, folate in particular

Hyperalbuminemia is caused by: Dehydration syndromes. Liver disease. Burns. Gastroenteropathy.

Dehydration syndromes.

Prerenal azotemia is found in: Acute kidney disease Kidney stones Nephrotic syndrome. Dehydration.

Dehydration.

Prerenal hyperuricemia is caused by: Dehydration. Uremia. Bladder tumors. Prostatic hypertrophy.

Dehydration.

Which of the following statements best illustrates the diagnostic criteria for primary hyperparathyroidism? No serum PTH detected and no serum calcium detected Detectable amounts of serum PTH concomitant with elevated total serum calcium Elevated total serum calcium only A normal levels of serum PTH and serum calcium

Detectable amounts of serum PTH concomitant with elevated total serum calcium

All of the following are clinical applications of FISH EXCEPT:

Detecting DNA from tumor-causing viruses in cytologic specimens.

What is the role of therapeutic drug monitoring for diseases? Diagnosis Selection of therapy Determination of drug compliance Prognosis for future complications

Determination of drug compliance

Which of the following conditions is associated with hypernatremia? Hypoaldosteronism Burns Diabetes insipidus Diarrhea

Diabetes insipidus

Heroin is: Diacetyl morphine. Methadone. N-acetylprocainamide. 9-tetrahydrocannabinol.

Diacetyl morphine.

Clinical usefulness of BNP or NT-Pro BNP include all of the following EXCEPT: Rule out test for suspected cases of new heart failure in breathless patients. Risk stratification. Diagnose S-T segment elevation myocardial infarction (STEMI). Monitoring of patients with heart failure.

Diagnose S-T segment elevation myocardial infarction (STEMI).

The role of cardiac biomarkers includes which of the following? Establish odds ratio, diagnosis, and treatment modalities Tumor identifications, prognosis, appropriate drug therapy intervention Diagnosis, monitoring, risks stratification, and therapeutic management Determining life expectancy, staging diseases, population studies

Diagnosis, monitoring, risks stratification, and therapeutic management

Which of the following is an example of a controllable preanalytical variable associated with specimen collection for bone biomarker testing? Diet Age Gender Fractures

Diet

Myoglobin is a good cardiac marker because it: Diffuses into the blood more quickly than CK-MB. Diffuses into the blood more slowly than CK-MB. Doesn't diffuse into the blood at all when cardiac tissue dies. Is an extremely large protein and therefore does not diffuse into the blood very easily.

Diffuses into the blood more quickly than CK-MB.

Board Review Question: A cardiac glycoside that is used in the treatment of congenital heart failure and arrhythmias by increasing the force of velocity of myocardial infarction is Digoxin Acetaminophen Lithium Phenytoin

Digoxin

Which of the following compounds is a cardiac glycoside that is used in the treatment of congenital heart failure and arrhythmias by increasing the force and velocity of myocardial contraction? Digoxin Carbamazepine Amikacin Phenobarbital

Digoxin

__________ is used to improve cardiac output in patients with heart failure. Lidocaine Quinidine Procainamide Digoxin

Digoxin

Measurement of vitamin B 12 concentration in serum using an immunoassay is an example of which of the following? Indirect assay Direct assay Screening assay Bioassay

Direct assay

Following the entrance of a drug into the vascular compartment, it will be carried to all organs and fluid compartments. This statement describes which of the following? Digestion Distribution Metabolism Reperfusion

Distribution

Serial sampling for cardiac biomarkers is defined as: Drawing blood samples periodically, usually at prescribed time intervals over the course of the patient's stay. Drawing blood samples randomly during the first four hours after admission to the facility. Drawing a blood sample once after admission to the facility. Making dilutions of each blood sample and analyzing them for the appropriate cardiac biomarker.

Drawing blood samples periodically, usually at prescribed time intervals over the course of the patient's stay.

Which information is not critical to capture when performing therapeutic drug monitoring? Blood collection tube used Time of drug administration Patient demographics Drug's half-life

Drug's half-life

Which form of congenital hyperbilirubinemia is associated with increased direct bilirubin? Crigler-Najjar Syndrome Gilbert Syndrome Dubin-Johnson Syndrome Kernicterus

Dubin-Johnson Syndrome

Which of the following regarding hemoglobin is true? Variant forms of hemoglobin are devoid of the heme group. All hemoglobins contain two α and two β globin chains. Each heme group binds one oxygen molecule. All myoglobins contain two α and two β globin chains.

Each heme group binds one oxygen molecule.

What is the diagnosis of a patient with high cortisol, high ACTH, and failure to suppress cortisol with the administration of dexamethasone? Cushing's disease Ectopic ACTH syndrome Adrenal tumor Adrenogenital syndrome

Ectopic ACTH syndrome

Which of the following statements is true regarding serum levels of arsenic? Elevated levels of arsenic in serum is detected for up to two weeks after ingestion A serum level of 1 µg/L of arsenic is toxic Arsenic is not metabolized by the liver Elevated levels of arsenic in serum can be detected for only a few hours (< 4) after ingestion.

Elevated levels of arsenic in serum can be detected for only a few hours (< 4) after ingestion.

Which of the following test results are correct for a patient with Zollinger-Ellison syndrome? Elevated serum gastrin, increase in basal gastric acid output Decrease serum gastrin, decreased in basal gastric acid output Elevated serum gastrin, decreased in basal gastric acid output Decrease serum gastrin, increase in basal gastric acid output

Elevated serum gastrin, increase in basal gastric acid output

Which of the following respiratory diseases is associated with permanent lung damage? Asthma Bronchitis Emphysema All of these cause alveoli damage.

Emphysema

What is the objective of metabolism? Making drugs more nonpolar Increasing drug's protein binding Enhance clearance by making drugs more polar Enabling access through lipophilic membranes.

Enhance clearance by making drugs more polar

What is the origin of carcinoid? G cells of the gut Islet cells of the pancreas Enterochromaffin cells of the GI tract Parafollicular cells the thyroid gland

Enterochromaffin cells of the GI tract

Which of the following is true regarding proteins and enzymes? All proteins are enzymes. Enzymes are found in lower concentrations than proteins seen on serum protein electrophoresis. In addition to catalytic functions, most enzymes are also transporter proteins. Many proteins also provide structural support.

Enzymes are found in lower concentrations than proteins seen on serum protein electrophoresis.

Which neurotransmitter/hormone(s) is metanephrine a metabolite of? Insulin Testosterone Epinephrine and norepinephrine Calcitonin

Epinephrine and norepinephrine

Select the principle estrogen produced by the ovaries and measured to evaluate ovarian function. Estriol Estradiol Epiestriol Hydroxyestrone

Estradiol

____________ has a surge during the luteal phase of a menstrual cycle. Follicle-stimulating hormone Lutenizing hormone Estrogen Progesterone

Estrogen

Commercially prepared radiator fluid contains a significant amount of which of the following compounds? Methanol Isopropanol Glycolic acid Ethylene glycol

Ethylene glycol

Which of the following alcohols will produce a metabolic acidosis? Isopropyl Ethylene glycol Ethanol None of these are correct.

Ethylene glycol

________________ is the most common cause of hypoglycemia. Insulinoma Excess insulin administration from a diabetic Glucagonoma Ketoacidosis

Excess insulin administration from a diabetic

Which of the following practices is inappropriate when establishing quality controls ranges? Exclusion of any quality control results greater than ±2 standard deviation from the mean Compare your data to the manufacturer of the quality control material Gather quality control data for a long period of time if necessary Using control results from all shifts on which the assay is performed

Exclusion of any quality control results greater than ±2 standard deviation from the mean

Nephrotic syndrome is characterized by Excretion of low molecular weight proteins. Excretion of high molecular weight proteins. Excretion of tubular proteins. Excretion of proteins irrespective to their size.

Excretion of low molecular weight proteins.

Board Review Question: The hemoglobin that is resistant to alkali (KOH) denaturation is C F A2 A

F

Which of the following is true of the male reproductive system? LH and FSH are largely absent. LH stimulates spermatogenesis. FSH stimulates spermatogenesis. Dehydroepiandrosterone stimulates spermatogenesis.

FSH stimulates spermatogenesis.

Increase test throughput, reduce turnaround time, and compensate for staff shortages are all examples of which of the following? Factors that lead to more errors Factors that drive manual procedures Management options used to reduce the number of technologist in the laboratory Factors that drive automation

Factors that drive automation

The portal vein drains the detoxified blood away from the liver. True False

False

A hypothermic patient will produce erroneous in blood gases in which direction? Falsely high PCO2 and falsely low PO2 False lows in both PCO2 and PO2 False highs in both PCO2 and PO2 Falsely low PCO2 and falsely high PO2

False highs in both PCO2 and PO2

What is meant by the term pseudohyperkalemia? Measurement of some other monovalent cation instead of potassium Falsely high result using an indirect assay due to the presence of solids such as lipids Falsely high result using a direct assay due to the presence of solids such as lipids Falsely increased due to hemolysis

Falsely increased due to hemolysis

What is meant by the term pseudohyponatremia? Measurement of some other monovalent cation instead of sodium Falsely low result using an indirect assay due to the presence of solids such as lipids Falsely low result using a direct assay due to the presence of solids such as lipids Falsely decreased due to hemolysis

Falsely low result using an indirect assay due to the presence of solids such as lipids

Which dyslipidemia is characterized by normal LDL, decreased HDL, and increased triglycerides? Apolipoprotein C-II deficiency Hyperapobetalipoproteinemia Familial hypertriglyceridemia Dysbetalipoproteinemia

Familial hypertriglyceridemia

Vitamins A, D, and K are classified as: Water-soluble Fat-soluble Insoluble Soluble in nitric acid only.

Fat-soluble

Levels of 89% carboxyhemoglobin saturation of whole blood are commonly found in which of the following? Fatal carbon monoxide poisoning Nonsmoking residents who live in the country Nonsmoking residents of large cities Cigarette smokers

Fatal carbon monoxide poisoning

Which test of exocrine pancreatic function is noninvasive and can differentiate pancreatic insufficiency in children with cystic fibrosis? Fecal elastase NBT-PABA Phospholipase-A2 Urinary amylase

Fecal elastase

In obstructive liver disease, the following test results are found: Feces: urobilinogen decreased; urine: bilirubin: positive; serum: conjugated bilirubin increased. Feces: urobilinogen decreased or negative; urine: urobilinogen decreased or negative; serum: conjugated bilirubin decreased. Feces: urobilinogen increased; urine: bilirubin: normal; serum: conjugated bilirubin normal or slightly elevated. None of the above

Feces: urobilinogen decreased; urine: bilirubin: positive; serum: conjugated bilirubin increased.

What is the primary storage form of iron? Hemosiderin Myoglobin Apotransferrin Ferritin

Ferritin

Which of the following are iron storage proteins? Hemosiderin Transferrin Ferritin and transferrin Porphyrins

Ferritin and transferrin

Which of the following chromogens will produce a colored complex with iron using spectrophotometry? Biuret Ferrozine Molybdic acid 8-hyroxyquinoline

Ferrozine

Serum lacks which of the following constituents? Electrolytes Glucose Fibrinogen Enzymes

Fibrinogen

Which of the following is not a defense biochemical barrier against foreign pathogens? Mucous membranes Sweat Skin Fingernails

Fingernails

In the thyroid gland, which of the following is described as the secretory unit? Calcitonin Follicle Colloid The isthmus

Follicle

Urea can be measured by incubation with urease followed by all of the following EXCEPT: Formation of a colored product by reaction with diacetyl. Measurement of increased conductivity. Ion-selective electrode measurement of the ammonia produced. NADH consumption in a reaction catalyzed by glutamate dehydrogenase.

Formation of a colored product by reaction with diacetyl.

The pharmacological response of drug is initiated when the drug is in which form? Bound to fatty acids Bound to proteins Bound to carbohydrates Free

Free

Which form of drugs is most available to reach target tissues? Protein-bound drug Free drug Ionized drug Bound and free drug

Free drug

The term associated with indirect methods for assessment of vitamin status is termed: Proportional assays Functional assays Reciprocal assays Bioassays

Functional assays

Pituitary gigantism is associated with which of the following? Growth (GH) deficiency GH excess Hypercorticolism Hypeprolactinemia

GH excess

Bile formed in the liver is stored in the: Liver. Gall bladder. Duodenum. Large intestine.

Gall bladder.

________ radiation causes the most damage to human cells. Ultraviolet Gamma Infrared Microwave

Gamma

_________ radiation causes the most damage to human cells. Ultraviolet Gamma Infrared Microwave

Gamma

Which of the following techniques is a definitive means for both qualitative and quantitative analysis of drugs of abuse? Thin layer chromatography (TLC) Gas chromatography coupled with mass spectrometry Spectrophotometry Osmometry

Gas chromatography coupled with mass spectrometry

Which of the following conditions occurs in patients with Zollinger-Ellison syndrome? Overactive large bowel Excessive loss of protein Gastric hypersecretion Hyposecretion of IgA and IgM

Gastric hypersecretion

Which analyte is important in the diagnosis of Zollinger-Ellison syndrome? Gastrin Amylase Glycogen Insulin

Gastrin

What is the proper order of structures of a nephron from the blood to the collecting duct? Glomerulus, distal tubule, proximal tubule, loop of Henle Loop of Henle, glomerulus, proximal tubule, distal tubule Glomerulus, proximal tubule, loop of Henle, distal tubule Loop of Henle, proximal tubule, distal tubule, glomerulus

Glomerulus, proximal tubule, loop of Henle, distal tubule

Which of the following is the primary hypoglycemic hormone (kicks in when glucose is low)? Insulin Thyroxine Glucagon Growth hormone

Glucagon

Which of the following is the primary hypoglycemic hormone? (kicks in when you have hypoglycemia) Insulin Thyroxine Glucagon Growth hormone

Glucagon

The alpha cells of the islets of Langerhans of the pancreas produce: Insulin. Glucagon. Somatostatin. Pancreatic polypeptide.

Glucagon.

Which of the following laboratory analytes is tested for a patient with suspected lactose intolerance? Glucose Fructose Mannose Lactase

Glucose

___________ is not a substrate for amylase. Starch Glucose Carbohydrates Glycogen

Glucose

Which inherited hemoglobinopathy or anemia affects men more than women? Paroxysmal nocturnal hemoglobinuria Glucose-6-phosphate dehydrogenase deficiency Hereditary spherocytosis or elliptocytosis α-Thalassemia

Glucose-6-phosphate dehydrogenase deficiency

The enzymatic determination of glycerol in triglyceride analysis usually involves conversion of glycerol to: Oleic acid. Phospholipid. Formaldehyde. CO2 and H2O. Glycerol phosphate.

Glycerol phosphate.

The biosynthesis of heme commences with which two compounds? Glycine and succinyl CoA Alanine and glycine Glycerin and acetyl-CoA Lysine and globulin

Glycine and succinyl CoA

What is the explanation for a high FSH in primary hypogonadism? Hypothalamic failure Pituitary failure Gonadal failure All of these are correct.

Gonadal failure

The basement membrane of the nephron is rich in collagen. The production of autoantibodies leads to Sjögren syndrome. Goodpasture syndrome. Wiskott-Aldrich syndrome. delayed hypersensitivity type III.

Goodpasture syndrome.

_________ is usually characterized by an increase in uric acid. Rheumatoid arthritis Osteoarthritis Gout Ankylosing spondylitis

Gout

Which hepatitis B marker is associated with current infection? HBsAg Anti-HBs Anti-HBc total Alanine aminotransferase

HBsAg

The first serological marker of Hepatitis B is: HBsAg. HBeAg. Anti-HBc. Anti-HBs.

HBsAg.

Which hepatitis B marker panel is consistent with someone having taken the hepatitis B vaccine? HBsAg: positive, antiHBsAg: positive, anti-HBc: positive HBsAg: positive, antiHBsAg: negative, anti-HBc: negative HBsAg: negative, antiHBsAg: positive, anti-HBc: negative HBsAg: negative, antiHBsAg: positive, anti-HBc: positive

HBsAg: negative, antiHBsAg: positive, anti-HBc: negative

Board Review Question: Which of the following is secreted by the placenta and used for the early detection of pregnancy FSH HCG LH progesterone

HCG

Which of the following contributes the most to the serum total CO 2? Carbonium ion PCO2 Dissolved carbon dioxide HCO3-

HCO3-

Board Review Question: High levels of which lipoprotein class are associated with decreased risk of accelerated atherosclerosis? chylomicrons VLDL LDL HDL

HDL

Which of the following is used to assess the usefulness of trastuzumab (Herceptin ®) therapy for breast cancer? CA 15-3 HER-2/neu CA 125 Prolactin

HER-2/neu

Which of these proteins prevents the loss of hemoglobin and its iron through the kidneys? Haptoglobin. Transferrin. Ceruloplasmin. Hemopexin

Haptoglobin.

Atherosclerosis is defined or described as: Hardening of the arteries that occurs over a period of many years due in part to the abnormal accumulation of lipids. Syndromes that encompass a continuum of clinical presentations ranging from unstable angina to non-Q-wave AMI. A degenerative condition of the muscles. An acute-phase reactant whose concentration in the blood rises dramatically in response to nonspecific inflammatory stimuli.

Hardening of the arteries that occurs over a period of many years due in part to the abnormal accumulation of lipids.

The reason that carbon monoxide is so toxic is because it: Is a protoplasmic poison Combines with cytochrome oxidase Has 200-250 times the affinity of oxygen for hemoglobin binding sites. Sensitizes the myocardium

Has 200-250 times the affinity of oxygen for hemoglobin binding sites.

An example of an organ-specific disease with autoimmune antibodies is Hashimoto's thyroiditis rheumatoid arthritis Wegener's granulomatosus systemic lupus erythematosus

Hashimoto's thyroiditis

Board Review Question: An example of an organ-specific disease with autoimmune antibodies is systemic lupus erythematosus Hashimoto's thyroiditis Wegener's granulomatosus rheumatoid arthritis

Hashimoto's thyroiditis

Which of the following is not a sign or symptom of congestive heart failure? Shortness of breath Chest pain Fluid overload Headache

Headache

Aspartate aminotransferase is elevated in diseases involving the: Renal cortex. Heart muscle. Intestinal epithelium. Acinar cells of the pancreas.

Heart muscle.

Peptic ulcer disease (PUD) is associated with: Staphylococcus aureas and Bacteriodies. Helicobacter pylori and consumption of nonsteroidal anti-inflammatory drugs (NSAIDs). Escherichia coli and consumptions of the steroid cortisol. Helicobacter pylori and consumptions of cocaine.

Helicobacter pylori and consumption of nonsteroidal anti-inflammatory drugs (NSAIDs).

Protoporphyrins that chelate iron are called: Hemin. Hemoglobin. Heme. Hemosiderin.

Heme.

Which of the following buffers has the greatest percentage buffering capacity? Hemoglobin Bicarbonate Phosphate Protein

Hemoglobin

Which of the following is incorrect regarding the diagnosis of diabetes mellitus? Fasting blood glucose ≥126 mg/dL Random glucose ≥200 mg/dL Hemoglobin A1c ≥7.0% 2-hour postprandial glucose ≥200 mg/dL during an oral glucose tolerance test

Hemoglobin A1c ≥7.0%

HELLP is a life-threatening manifestation of preeclampsia during pregnancy. What do the acronyms indicate? Hemoglobinopathy, Elevated Lipase, Low Phosphorus Hemolysis, Elevated Liver enzymes, Lumbar Puncture (needed) Haptoglobinemia, Elevated Lactate, Low Proteins Hemolysis, Elevated Liver enzymes, Low Platelets

Hemolysis, Elevated Liver enzymes, Low Platelets

Which of these proteins removes heme from circulation? Haptoglobin. Transferrin. Ceruloplasmin. Hemopexin

Hemopexin

What is the difference between an ischemic versus a hemorrhagic stroke? Hemorrhagic: blockage of a cerebral artery; ischemic: blood leakage into brain tissue Hemorrhagic: embolism of a cerebral artery; ischemic: blood leakage into brain tissue Hemorrhagic: blood leakage into brain tissue; ischemic: blockage of a cerebral artery Hemorrhagic: a thinning of a cerebral artery leading to ballooning; ischemic: blockage of a cerebral artery

Hemorrhagic: blood leakage into brain tissue; ischemic: blockage of a cerebral artery

Board Review Question: The bicarbonate and carbonic acid ratio is calculated from an equation by Natelson Henderson-Hasselbalch Siggaard-Andersen Gibbs-Donnan

Henderson-Hasselbalch

Which of the following tubes can be used for measuring total calcium in plasma with interference? Heparin Citrate EDTA Oxalate

Heparin

The specimen of choice for measuring blood pH, pO 2, and pCO 2 is: Heparinized capillary blood. Heparinized arterial blood. Heparinized venous blood. Serum.

Heparinized arterial blood.

Viral hepatitis that results in the largest percentage of chronic hepatitis is: Hepatitis A. Hepatitis B. Hepatitis C. Hepatitis D.

Hepatitis C.

Complications of diabetes mellitus include all of the following EXCEPT: Heart disease and stroke. Neuropathy. Nephropathy. Hepatitis.

Hepatitis.

A markedly elevated serum AFP is associated with which of the following? Ovarian cancer Small Cell Lung cancer Hepatocellular carcinoma Breast cancer

Hepatocellular carcinoma

The toxic effect of acetaminophen overdose is: Cardiac arrest. Hepatocystic necrosis. Renal necrosis. Hypotension.

Hepatocystic necrosis

The cells that make up 70% of the liver's mass are: Kupffer cells Hepatocytes Endothelial cells None of the above

Hepatocytes

An autosomal recessive disorder of iron metabolism, which is characterized by excessive iron absorption and accumulation in various tissues in the body, is termed: Hereditary hemochromatosis. Wilson's disease. á1-antitrypsin. Dubin-Johnson.

Hereditary hemochromatosis.

The enzyme that catalyzes the reaction ATP + D-glucose? ADP + D-glucose-6-phosphate is: Glucose oxidase Lyase Hexokinase Mutase

Hexokinase

Risk factors for coronary heart disease include all of the following EXCEPT: Diabetes mellitus. Other forms of atherosclerotic disease. Hypertension. High HDL cholesterol.

High HDL cholesterol.

Why do patients with Waldenström's macroglobulinemia sometimes develop hyperviscosity syndrome? The IgM can form pentamers. IgM paraproteins can also cause cryoglubulinemia. High concentrations of monoclonal IgM can be produced. All of these are correct.

High concentrations of monoclonal IgM can be produced. The IgM can form pentamers.

All of the following statements about clinical hypoglycemia are true EXCEPT: Neuroglycopenic symptoms must be present at the time of the low blood sugar. Symptoms can be relieved by ingestion of carbohydrates. High fasting insulin levels must be present to make a diagnosis. C-peptide levels are normal or elevated.

High fasting insulin levels must be present to make a diagnosis.

Glucose concentration in serum is: Higher than the concentration in whole blood. Lower than the concentration in whole blood. Equal to the concentration in whole blood. Unable to predict- variable.

Higher than the concentration in whole blood.

The protein part of the enzyme molecule WITH the cofactor is called a(n): Apoenzyme. Zymogen. Holoenzyme. Coenzyme.

Holoenzyme.

Which test doubles as a marker for pregnancy and gonadal tumor? Testosterone Human growth hormone Human choriogonadotropin Estradiol

Human choriogonadotropin

Which of the following hormones is useful in identifying women with ectopic pregnancies or abnormal intrauterine pregnancies? Human pituitary gonadotropin Human chorionic gonadotropin Human luteinizing hormone Human progesterone

Human chorionic gonadotropin

A patient with acute intermittent porphyria is deficient in which enzyme? Coproporphyrinogen oxidase Aminolevulinic acid synthase Ferrochelatase Hydroymethylbilane synthase

Hydroymethylbilane synthase

Which of the following cellular adaptations is indicative of an increase in cell number? Dysplasia Hyperplasia Metaplasia Hypertrophys

Hyperplasia

Risk factors for the development of coronary heart disease include which of the following? Tobacco smoking, elevated serum homocysteine, low serum LDL, and high serum levels of CRP Tobacco smoking, low serum homocysteine, low serum LDL, and high serum levels of CRP. Hypertension, abdominal obesity, low HDL-C, high serum levels of CRP, and elevated levels of homocysteine. Walking at least one hour per day, low serum homocysteine, low serum CRP, and low serum levels of LDL-C.

Hypertension, abdominal obesity, low HDL-C, high serum levels of CRP, and elevated levels of homocysteine.

A patient has the following arterial blood gas results: pH = 7.57; pCO2 = 25 mmHg; pO2 = 100 mmHg; HCO 3- =22 mmol/L. Which of the following is most likely to account for these results? Hypokalemia Hyperventilation Hypoventilation Improper specimen collection

Hyperventilation

Which of the following is the primary compensatory mechanism for metabolic acidosis? Hypoventilation Hyperventilation Bicarbonate excretion Retention of hydrogen ions

Hyperventilation

Which of the following laboratory results is consistent with protein-losing enteropathy (PLE)? Hyperproteinemia Hypoalbuminemia Hyponatremia Hypercholesterolemia

Hypoalbuminemia

A patient with an insulinoma may exhibit dizziness and fainting attributable to: Hypoglycemia. Hyperglycemia. Ketosis. Acidosis.

Hypoglycemia

Increased uric acid is found in each of the following conditions EXCEPT: Gout. Hypothyroidism. Lesch-Nyhan syndrome. Renal failure.

Hypothyroidism.

Complications of acute pancreatitis include all of the following EXCEPT: Adult respiratory distress syndrome. Hypotriglyceridemia. Pseudocyst formation. Splenic varices.

Hypotriglyceridemia.

What is the difference between ischemia and hypoxia? The two terms are used interchangeably. Hypoxia is an oxygen deficiency while ischemia is caused by a reduced flow of blood. Ischemia is the only cause of hypoxia. Hypoxia is the only cause of ischemia.

Hypoxia is an oxygen deficiency while ischemia is caused by a reduced flow of blood.

Respiratory alkalosis can be seen in patients with: Severe diarrhea. Chronic obstructive pulmonary disease (COPD). Mechanical hypoventilation. Hysterical hyperventilation.

Hysterical hyperventilation.

Respiratory alkalosis can be seen in patients with: Severe diarrhea. Chronic obstructive pulmonary disease (COPD). Mechanical hypoventilation. Hysterical hyperventilation.

Hysterical hyperventilation.

Board Review Question: In lipoprotein phenotyping, chylomicrons are present in the plasma of persons with which of the lipoprotein phenotypes? I and IIa I and IIb I and V II and III

I and V

Which of the following cells contain cholecystokinin (CCK)? G cells from the gut B cells from the pancreas I cells from the upper small intestinal mucosa S cells from the salivary glands

I cells from the upper small intestinal mucosa

Which lipoprotein particle has the lowest concentration in a nonfasting sample of a healthy subject? LDL IDL VLDL Calculated LDL from the Friedewald equation

IDL

Which route of administration bypasses the first phase of drug processing? Oral administration IV injection Rectal insertion Transdermal administration (on the skin)

IV injection

Board Review Question: The immunoglobulin class typically found to be present in saliva, tears and other secretions is: IgD IgM IgG IgA

IgA

Board Review Question: Which of the following immunoglobulins classes are associated with a secretory component (transport piece? IgE IgG IgD IgA

IgA

_____ is found in abundance in body secretions. IgG IgA IgM IgD

IgA

Board Review Question: Which class of immunoglobulin is thought to function as an antigenic receptor site on the surface of immature B lymphocytes? IgG IgA IgD IgM

IgD

Board Review Question: Measurement of serum levels of which of the following immunoglobulins can serve as a screening test for multiple allergies? IgM IgA IgG IgE

IgE

Board Review Question: The immunoglobulin class associated with immediate hypersensitivity or atopic reactions is IgA IgD IgM IgE

IgE

Which immunoglobulin responds within a few minutes after exposure to an antigen and constitutes a type 1 hypersensitivity reaction? IgG IgA IgM IgE

IgE

Which ϒ-globulin is increased in allergies? IgG IgM IgA IgE

IgE

Board Review Question: To which of the following classes do red cell antibodies usually belong? IgE IgG IgA IgD

IgG

Which is the most abundant ϒ-globulin? IgG IgM IgA IgE

IgG

Board Review Question: Rheumatoid factor is capable of forming circulating immune complexes only when IgM-type autoantibody is present an antigen found in the serum of patients with rheumatoid arthritis IgG or IgM autoantibody identical to the rheumatoid arthritis precipitin

IgG or IgM autoantibody

Board Review Question: Patients suffering from Waldenstrom's macroglobulinemia demonstrates excessively increased concentrations of which of the following? IgA IgM IgG IgD

IgM

Board Review Question: Which of the following immunoglobulins is the most efficient agglutinin? IgM IgE IgA IgG

IgM

Lupus erythematosus and osteoarthritis cause damage to human tissues through which mechanism? Hypoxia Myocrobes Immune reaction Nutrition

Immune reaction

The principle method used to measure hormone levels in blood in most clinical laboratories is: Gas chromatography. Thin layer chromatography. Electrophoresis. Immunoassays.

Immunoassays.

FK506 (tacrolimus) is classified as a/an: Immunosuppressant. Sedative hypnotic. Cardiac glycoside. Antiasthmatic.

Immunosuppressant

What is the difference between primary and secondary amenorrhea? In primary amenorrhea, there is a delay in the first menstruation until age 17. In secondary amenorrhea, there is an absence of monthly blood and cell flow. FSH levels are low in primary amenorrhea. There is a genetic basis for both forms of amenorrhea.

In secondary amenorrhea, there is an absence of monthly blood and cell flow.

A deficiency of vitamin K (menaquinone) can result in which of the following? Scurvy Pellagra Increased clotting time Hyperglycemia

Increased clotting time

Which of the following is an effect of increased parathyroid secretion? Decreased intestinal absorption of calcium Increased intestinal absorption of calcium Decreased blood calcium levels Decreased bone resorption

Increased intestinal absorption of calcium

Which of the following test combinations indicates the HIGHEST risk for coronary heart disease? Increased total cholesterol, increased HDL cholesterol Increased total cholesterol, decreased HDL cholesterol Decreased total cholesterol, decreased HDL cholesterol Decreased total cholesterol, increased HDL cholesterol

Increased total cholesterol, decreased HDL cholesterol

Which of the following is not a characteristic of menopause? Hot flashes Vaginal dryness Osteoporosis Increased vaginal elasticity

Increased vaginal elasticity

In a patient with suspected primary hyperthyroidism (Graves' disease), one would expect the following laboratory serum results: total T 4 ____FT 4____, and TSH_____. Increased, decreased, increased Increased, decreased, decreased Increased, increased, decreased Decreased, decreased, increased

Increased, increased, decreased

In uncontrolled diabetes mellitus, cholesterol and triglycerides are: Increased. Decreased. Not affected. Neither is increased

Increased.

A new lab test is being developed for a specific disease. Which of the following populations is the best to compare this test against? Completely healthy, age-, and gender-matched Completely healthy, age-, and gender-mismatched Individuals who produce clinical symptoms or presentation but are devoid of the disease Individuals before they develop the disease

Individuals who produce clinical symptoms or presentation but are devoid of the disease

_________ causes orchitis. Genetic disease Infection Testicular injury Psychiatric disease

Infection

Which disease is responsible for the most cases of pneumonia? HIV/AIDS Influenza infection Hepatitis C infection Polio virus

Influenza infection

What is the primary route of exposure in humans to mercury? Inhalation of vapors Contact with the skin of elemental mercury (e.g., mercury containing thermometers). Ingestion of mercury containing medications Direct injection of mercury from contaminated needles

Inhalation of vapors

In a specimen collected for plasma glucose analysis, sodium fluoride: Serves as a coenzyme of hexokinase Prevents reactivity of non glucose reducing substances Precipitates protein Inhibits glycolysis

Inhibits glycolysis

Which of the following hormones does NOT stimulate glycogenolysis? Insulin Glucagon Epinephrine Thyroxine

Insulin

A person who is deficient of chromium may develop which of the following? Insulin resistance and glucose intolerance Cardiovascular disease Chronic obstructive pulmonary disease Acute renal failure

Insulin resistance and glucose intolerance

All of the following are tests of exocrine pancreatic function EXCEPT: Secretin/cholecystokinin. Pancreatic elastase. Fecal fat. Insulin.

Insulin.

The only hormone that causes a decrease in blood glucose levels is: Glucagon. Thyroxine. Insulin. Parathyroid hormone.

Insulin.

Insulin and C-peptide levels are important in diagnosing: Glucagonomas. Insulinomas. Somatostatinomas. Pancreatic neoplasms.

Insulinomas.

Which route of administration delivers drugs the fastest to the blood? Oral Intravenous Subcutaneous Intramuscular

Intravenous

Board Review Question: Absorption of vitamin B12 requires the presence of: Folic acid Secretin Gastrin Intrinsic factor

Intrinsic factor

An exogenous substance used to assess the glomerular filtration rate that affords the most accurate measure of renal clearance is: Urea. Inulin. Glucose. Creatinine. Para aminohippurate.

Inulin.

Measurement of sodium, potassium, and chloride are commonly performed in laboratories using which of the following? Ion selective electrodes Colorimetry Photometry Gas chromatography

Ion selective electrodes

A 25-year-old female visits her physician complaining of lethargy and wants to take a nap all of the time. Her physician orders laboratory tests and the results are shown below. Which of the following conditions best represent this patient's status? Serum iron(µg/dL): DecTIBC (µg/dL): IncTransferrin saturation (%): DecSerum Ferritin (µg/L): Dec Thalassemia major Iron deficiency anemia Variegate porphyria Hemochromatosis

Iron deficiency anemia

A patient has small red blood cells and an MCV of 80. What is the most likely cause? Iron deficiency anemia Vitamin B12 deficiency Aplastic anemia Anemia of chronic renal disease

Iron deficiency anemia

All of the following are associated with gestational diabetes EXCEPT: It converts to diabetes mellitus after pregnancy in 30-60% of patients. Is diagnosed using the same glucose tolerance criteria as in nonpregnant women. Is defined as glucose intolerance during pregnancy. Associated with increased fetal risk.

Is diagnosed using the same glucose tolerance criteria as in nonpregnant women.

An important difference between parametric statistics and nonparametric statistics is that parametric statistics presumes a Gaussian distribution, whereas nonparametric statistics: Assumes linearity. Is distribution-free, and usually comprised of nominal variables Is sensitive to gender and age. Accepts all outliers.

Is distribution-free, and usually comprised of nominal variables

An important difference between parametric statistics and nonparametric statistics is that parametric statistics presumes a Gaussian distribution, whereas nonparametric statistics: Assumes linearity. Is distribution-free, and usually comprised of nominal variables Is sensitive to gender and age. Accepts all outliers.

Is distribution-free, and usually comprised of nominal variables

The albumin cobalt-binding test is used to measure which of the following? Microalbumin Total serum protein Ischemia modified albumin Serum cobalt

Ischemia modified albumin

The reaction that allows CO 2 to move from peripheral tissue cells to plasma, then to erythrocytes and O 2 from erythrocytes to plasma, and then into peripheral tissue cells is termed: Chloride momentum. Isothionate shift. Cytochrome p450 shift. Isohydric shift.

Isohydric shift.

Which is a characteristic of unconjugated bilirubin? It is water-soluble It reacts faster than conjugated bilirubin It has the same absorbance properties as conjugated bilirubin It a not water-soluble

It a not water-soluble

Lp (a) is considered a risk factor for developing atherosclerosis due to which of the following? It competes with fibrinogen for binding sites, thus interfering with clot lysis and increasing the risk of acute myocardial infarction (AMI) It is produced by macrophages and expressed in atherosclerotic lesions It activates complement It competes with plasminogen for binding sites, thus interfering with clot lysis and increasing the risk of acute myocardial infarction (AMI)

It competes with plasminogen for binding sites, thus interfering with clot lysis and increasing the risk of acute myocardial infarction (AMI)

Why was the protein antitrypsin labeled as α 1? It designates electrophoretic migration using serum protein electrophoresis. The name differentiates it from the other isoproteins, e.g., β1 and β2 antitrypsin. It binds to α1 immunoreactive trypsin. It was the first of the protease proteins to be described.

It designates electrophoretic migration using serum protein electrophoresis.

Which is true concerning total iron binding capacity? It is a direct measure of ferritin concentrations. It is a direct measure of hemosiderin concentrations. Low levels are seen with oral contraceptive use. It determines the number of binding sites on transferrin.

It determines the number of binding sites on transferrin.

What is the mechanism of action for cocaine at the junction between nerves? It blocks the reuptake. It blocks update at dendritic receptors. It enhances release from vesicles. It inhibits release from vesicles.

It enhances release from vesicles.

Which of the following is true regarding prealbumin? It is a precursor protein to the production of albumin. It has high molecular weight. It is found in higher concentrations in CSF than albumin. It functions to bind thyroid hormones.

It functions to bind thyroid hormones.

Which of the following is true regarding Lp(a)? It is a metabolite of LDL. It is a metabolite of HDL. It is LDL without apo B. It is a separate entity from the classical lipoproteins.

It is a separate entity from the classical lipoproteins.

Which is true concerning muscular dystrophy? It occurs in males because it is a Y-linked disease. It is associated with muscle fiber atrophy. Symptoms mimic acute myocardial infarction. Creatine kinase levels are normal or mildly increased.

It is associated with muscle fiber atrophy.

Which of the following is false of BUN? It is a marker of nitrogen balance. It is used in conjunction with urine urea nitrogen. It is constantly reabsorbed by the tubule. It can be increased in nonrenal conditions.

It is constantly reabsorbed by the tubule.

Which of the following is FALSE about PSA? It is a single-chain glycoprotein It is used as a tumor marker It is not elevated in benign prostatic hyperplasia It is quantified in serum by immunoassays

It is not elevated in benign prostatic hyperplasia

Which of the following statement about selenium is FALSE? It is present in several selenoproteins in humans It is a nonmetal. It is not important for proper maintenance of health in humans. Selenocysteine is a biologically active compound in humans.

It is not important for proper maintenance of health in humans.

Ionized or free calcium is clinically useful for which of the following reasons? It is the best indication of phosphate status because it is biologically active and tightly regulated by PTH and Vitamin D. It is the best indication of calcium status because it is biologically active and tightly regulated by thyroid hormones. It is the best indication of calcium status because it is biologically inactive and tightly regulated by PTH and Vitamin D. It is the best indication of calcium status because it is biologically active and tightly regulated by PTH and Vitamin D.

It is the best indication of calcium status because it is biologically active and tightly regulated by PTH and Vitamin D.

Which of the following is true concerning lithium? Lithium is a major endogenous monovalent cation. It is used to treat manic depression. Use of lithium heparin as an anticoagulant is acceptable. It exchanges for potassium during acidosis.

It is used to treat manic depression.

The significance of CRP in the arterial wall is described as which of the following? It predicts the severity of arteriosclerosis It predicts the severity of atherosclerosis and is able to bind to damaged membranes and lipids It predicts the severity of atherosclerosis but cannot bind to damaged membranes and lipids It has nothing to do with either arteriosclerosis or atherosclerosis

It predicts the severity of atherosclerosis and is able to bind to damaged membranes and lipids

Creatinine reacts with strong alkaline picrate to form a yellow-red compound. This reaction is: Nessler's reaction. Ehrlich's diazo reaction. Jaffe reaction. Lieberman-Burchard reaction.

Jaffe reaction.

Board Review Question: The most widely used methods for bilirubin measurement are those based on the Jendrassik-Grof method Schales and Schales method 8-hydroxyquinoline reaction Jaffe reaction

Jendrassik-Grof method

Which vitamin is involved in hemostasis? A C D K

K

Board Review Question: Slight hemolysis can cause erroneous laboratory results in which serum analyte? Cl- K+ Na+ Ca++

K+

Select all the fat soluble vitamins K E A B D C

K,E,A,D

Which of the following are ketones, and which are acids? Ketones: acetone and acetoacetic. Acids: β-hydroxybutyrate and acetoacetic. Ketones: acetone only. Acids: β-hydroxybutyrate and acetoacetic. Ketones: acetone, β-hydroxybutyrate. Acids: acetoacetic only. All of these are ketones and acids.

Ketones: acetone and acetoacetic. Acids: β-hydroxybutyrate and acetoacetic.

Increased serum peak and trough levels of aminoglycosides (e.g., tobramicin) are often associated with toxic effects to which of the following organs? Heart Kidney Spleen Liver

Kidney

An elevated BUN usually indicates: Liver disease. Kidney disease. Pancreatic disease. Myocardial infarction.

Kidney disease.

These cells are phagocytes that engulf bacteria, old RBCs, toxins and cellular debris epithelial cells hepatocytes Kupffer cells monocytes

Kupffer cells

Which of these enzymes is an oxidoreductase that drives the reversible reaction that converts L-lactate to pyruvate and NADH? CK LD ALP AST

LD

Which of the commonly measured enzymes has the least specificity toward one organ? AST CK LDH ALT

LDH

Board Review Question: 60% to 75% of the plasma cholesterol is transported by LDL HDL chylomicrons VLDL

LDL

Board Review Question: In familial hypercholesterolemia, the hallmark finding is an elevation of apolipoprotein A1 chylomicrons LDL HDL

LDL

Board Review Question: Premature atherosclerosis can occur when which of the following becomes elevated? chylomicrons HDL cholesterol prostaglandins LDL cholesterol

LDL cholesterol

Testing of _____ indicates ovulation and potential fertility. FSH LH testosterone estradiol

LH

Board Review Question: Zinc protoporhyrin or free eryhtrocyte protoporphyrin measurements are useful to assess blood concentrations of mercury beryllium arsenic lead

Lead

Free erythrocyte protoporphyrin levels are useful for assessing exposure to which of the following metals? Lead Iron Zinc Copper

Lead

During a normal pregnancy, which of the following is true regarding the lecithin (L) and sphingomyelin (S) ratio of amniotic fluid? Both lecithin and spingomyelin increase proportionally with gestational age. Lecithin increases while spingomyelin remains the same. Sphingomyelin increases while lecithin remains the same. Both decline with gestational age.

Lecithin increases while spingomyelin remains the same.

A glucose result that is lower than the detection limit of the method should be reported as which of the following? Zero Less than the detection limit value The actual concentration value given by the analyzer or as calculated by the operator Greater than the detection limit value

Less than the detection limit value

As C-reactive protein is increased during acute inflammation, what is the clinical value for high-sensitivity CRP? Levels greater than 1000 indicate myocardial infarction. Levels below the normal range indicate cardiovascular disease. In the absence of acute or chronic systemic inflammation, a mild increase indicates cardiovascular disease risk. Levels correlate with the size of a myocardial infarction.

Levels correlate with the size of a myocardial infarction.

Which of the following is correct regarding the use of amylase and lipase in patients with acute pancreatitis? Amylase releases sooner into blood than lipase. Amylase releases later into blood than lipase. Lipase is more specific for pancreatic disease than amylase. Lipase is less specific for pancreatic disease than amylase.

Lipase is more specific for pancreatic disease than amylase.

Eicosanoids such as the prostaglandins are derived from Proteins Lipids Carbohydrates Heavy metals

Lipids

Board Review Question: A carbonate salt used to control manic-depressive disorders is Digoxin Acetaminophen Phenytoin Lithium

Lithium

Which of the following compounds is prescribed to control patients with manic-depressive tendencies? Digoxin Acetaminophen Lithium Phenytoin

Lithium

__________ is also an antidepressant. Sodium Potassium Cesium Lithium

Lithium

_______________ is not a common sequela of poorly controlled diabetes. Neuropathy Nephropathy Cerebrovascular disease Liver cancer

Liver cancer

All of the following conditions are associated with hyperuricemia EXCEPT: Liver failure. Malignancy. Renal failure. Primary "essential" overproduction of uric acid.

Liver failure.

Glycogen is stored in the: Pancreas. Liver. Spleen. Gall bladder.

Liver.

______________ is not known to cause cancer. Sunlight Human immunodeficiency virus Consumption of nitrites Living near power lines

Living near power lines

Cyanide blocks mitochondrial cytochrome C oxidase. Which of the following biochemical mechanisms is most likely to be affected? Loss of calcium homeostasis Defect in permeability Free radical generation Loss of energy production

Loss of energy production

Which of the following is true regarding calcium homeostasis? Low calcium inhibits PTH secretion. Low calcium stimulates release of 1,25 dihydroxyvitamin D. Low calcium releases calcitonin. Low calcium can be caused by excessive antacid use.

Low calcium stimulates release of 1,25 dihydroxyvitamin D.

The following are criteria for Clinical Diagnosis of Metabolic Syndrome EXCEPT: Elevated waist circumference. Elevated triglycerides. Reduced HDL-C. Low fasting glucose.

Low fasting glucose.

In the secretin-cholecystokinin test, which of the following results is indicative of maldigestion? High lipase and amylase result Low level of cholecystokinin Low level of exocrine pancreatic enzymes, including trypsin Decreased fecal fat

Low level of exocrine pancreatic enzymes, including trypsin

What is the clinical significance of testing for prealbumin? High levels are associated with an acute phase reaction Levels are associated with glomerular injury in diabetic nephropathy Low levels indicate compromised nutritional status Low levels are associated with increased free cortisol

Low levels indicate compromised nutritional status

Which of the following electrolyte results is characterized by the syndrome of inappropriate antidiuretic hormone secretion (SIADH)? Low serum and urine sodium High serum and urine sodium High serum and low urine sodium High urine and low serum sodium

Low serum and urine sodium

A patient with Addison's disease would present with which of the following? High sodium, low potassium levels Low sodium, high potassium levels Normal sodium, low potassium levels Low sodium, low potassium levels

Low sodium, high potassium levels

Which is the correct bilirubin pattern of results for prehepatic jaundice? High percentage of conjugated bilirubin in serum, high urine bilirubin Low urine urobilinogen, high urine bilirubin High percentage of unconjugated bilirubin in serum, negative urine bilirubin High urine urobilinogen, low unconjugated bilirubin High urine urobilinogen, high urine bilirubin

Low urine urobilinogen, high urine bilirubin

Which of the following cardiac biomarker co-traffics with low-density lipoprotein? MPO CRP Lp-PLA2 Leptin

Lp-PLA2

Berylliosis in humans affects which of the following organs? Brain Heart Urinary bladder Lungs

Lungs

Which is a foam cell? Liver cell with a high phospholipid content Neuron with a high spingolipid content Macrophage with a high cholesterol ester content Cell that produces Lp(a)

Macrophage with a high cholesterol ester content

Which human cells provide protection against foreign invaders while themselves causing damage? Macrophages and neutrophils Red cells and white cells Platelets Liver and kidney cells

Macrophages and neutrophils

Which of the following electrolyte measurements would be of clinical usefulness to the clinician who is treating patients for pregnancy-induced hypertension? Ionized calcium Potassium Magnesium Phosphorus

Magnesium

__________ is used to treat pregnant women for eclampsia. Calcium Magnesium Potassium Sodium

Magnesium

Peltier thermal electric module functions to: Maintain a constant pressure environment in the automated pipetting device. Maintain a constant temperature environment for polychromatic light source. Maintain a constant temperature environment for photomultiplier tube. Maintain a constant temperature environment for the reaction cuvets.

Maintain a constant temperature environment for the reaction cuvets.

Which of the following conditions is associated with an elevated total protein? Cirrhosis Glomerular disease Starvation Malignancy

Malignancy

Which is true regarding tumors? All are cancerous. A benign process is always the precursor to a malignancy. Hyperplasia is the precursor to cancer. Malignant tumors are not subject to normal regulatory growth controls.

Malignant tumors are not subject to normal regulatory growth controls.

Methotrexate is a drug used for which of the following? Management of lymphoblastic leukemia in children Management of pernicious anemia Management of breast cancer Management of hypervitaminosis D

Management of lymphoblastic leukemia in children

Board Review Question: Lithium therapy is widely used in treatment of Manic depression Aggression Hypertension Hyperactivity

Manic depression

Which inborn error of metabolism is associated with a defect in branched-chain-α-ketoacid dehydrogenase? Tay-Sachs Maple syrup urine disease Phenylketonuria Alkaptonuria

Maple syrup urine disease

THC (∆ 9-tetrahydrocannabinol) is the principal active metabolite of which of the following? Benzodiazepine Marijuana Acetaminophen Morphine

Marijuana

Characteristics of the ideal cardiac marker include all of the following EXCEPT: Marker is specific for cardiac tissue versus skeletal muscle. Marker rises soon after symptoms of cardiac ischemia occur. Marker must return to normal in a relatively short period of time. Marker is easy, rapid, and inexpensive to measure.

Marker must return to normal in a relatively short period of time.

Which antibodies protect the fetus during gestation? Maternal IgG Maternal IgM Fetal IgG Fetal IgM

Maternal IgG

Which of the following is a useful clinical laboratory test for bile salt malabsorption? Measurement of 1, 25-dihydroxycholecalciferol Measurement of 7á-hydroxy-4-cholesten-3-one Measurement of cholesterol Measurement of cytotoxin-associated gene A (CagA)

Measurement of 7á-hydroxy-4-cholesten-3-one

_____________ is caused by excessive sunlight exposure. Liver cancer Ovarian cancer Melanoma Myeloma skin cancer

Melanoma

What is the best interpretation of the following blood gas results? pH = 7.32 pCO 2 = 31 Bicarbonate = 15.4 Metabolic acidosis with compensation Metabolic acidosis without compensation Respiratory acidosis with compensation Respiratory acidosis without compensation

Metabolic acidosis with compensation

A patient's blood gas results are: pH= 7.49; PCO = 54 mmHg; HCO 3 - = 39 mmol/L; pO2 = 100 mmHg. These results are consistent with which of the following? Respiratory alkalosis Respiratory acidosis Metabolic alkalosis Metabolic acidosis

Metabolic alkalosis

A 43-year-old female arrived at the emergency department with altered level of consciousness. She complained of chronic but moderate severity acid indigestion. This was partially relieved by taking antacids. Her blood gases results are as follows: RESULTS: pH 7.60 pCO 2 38 mm Hg HCO 3 - 40 mmol/L This patient demonstrates: Respiratory acidosis. Metabolic alkalosis. Respiratory alkalosis. Metabolic acidosis.

Metabolic alkalosis.

The group of multiplex risk factors listed below for cardiovascular disease represents which of the following? · Abdominal obesity · Atherogenic dyslipidemia · Raised blood pressure · Insulin resistance · Prothrombotic state Hyperhomocysteinemia Atherosclerosis Acute coronary syndrome Metabolic syndrome

Metabolic syndrome

Which of the below is a group of interrelated metabolic risk factors that appear to directly promote the development of atherosclerotic cardiovascular disease? Metabolic syndrome Hypercholesterolemia Syndrome B Familial hypercholesterolemia

Metabolic syndrome

The protein product derived from the DNA sequence below contains which of the following amino acid sequences? DNA: 3' TACTTTCGCGGAACT 5' Tyrosine-phenylalanine-arginine-glycine-threonine Tyrosine-phenylalanine-arginine-glycine Methionine-lysine-alanine-proline Methionine-lysine-alanine-proline-tryptophan

Methionine-lysine-alanine-proline

Which form of mercury is the most toxic? Methylmercury Inorganic mercury Mercury present in salts Mercury vapors

Methylmercury

_____________ is useful for measuring the family of cytokine concentrations in serum with a high degree of precision and rapid turnaround time. Flow cytometry Mass spectrometry Microtiter plate array Bioassay

Microtiter plate array

Which of the following is an example of software that allows a laboratory to connect their existing LIS and instrumentation to facilitate sharing information and performs tasks not currently done with laboratories' existing hardware and software? Middleware LIS-HIS interface RS232 software Computer operating system

Middleware

What is a designer drug? FDA-approved medications that are generic to the ones originally approved Drugs that are altered by the pharma industry to improve efficacy and reduce toxicity Modified versions of known drugs intended for recreational abuse purposes Drugs that are designated to be tested for workplace drug testing programs

Modified versions of known drugs intended for recreational abuse purposes

What is the primary clinical usefulness of measuring carcinoembryonic antigen? Diagnosis of lung cancer Diagnosis of colorectal cancer Screening for breast cancer Monitoring for recurrence of colon cancer

Monitoring for recurrence of colon cancer

Which of the following indications is most useful for protein-based tumor markers? Screening for early disease detection Selection of optimum anticancer therapy Monitoring for therapeutic efficacy Diagnosis of disease

Monitoring for therapeutic efficacy

Which of the following cellular mediators of inflammation is not involved in an acute process? Neutrophils Monocytes Eosinophils T and B lymphocytes

Monocytes

Which of the following is NOT a metabolite of catecholamines? Methoxyhydroxyphenylglycol (MHPG) Vanillylmandelic acid (VMA) Homovanillic acid (HMA) Monoiodothyronine

Monoiodothyronine

High serum total protein but low albumin is usually seen in: Multiple myeloma. Hepatic cirrhosis. Glomerulonephritis. Nephrotic syndrome.

Multiple myeloma.

Creatinine would be increased in which of the following? Reye's syndrome Myocardial infarction Muscular dystrophy Hepatitis

Muscular dystrophy

Mrs. Smith has the following chemistry results: CK: moderately increased LD: moderately increased The probable diagnosis is: Myocardial infarction. Acute pancreatitis. Acute hepatitis. Cholecystitis.

Myocardial infarction.

Which cardiac disease is not inherited? Atrial septic defect Myocarditis Tetrology of Fallot Transposition of great arteries

Myocarditis

Which cardiac biomarker has the lowest molecular weight and, therefore, appears in blood the soonest after an acute myocardial infarction? Myoglobin CK-MB Cardiac troponin I Cardiac troponin T

Myoglobin

Which of the following represents the correct sequence for the rise and fall of myoglobin, CK-MB, and cTnI after an AMI? CK-MB, cTnI, myoglobin cTnI, CK-MB, myoglobin Myoglobin, CK-MB, cTnI CK-MB, myoglobin, cTnI

Myoglobin, CK-MB, cTnI

Board Review Question: In the assay of LDH the reaction is dependent on which of the following coenzyme systems? NAD/NADH Fe++/Fe+++ ATP/ADP Cu/Cu++

NAD/NADH

Board Review Question: In the assay of LDH, which of the following products is actually measured? NADH lactic acid pyruvic acid ATP

NADH

In the Hexokinase method for glucose determinations, the actual end product measured is the: Amount of hydrogen peroxide produced. NADPH + H+ produced from the reduction of NADP. Amount of glucose combined with bromcresol purple. Condensation of glucose with an aromatic amine.

NADPH + H+ produced from the reduction of NADP.

Nerve impulse conduction principally relies on which two electrolytes? Na and Mg Na and K K and Mg Na and Cl

Na and Mg

Aldosterone stimulates ADH secretion and thirst the heart to beat faster the kidneys to produce more urine Na reabsorption by the kidneys

Na reabsorption by the kidneys

Which of the following is false regarding alpha-fetoprotein? Specific tumor marker for ovarian cancer Near 100% sensitivity for liver cancer Negative in patients with liver and colon disease Minor protein found in fetal circulation

Near 100% sensitivity for liver cancer

Apoptosis is described as programmed cell death and is a normal process. How does this process compare to necrosis? Normal cells can also die of necrosis. Necrosis is another term for apoptosis. Once cells are dead by whatever mechanism the route of clearance from the body is identical. Necrosis is usually considered premature cell death.

Necrosis is usually considered premature cell death.

Which of the following feedback mechanisms regulate the production of 1, 25(OH) 2D 3? Negative feedback mechanism associated with circulating levels of calcium and inorganic phosphorus. Negative feedback mechanism associated with circulating levels of calcitonin. Negative feedback mechanism associated with circulating levels of magnesium. Positive feedback mechanism associated with circulating levels of calcium and inorganic phosphorus.

Negative feedback mechanism associated with circulating levels of calcium and inorganic phosphorus.

Which of the following is/are characterized by a normal white blood cell count? Hodgkin and non-Hodgkin lymphoma Hodgkin only Non-Hodgkin only Neither Hodgkin nor non-Hodgkin lymphoma

Neither Hodgkin nor non-Hodgkin lymphoma

What is the most common cause of unconjugated hyperbilirubinemia? Hemolytic anemia Gilbert's disease Bile duct obstruction Dubin-Johnson Neonatal physiologic jaundice

Neonatal physiologic jaundice

Which condition is associated with massive proteinuria and pitting edema? Acute glomerulonephritis Chronic glomerulonephritis Nephrotic syndrome Acute pyelonephritis

Nephrotic syndrome

Renal azotemia is found in: Advanced cirrhosis. High protein diets. Nephrotic syndrome. Dehydration.

Nephrotic syndrome.

In which of the following disorders would the maternal serum level of alpha 1-fetoprotein be elevated? Neural tube defect. Cardiac ischemia. Down syndrome. Small cell lung carcinoma.

Neural tube defect.

Pheochromocytoma is a benign or malignant tumor arising from which of the following? Bile caniculi Trophoblastic cells Neurochromaffin cells in the adrenal medulla Follicular cells of the thyroid

Neurochromaffin cells in the adrenal medulla

A gastrinoma is classified as which of the following? Pituitary adenoma Neuroendocrine tumor (NET) Hematoma Glomma

Neuroendocrine tumor (NET)

Large orange-red droplets seen on direct microscopic examination of stools mixed with Sudan III represent: Cholesterol. Fatty acids. Neutral fats. Soaps.

Neutral fats.

Board Review Question: Pellagra is associated with deficiency in which of the following vitamins? Niacin Vitamin A Vitamin B1 Thiamine

Niacin

Niacin is converted to which of the following two cofactors? Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) Vitamin B12 and ubiquinone Nicotinamide-adenine dinucleotide and nicotinamide-adenine dinucleotide phosphate Thiamine pyrophosphate and biotin

Nicotinamide-adenine dinucleotide and nicotinamide-adenine dinucleotide phosphate

An individual undergoes an ultrasound procedure. Which of the following is an expected cause of cell injury? Radiation Toxic substance Immune reaction None of these are correct.

None of these are correct.

The combination of squamous cell carcinoma antigen (SCCA) and CYFRA 21-1 test results can be used to provide reliable laboratory data for the differential diagnosis of which disease? Nonsquamous cell lung carcinoma Pancreatic cancer Liver cancer Pulmonary embolism

Nonsquamous cell lung carcinoma

The following glucose tolerance test values are indicative of what state? Fasting: 85 mg/dL½ hour: 135 mg/dL1 hour: 139 mg/dL2 hour: 130 mg/dL Normal Diabetes mellitus Addison's disease Hyperinsulinism

Normal

Which of the following is true regarding cells grown in culture media? Cancer cells form monolayers. Normal cells cannot proliferate unless they are anchored to each other or to some extracellular protein. Cancerous and noncancerous cells grow the same way in culture. None of these are correct.

Normal cells cannot proliferate unless they are anchored to each other or to some extracellular protein.

Which one of these is an example of adaptive immunity? Not getting chicken pox again after you have had it as a child sneezing in reaction to the flu virus stomach acid dissolving Strep bacteria running a fever after getting the flu

Not getting chicken pox again after you have had it as a child

Which tumor marker is associated with cancer of the urinary bladder? CA 125 CA19-9 CA 50 Nuclear matrix protein

Nuclear matrix protein

Zinc plays a vital role in the synthesis of which of the following? Glucose Low density lipoproteins Nucleic acid Carboxyhemoglobin

Nucleic acid

Uric acid values are usually elevated in patients with leukemia because of the breakdown of: Proteins. Nucleic acids (adenine and guanine). Amino acids. Epinephrine.

Nucleic acids (adenine and guanine).

Throughput is defined as: Numbers of tests performed per hour. Number of stat tests performed per hour. Number of specimen processed per 24 hours. Number of sample aspirations performed in 60 seconds.

Numbers of tests performed per hour.

Rickets and scurvy are examples of which form of cell injury? Nutritional Exposure to toxic substances Radiation Aging

Nutritional

Insufficient amounts of vitamin A can lead to degenerative changes to the cornea, which leads to poor dark adaptation, or night blindness, also known as: Myocarditis Dyslexia Photophobia Nyctalopia

Nyctalopia.

Which of the following is characteristic of type 2 diabetes mellitus? High insulin levels Ketosis Obesity and physical inactivity Juvenile onset

Obesity and physical inactivity

Which liver markers are considered obstructive and which are indicators of hepatocellular injury? Obstructive: ALT, AST; hepatocellular: Alk phos, bilirubin Obstructive: alk phos, bilirubin; hepatocellular: ALT, AST All are obstructive liver markers All are hepatocellular liver markers

Obstructive: alk phos, bilirubin; hepatocellular: ALT, AST

Which of the following assays is recommended as a screening test for colorectal cancer in persons over 50 years of age? Fecal typsin AFP BTA Occult blood test

Occult blood test

A substrate used in lipase reactions is: Starch. -nitrophenyl phosphate. Olive oil emulsion. Creatine phosphate.

Olive oil emulsion

Where are the coronary arteries found? Within the ventricles On the surface of the heart Attached to the valves Within the atria

On the surface of the heart

Which of the following fragments would be generated when the following sequence is cut by SmaI? 5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3' One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment Two 19 bp fragments One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment

One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment

Free thyroxine assays measure which of the following? Total thyroxine levels Only the bound thyroxine level Only the unbound thyroxine level The sum of the bound and unbound thyroxine

Only the unbound thyroxine level

____________ is characterized by the movement of water from an environment of low solute concentration to one that contains high solute concentration. Active transport Filtration Diffusion Osmosis

Osmosis

_____________ is most often due to excessive mechanical wear and tear. Rheumatoid arthritis Osteoarthritis Gout Ankylosing spondylitis

Osteoarthritis

Which of the following is the correct characterization of bone cells? Osteoclasts are responsible for bone formation. Osteocytes are responsible for bone resorption. Osteoblasts are responsible for bone resorption. Osteoblasts are responsible for bone formation.

Osteoblasts are responsible for bone formation.

Biomarkers of bone formation include which of the following? Hydroxproline Carboxyl-terminal cross-linked telopeptide of type I collagen Bone sialoprotein Osteocalcin

Osteocalcin

"A progressive systemic skeletal disease characterized by low bone mass and micro architectural deterioration of bone tissue, with a consequent increase in bone fragility and susceptible to fracture" describes which of the following diseases? Osteosarcoma Osteoporosis Renal osteodystrophy Paget's disease

Osteoporosis

Malate dehydrogenase (MD) is used in the aspartate transferase reaction mixture to convert: L-glutamate to alpha oxoglutarate. L-glutamate to L-aspartate. L-malate to L-glutamate. Oxaloacetate to L-malate.

Oxaloacetate to L-malate.

Creatinine is formed from the: Oxidation of creatine. Oxidation of protein. Deamination of dibasic amino acids. Metabolism of purines.

Oxidation of creatine.

Which constituent is not included in the Henderson-Hasselbalch equation? Carbon dioxide content pH Oxygen content Bicarbonate

Oxygen content

Which of the following effects result from exposure of a normal arterial blood sample to room air? PO2 decreased, PCO2 decreased, pH decreased PO2 increased, PCO2 decreased, pH increased PO2 decreased, PCO2 increased, pH decreased PO2 decreased, PCO2 decreased, pH increased

PO2 increased, PCO2 decreased, pH increased

____________ produces the highest alkaline phosphatase level in serum. Osteoporosis Paget disease Normal puberty Rickets

Paget disease

Coenzyme A (CoA) contains which of the following? Pantothenic acid Thiamin Riboflavin Vitamin D

Pantothenic acid

Which of the following cells of the stomach is incorrectly listed with its principal secreted product? Mucosal: mucus Parietal: nitric acid Chief: pepsinogen and chymosin Endocrine: gastrin

Parietal: nitric acid

_____________ is most commonly associated with tremors and uncontrollable shaking. Senile dementia Parkinson disease Alzheimer disease Guillain-Barre Syndrome

Parkinson disease

A patient's blood gas results are as follows: pH = 7.28; dissolved CO 2 = 1.9 mmol/L; HCO 3 - = 28 mmol/L. These results would be classified as: Metabolic acidosis. Metabolic alkalosis. Partially compensated respiratory acidosis. Respiratory alkalosis.

Partially compensated respiratory acidosis.

Which of the following represents an accepted protocol for making a diagnosis of acute myocardial infarction? Patient history, EKG (or ECG), serial sampling of blood samples for measurement of C- reactive protein, homocysteine, and B-type natriuretic hormone Patient history, EKG (or ECG), random sampling of blood samples for measurement of CKMB Serial sampling of blood or measurement of cTnI Patient history, EKG (or ECG), serial sampling of blood for measurement of cTnI

Patient history, EKG (or ECG), serial sampling of blood for measurement of cTnI

In reference to clinical laboratory tests, which of the following is not true regarding the change in terms from "normal range" to "reference range"? An individual can have a normal result and not be ill. The objective of the test is to compare results against a reference population, not necessarily a healthy population. Patients with related diseases can be included in the reference range. Patients with unrelated diseases can be included in the reference range.

Patients with related diseases can be included in the reference range.

A patient presents with the following symptoms: • Loss of appetite• Generalized weakness and irritability• Abdominal pain and vomiting• Bright red tongue (glossitis)• Skin rash ("Casal's necklace") Which of the following is associated with these symptoms? Scurvy Rickets Pellagra Dermatitis

Pellagra

The consumption of nonsteroidal anti-inflammatory drugs (NSAIDs) such as aspirin can lead to which of the following? Heart attack Peptic ulcer disease (PUD) Zollinger-Ellison Syndrome Helicobacter pylori disease

Peptic ulcer disease (PUD)

The chemical bonds between amino acids in the primary structure of proteins are: Hydrogen bonds. Disulfide bonds. Peptide bonds. Hydrophilic bonds.

Peptide bonds.

In the Berthelot method, BUN is measured by reaction with: Sodium hydroxide and arsenomolybdate. Dinitrophenylhydrazine. Phenol and sodium hypochlorite. Dinitrocarbazone.

Phenol and sodium hypochlorite.

Which of the following compounds is an anticonvulsant used to control tonic-clonic (grand mal) seizures? Digoxin Acetaminophen Lithium Phenytoin

Phenytoin

Why is clean glassware essential for measuring inorganic phosphorus? Phosphates are found in detergents. Phosphates leach from borosilicate glass. Detergents interfere with the enzyme reaction. Detergents are highly pigmented.

Phosphates are found in detergents.

Primary hypothyroidism may be due to all of the following EXCEPT: Pituitary adenoma. Surgical removal of the thyroid gland. Damage to the thyroid gland. Inherited disorder of the thyroid gland.

Pituitary adenoma.

Which of the following does NOT release steroid hormones? Ovaries Pituitary gland Testes Adrenal cortex

Pituitary gland

Which fluid fills the cavity surrounding the lungs? Pericardial Epicardial Pleural Peritoneal

Pleural

Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart in size. The optimal technique to use for the separation is: Agarose gel electrophoresis. Polyacrylamide gel electrophoresis. Pulse-field gel electrophoresis. Denaturing gel electrophoresis.

Polyacrylamide gel electrophoresis.

Which of the following porphyrias best reflects this patient's symptoms and laboratory results?A 30-year-old male presents to his clinician with alcoholic liver disease, hyperpigmentation, blister formation, and fragile skin. The results of the liver function tests (AST and ALT) were abnormal. The patient's urine PBG/ALA was not increased. Urine porphyrins analysis reveals and elevation of uroporphyrinogen and heptacarboxylate. ALA-dehydratase deficient porphyria Acute intermittent porphyria Erythropoietic protoporphyria Porphyria cutanea tarda

Porphyria cutanea tarda

Oxytocin and antidiuretic hormone (ADH) are hormones that are released by the: Hypothalamus. Anterior pituitary. Posterior pituitary. Left cardiac ventricle.

Posterior pituitary.

A high BUN/creatinine ratio with an elevated creatinine is usually seen in: Liver disease. Low protein intake. Tubular necrosis. Postrenal azotemia.

Postrenal azotemia.

The presence of only slightly visible hemolysis can significantly increase the serum level of which of the following ions? Sodium Potassium Chloride Bicarbonate

Potassium

The cation with the highest intracellular concentration is: Potassium. Sodium. Calcium. Magnesium.

Potassium.

Direct tube sampling by automated analyzers eliminates the need to perform which of the following tasks? Pour off specimens into another container Manual dilution of specimens Check for clots in specimens Check for proper sample volume

Pour off specimens into another container

Retinol is formed from which of the following vitamins? Vitamin C Vitamin K Preformed vitamin A Provitamin D

Preformed vitamin A

Which of the following devices is suitable to detect clots in serum specimens? Aggregometer Refractometer Luminometer Pressure transducer

Pressure transducer

What is the diagnosis of a patient with increased calcium, an increased parathyroid hormone level, and low phosphorus? Primary hyperparathyroidism Secondary hyperparathyroidism Vitamin D intoxication Hypoparathyroidism

Primary hyperparathyroidism

Serum thyroid stimulating hormone (TSH) levels are decreased in which of the following diseases or conditions? Primary hyperthyroidism Primary hypothyroidism Primary parathyroidism Hyperpituitarism

Primary hyperthyroidism

The structure of a protein that is determined by the sequence of amino acids in the polypeptide chain is the: Primary structure. Secondary structure. Tertiary structure. Quaternary structure.

Primary structure.

Board Review Question: Phenobarbital is a metabolite of Phenytoin Secobarbital Amobarbital Primidone

Primidone

What is the infectious agent that causes Creutzfeld-Jakob disease? Bacteria Virus Parasite Prion

Prion

Which of the following is an example of an antiarrhythmic drug that has a metabolite with the same pharmacological action? Procainamide Phenobarbital Quinidine Caffeine

Procainamide

What is the function of erythropoietin? Production of white cells Production of platelets Production of red cells Production of renal stones

Production of red cells

Which of the following compounds chelates iron and is the immediate precursor of heme formation? Protophorhyrin IX Porphrobilinogen Uroporphyrinogen Urobilinogen

Protophorhyrin IX

Three natural forms of vitamin B 6 are: Cholic acid, tauracholic acid, and glycocholic acid. Pyridoxine (pyridoxol) (PN), pyridoxamine (PM), and pyridoxal (PL). Caffeine, xanthene, and ubiquinone. Flavin adenine dinucleotide (FAD), flavin mononucleotide (FMN), and flavin.

Pyridoxine (pyridoxol) (PN), pyridoxamine (PM), and pyridoxal (PL).

Which of these reflects an appropriate selection of quality control material ? QC1 range= 50-70 mg/dL; QC2= 350-380 mg/dL; AMR= 20-600 mg/dL QC1 range= 50-70 mg/dL; QC2= 150-180 mg/dL; AMR= 20-600 mg/dL QC1 range= 150-180 mg/dL; QC2= 350-380 mg/dL; AMR= 20-600 mg/dL QC1 range= 150-190 mg/dL; QC2= 450-500 mg/dL; AMR= 20-600 mg/dL

QC1 range= 50-70 mg/dL; QC2= 350-380 mg/dL; AMR= 20-600 mg/dL

"Any specimen, by a command to the processing systems, can be analyzed by any available process, in or out of sequence with other specimens, and without regard to their initial order" describes which type of sample processing principle? Batch and discrete analysis Centrifugal analysis Continuous flow analysis Random access analysis

Random access analysis

What is the mechanism for injury when an incompatible unit of blood is transfused into a recipient? Type III hypersensitivity reaction Autoimmune reaction Red cell lysis following complement activation Mast cell release

Red cell lysis following complement activation

Why is glycosylated hemoglobin indicative of blood glucose over 2 to 4 months? Mean glucose levels do not change much over that period. Free hemoglobin has a 2- to 4-month life. Red cells have a 2- to 4-month life. White cells have a 2- to 4-month life.

Red cells have a 2- to 4-month life.

Which of the following is not a risk factor for myocardial infarction? Smoking Lack of exercise Red wine consumption Male gender

Red wine consumption

The first step in the enzymatic cholesterol reaction, which results in cholesterol esterase, is: Oxidation of cholesterol esters. Hydrolysis of cholesterol esters. Reduction of cholesterol. Reduction of cholesterol esterases.

Reduction of cholesterol.

Least squares, Deming's, and Passing and Bablok are examples of: Confidence intervals. Inferential tests. Quality control programs. Regression analysis.

Regression analysis.

______________ is the hallmark of irreversible cell death. Release of electrolytes Reduced production of ATP in the mitochondria Release of hormones Release of macromolecules such as proteins and enzymes

Release of macromolecules such as proteins and enzymes

Which of the following conditions will cause an increase anion gap? Renal failure Hypoaldosteronism Renal failure Hyperkalemia

Renal failure choose option C, not A

A technologist obtains a BUN value of 61 mg/dL and serum creatinine value of 3.5 mg/dL on a patient. The BUN/Creatinine ratio indicates: Renal failure. Liver failure. Gout. Prerenal failure.

Renal failure.

Hypokalemia may be seen in each of the following EXCEPT: Renal failure. Starvation. Alkalosis. Diarrhea.

Renal failure.

Which condition results in metabolic acidosis with severe hypokalemia and chronic alkaline urine? Drug-induced acidosis Renal tubular acidosis Diabetic ketoacidosis Acidosis caused by starvation

Renal tubular acidosis

Which of the following sequences accurately reflects the renin-angiotensin-aldosterone system in response to hyponatremia? Renin is released from the kidney; renin converts angiotensinogen to angiotensin I; angiotensin I is converted to angiotensin II. Angiotensinogen is released from the kidney; angiotensinogen converts to angiotensin I; angiotensin I is converted to renin. Angiotensin I is released from the kidney; angiotensin I converts angiotensinogen to angiotensin II; angiotensin II is converted to renin. Renin is released from the kidney; renin converts angiotensinogen to angiotensin II; angiotensin II is converted to angiotensin I.

Renin is released from the kidney; renin converts angiotensinogen to angiotensin I; angiotensin I is converted to angiotensin II.

What might be considered thirdhand smoke? Vapors from chewing tobacco Residual nicotine on household surfaces Similar to secondhand smoke but from pipes and cigars Dermal exposures

Residual nicotine on household surfaces

A patient's blood gas results are shown below: pH 7.30; pCO 2 = 60 mm Hg; HC0 3 - = 25 mmol/L. These results indicate: Respiratory acidosis. Metabolic alkalosis. Respiratory alkalosis. Metabolic acidosis.

Respiratory acidosis.

A woman watches a horror movie and is profoundly scared. Which of the following acid-base disorders might occur while watching? Metabolic acidosis Respiratory acidosis Metabolic alkalosis Respiratory alkalosis

Respiratory alkalosis

What is the most probable acid/base imbalance in the patient described below? 26-year-old male presents with the following signs and symptoms: Extreme hysteria Hyperventilating Pulse 105 BPM Lab data for ABGs: pH = 7.60 pCO 2 = 28 mmHg HCO 3 - =26 mmol/L pO 2 = 100 mmHg Respiratory acidosis Metabolic alkalosis Respiratory alkalosis Metabolic acidosis

Respiratory alkalosis

What is the most probable acid/base imbalance in the patient described below? 26-year-old male presents with the following signs and symptoms: Extreme hysteria Hyperventilating Pulse 105 BPM Lab data for ABGs: pH = 7.60 pCO 2 = 28 mmHg HCO 3 - =26 mmol/L pO 2 = 100 mmHg Respiratory acidosis Metabolic alkalosis Respiratory alkalosis Metabolic acidosis

Respiratory alkalosis

Ingestion of acetylsalicylic acid (aspirin) is associated with which of the following? Myocardial infarction Reyes syndrome Alcoholism Atherosclerosis

Reyes syndrome

Vitamin D deficiency leads to which of the following conditions? Scurvy Peritonitis Rickets Hives

Rickets

Which abdominal quadrant is the liver located in? Right Upper Right Lower Left Upper Left Lower

Right Upper

___________ does not produce a lactic acidosis. Sepsis Extensive skeletal muscle injury Salicylate poisoning Renal disease

Salicylate poisoning

What is the tissue localization of amylase isoenzymes? Saliva and pancreas Stomach and bile Liver and esophagus Gall bladder and spleen

Saliva and pancreas

Which diarrhea-producing microorganism is found in contaminated meat such as uncooked chicken? C. difficile Salmonella Staphlococcus aureus Norovirus

Salmonella

Recapping/storage/retrieval are all examples of tasks performed during which of the following? The analytical stage of testing Sample processing The postanalytical stage of testing Preventative maintenance

Sample processing

Antimony is used to treat patients with which disease? Diabetes Pneumonia Schistosomiasis Lupus erythematosus

Schistosomiasis

Which methods are used for drug screening and confirmation? Screen: immunoassay; confirmation: chromatography/mass spectrometry Screen: chromatography/mass spectrometry; confirmation: immunoassay Thin-layer chromatography for both Screen: GC/MS; confirmation: LC/MS/MS

Screen: immunoassay; confirmation: chromatography/mass spectrometry

What is the diagnosis of a patient who has low calcium and high parathyroid hormone level? Primary hypoparathyroidism Secondary hyperparathyoridism Sick euthyroid syndrome Milk alkali syndrome

Secondary hyperparathyoridism

The gold standard for evaluating pancreatic exocrine function is: Secretin/cholecystokinin. Pancreatic elastase. Fecal fat. Insulin.

Secretin/cholecystokinin.

Which of the following is not an important step in lipid digestion? Secretion of cholecystokinin to increase gastric motility Formation of micelles Secretion of pancreatic enzymes Secretion of bile salts through the duodenum

Secretion of cholecystokinin to increase gastric motility

Phenobarbital is classified as a: Cardiac glycoside. Anti arrhythmic. Analgesic, antipyretic, and anti-inflammatory. Sedative and hypnotic.

Sedative and hypnotic.

Which of the following laboratory test groups and results best reflects a patient with primary hemochromatosis? Serum iron, increased; serum TIBC, decreased; transferrin saturation, increased Serum iron, increased; serum TIBC, increased; transferrin saturation, increased Serum lead, increased; serum TIBC, increased; transferrin saturation, increased Serum iron, decreased; serum TIBC, decreased; transferrin saturation, decreased

Serum iron, increased; serum TIBC, decreased; transferrin saturation, increased

Which is true regarding the anion gap? A negative gap indicates a net negative charge for serum. A positive gap indicates a net negative charge for serum. A negative gap indicates a net positive charge for serum. Serum is electrically neutral.

Serum is electrically neutral.

Which of the following clinical laboratory tests is useful for diagnosis of peptic ulcer disease (PUD)? Basal acid output and IgM Serum measurement of IgM and age Serum measurement of IgA, IgG CagA, and cytotoxin-associated gene A (CagA) Alpha -1-antitrypsin

Serum measurement of IgA, IgG CagA, and cytotoxin-associated gene A (CagA)

A blood sample for a trough drug level should be drawn: During the distribution phase of the drug. Shortly before drug administration. 1 hour after drug administration. During phase I biotransformation.

Shortly before drug administration.

Which of the following trace elements is NOT classified as essential? Fluorine Silver Chromium Cobalt

Silver

Linearity is useful for assessing: Slope and bias of an analytical method. Slope and intercept of an analytical method. Intercept and p value of analytical method. A large correlation coefficient.

Slope and intercept of an analytical method.

Which of the following is false regarding polycystic ovary syndrome? Small ovaries Increased androgen levels Infertility Presence of cysts

Small ovaries

What the most common cause of emphysema? Deficiency in α1-antitrypsin Influenza infection Smoking Allergens

Smoking

Which of the following electrolyte levels best correlate with plasma osmolality? Chloride Sodium Calcium Bicarbonate

Sodium

A family of peptides called natriuretic peptides serves to regulate: Potassium levels. Sodium and water metabolism. Glucose metabolism. Chloride excretion.

Sodium and water metabolism.

Which of the following is observed in heart failure? Sodium and potassium both high Sodium and potassium both low Sodium high, potassium low Sodium low, potassium high

Sodium high, potassium low

The anion gap is determined from which of the following groups of electrolytes? Sodium, chloride, potassium, and calcium Sodium, chloride, potassium, and phosphorus Sodium, chloride, potassium, and HCO3- TCO2, chloride, potassium, and magnesium

Sodium, chloride, potassium, and HCO3-

The cation with the highest extracellular concentration is: Potassium. Sodium. Calcium. Magnesium.

Sodium.

A neoplasm that blocks the exocrine and endocrine functions of the pancreas is: Insulinoma. Somatostatinoma. Glucagonoma. Pancreatic cancer.

Somatostatinoma.

A test's "negativity in the absence of the disease" is termed its: Specificity Predictive value Accuracy Sensitivity Efficiency

Specificity

Which of the following is carried out during the preanalytical stage of laboratory testing? Calculating the final concentration of the analyte Detecting the analyte in solution Specimen processing Sending patient results to the caregiver

Specimen processing

Decreased serum levels of vitamin B 12 and folic acid are seen in patients with which of the following? Coronary artery disease Sprue Beriberi Wilson's Disease

Sprue

Which of the following carbohydrates is a polysaccharide? Starch Sucrose Lactose Glucose

Starch

____________ can produce excess ketoacids, resulting in a metabolic acidosis. Alcoholic ketosis Starvation and diabetic ketosis Ingestion of toxic alcohols Sepsis

Starvation and diabetic ketosis

Which of the following is not associated with blood in the stools? Inflammatory bowel disease Peptic ulcer disease Diverticulosis Steatorrhea

Steatorrhea

What precursor cell type gives rise to all other hematopoietic cells? Monoblast Stem cell Myeloid progenitor Lymphoid progenitor

Stem cell

Which of the following is the primary physiological role of secretin? Stimulate the intestine to move its contents to the large bowel Stimulate the pancreas to secrete an increased volume of juice with high bicarbonate contents Stimulate the release of gastrin from the antral mucosa Stimulate the gut to secrete all of its contents

Stimulate the pancreas to secrete an increased volume of juice with high bicarbonate contents

Angiotensin II is a potent vasoconstrictor that: Suppresses ADH secretion. Stimulates ADH secretion and thirst. Suppresses aldosterone secretion by the adrenal cortex. Reduces NaCl reabsorption by the proximal tubule.

Stimulates ADH secretion and thirst.

Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure used stated that 10 µg was optimal. The laboratory's result can be explained by all of the factors below EXCEPT: A low patient white blood cell count. Inadequate harvesting of the buffy coat from the sample. Storage of the whole blood sample at 22°C for 12 hrs prior to use. Contamination of the sample with protein.

Storage of the whole blood sample at 22°C for 12 hrs prior to use.

Monitoring intraoperative PTH is useful for: Surgical management of primary hyperparathyroidism. Surgical management of thyroid disease. Surgical management of prostate cancer. Surgical management of coronary heart disease.

Surgical management of primary hyperparathyroidism.

Which of the following is not a function of the liver? Detoxification of drugs and poisons Synthesis of serum proteins Carbohydrate metabolism Synthesis of hemoglobin

Synthesis of hemoglobin

Tetraiodothyronine describes which of the following compounds? T4 (thyroxine) T3 MIT Reverse T3

T4 (thyroxine)

Board Review Question: Which of the following methods employs a highly specific antibody to thyroxine? total T4 by competitive protein binding T4 by RIA T4 by column T4 by equilibrium dialysis

T4 by RIA

All of the following analytes are calibrated on a blood gas analyzer EXCEPT: TCO2. pCO2. pO2. pH.

TCO2

Which of the following drugs is used as an immunosuppressant in liver transplants? Thiocyanate Tacrolimus Cyclosporine Primidone

Tacrolimus

Board Review Question: A 9-month-old boy from Israel has gradually lost the ability to sit up and develops seizures. He has an increased amount of a phospholipid called GM2-ganglioside in his neurons, and he lacks the enzyme hexoaminidase A in his leukocytes. These findings suggest pheylketonuria Hurler's syndrome Tay-Sachs disease Niemann-Pick disease

Tay-Sachs disease

Two tests are available to diagnose a specific disease. One (test A) has high sensitivity while the other (test B) has high specificity. If both cannot be ordered at the same time, which is the best order? Test A and if positive, Test B Test A and if negative, Test B Test B and if positive, Test A Test B and if negative, Test A

Test A and if positive, Test B

Nuclear matrix protein-22 (NMP) is a tumor marker designed for what purpose? Test for recurrence of bladder cancer Test for recurrence of lung cancer Test for recurrence of bone cancer Test for recurrence of colorectal cancer

Test for recurrence of bladder cancer

Which of the following hormones is not matched with its category? Calcitonin: peptide FSH: glycoprotein Testosterone: amine hormone Leukotrienes: arachnidonic acid derivative

Testosterone: amine hormone

When referring to quality control results, what parameter usually determines the acceptable range? The range that includes 45% of the results The range encompassed by ±2.5 standard deviations The 95% confidence interval for the mean (or +/-2SD) The central 68% of results

The 95% confidence interval for the mean (or +/-2SD)

Board Review Question: Which of the following statements about immunoglobulins is true? immunoglobulins are produced by T-lymphocytes The IgA class is determined by the gamma heavy chains The IgA class exists as serum and secretory molecules There are 2 molecules of IgG

The IgA class exists as serum and secretory molecules

Bidirectional interface between the laboratory information system (LIS) and a chemistry analyzer provides which the following? The LIS can only upload information from an instrument The LIS cannot simultaneously transmit or download information to a laboratory instrument The LIS can simultaneously transmit data in one direction only The LIS can simultaneously transmit or download information to a laboratory instrument and the instrument can transmit data to the LIS

The LIS can simultaneously transmit or download information to a laboratory instrument and the instrument can transmit data to the LIS

An elevated ischemia modified albumin means that: The N-terminus of albumin is altered in the presence of cardiac ischemia and continues during ischemia, which means its blood concentrations rise quickly and remain elevated during an ischemic event. The C-terminus of albumin is altered in the presence of cardiac ischemia and continues during ischemia, which means its blood concentrations rise quickly and remains elevated during an ischemic event. The N-terminus of globulin protein is altered in the presence of cardiac ischemia and continues during ischemia, which means its blood concentrations rise quickly and remain elevated during an ischemic event. The N-terminus of albumin is altered in the presence of cardiac necrosis and continues during an infarction, which means its blood concentrations rise quickly and remains elevated during an acute myocardial infarction.

The N-terminus of albumin is altered in the presence of cardiac ischemia and continues during ischemia, which means its blood concentrations rise quickly and remain elevated during an ischemic event.

Why is the third generation assay needed for TSH in patients with Graves' disease? Low levels require highly sensitive assays. The alpha subunit of TSH is identical to FSH, LH, and hCG. Free TSH results can be obtained. These assays can be put on routine chemistry analyzers.

The alpha subunit of TSH is identical to FSH, LH, and hCG.

Real-time PCR differs from traditional PCR in that: Primers are not necessary. The amplicon is detected as the reaction progresses. The amplicon is detected on a special fluorescent gel. The reaction requires hybridization probes.

The amplicon is detected as the reaction progresses.

Which is false regarding the erythrocyte sedimentation rate? The analysis can be done manually. Low levels indicate the presence of inflammation or infection. The analysis is conducted in serum or plasma. The units of measure is millimeters fallen per hour.

The analysis is conducted in serum or plasma.

What is Proficiency Testing? The assessment of a lab's performance by an outside agency. The quality control of the lab's analyzers compared to other labs. The assessment of an individual lab tech's performance in the lab. The assessment of how fast the lab is getting results to the nurses.

The assessment of a lab's performance by an outside agency.

Urea/BUN is produced from: The catabolism of proteins and amino acids. Oxidation of purines. Oxidation of pyrimidines. The breakdown of complex carbohydrates.

The catabolism of proteins and amino acids.

What will happen to a fetus who is delivered on the day that the L/S value taken at 35 weeks produces a value of 1.8? The child might develop respiratory distress syndrome. The child will develop respiratory distress syndrome. The child will have mature lungs. None of these are correct.

The child might develop respiratory distress syndrome.

Board Review Question: AS part of a hyperlipidemia screening program, the following results were obtained on a 25-year-old woman 6 hours after eating: triglycerides 260 mg/dL cholesterol 120 mg/dL Which of the following is the BEST interpretation of those results? The cholesterol is normal but the triglycerides are elevated, which may be attributed to the recent meal Both results are elevated, indicating a metabolic problem in addition to the nonfasting state both results are normal and not affected by the recent meal Both results are below normal despite the recent meal, indicating a metabolic problem

The cholesterol is normal but the triglycerides are elevated, which may be attributed to the recent meal

Which of the following statements best defines the term accuracy? The closeness of the agreement between the measured value of an analyte to its true value Laboratory results that do not agree A test's ability to produce the same value for replicate measure of the same sample A test's ability to correlate to another method

The closeness of the agreement between the measured value of an analyte to its true value

If the pH of a sample decreases, what is the predicable response to the serum magnesium concentration? The concentration will increase 1 mmol/L for each whole unit of pH change The concentration will not be altered The concentration will decrease The concentration will increase

The concentration will increase

f the pH of a sample decreases, what is the predicable response to the serum magnesium concentration? The concentration will increase 1 mmol/L for each whole unit of pH change The concentration will not be altered The concentration will decrease The concentration will increase

The concentration will increase

Which of the following represents a disadvantage to acquiring and implementing total laboratory automation? Increases labeling errors Increases turnaround times Increases the need for additional full time equivalents (FTEs) The initial costs are very high

The initial costs are very high

Which of the following represents the compensatory response of the kidney and lungs to a patient who is in metabolic acidosis? The kidneys will increase bicarbonate reabsorption and the patient will begin to breathe very deeply and often gasp for air. The kidneys will decrease bicarbonate reabsorption and the patient will begin to hyperventilate. The kidneys will increase retention of hydrogen ions and the patient will begin to hold their breath for as long as possible. The kidneys will "shut down" in an attempt to retain all electrolytes and the patient will place a bag over their face to conserve oxygen and carbon dioxide.

The kidneys will increase bicarbonate reabsorption and the patient will begin to breathe very deeply and often gasp for air.

Proportional error in a method is characterized by which of the following? The magnitude of the error stays the same over a wide concentration range. The magnitude of the error increases as the concentration of analyte increases. The magnitude of the error decreases as the concentration of analyte increases. The magnitude of the error is inversely proportional to concentration.

The magnitude of the error increases as the concentration of analyte increases.

Which of the following is considered a significant problem with using biomarkers of bone turnover in the management of patients with osteoporosis in a clinical setting? They can be repeated over short time intervals thus providing quick results. They are noninvasive. They require no special patient preparation. The measurements are affected by several preanalytical variables both controllable and uncontrollable

The measurements are affected by several preanalytical variables both controllable and uncontrollable

3, 5, 3'-triodothyronine is characterized as which of the following? The least potent thyroid hormone The most potent thyroid hormone Secreted by the anterior pituitary gland in response to low blood levels of TSH Used to make both T3 and T4 hormones

The most potent thyroid hormone

Diffusion of gases in the body is defined as: The movement of charged protein carriers through the alveoli. The movement of charged, hydrophilic ions through a nonpolar lipid layer. The movement of an uncharged, hydrophobic solute through a lipid bilayer. The passive movement of bound ions through cell membranes that results in the active transport of gases.

The movement of an uncharged, hydrophobic solute through a lipid bilayer.

NT-pro-BNP is 76 amino acids in length and it is: A metabolite of BNP. The storage form of BNP. The natriuretic peptide that is the inactive form. The catabolic product of ANP.

The natriuretic peptide that is the inactive form.

What is the disadvantage of transcutaneous blood gas analysis? Only oxygen can be measured. Only carbon dioxide can be measured. The pH cannot be measured. It is falsely increased due to hemolysis.

The pH cannot be measured.

The cutoff point for fasting serum glucose in the lactose tolerance test is > 30 mg/dL (> 1.7 mmol/L). Which of the following is the correct interpretation for a patient whose fasting serum glucose is < 20 mg/dL (<1.1 mmol/L)? The patient has a gastric tumor The patient is lactose intolerant The patient has Crohn's diseases The patient is lactose tolerant

The patient is lactose intolerant

A blood specimen is received in the laboratory from a maternity patient in the obstetric unit with blood magnesium ordered by the attending physician. The serum magnesium levels is 5.90 mmol/L (RI = 3.0 - 5.0 mmol/L).). Which of the following explains the elevated serum magnesium? The patient has primary hyperparathyroidism The patient has had a massive heart attack The patient is on magnesium sulphate intravenous infusion because she is experiencing pre eclampsia The patient has Paget's disease

The patient is on magnesium sulphate intravenous infusion because she is experiencing pre eclampsia

An important test for diarrhea is fecal fat. How should the patient be prepared prior to collection of the 24-hour stools? There are no special procedures. The patient should fast for 24 hours. The patient should avoid fat. The patient should consume a high fat diet.

The patient should consume a high fat diet.

The internal standard of a chromatogram involves the addition of a known concentration of a drug absent in the sample and enables correction for variable extraction recovery. If the internal standard is half the expected concentration, which of the following is true? The peak heights of each drug found in the sample will be twice as high. The peak heights of each drug found in the sample will be half as high. An external calibration curve without the internal standard is required. The run must be repeated.

The peak heights of each drug found in the sample will be half as high.

Which of the following explains a mixed acid-base disorder where the pH is near normal? The presence of a respiratory acidosis and respiratory alkalosis The presence of a metabolic acidosis and metabolic alkalosis The presence of a respiratory acidosis and metabolic alkalosis The presence of a respiratory acidosis and metabolic acidosis

The presence of a respiratory acidosis and metabolic alkalosis

A liquid level sensor is designed to detect which of the following? The presence of a sample by measuring the electrical capacitance of the surrounding area The presence of a sample by measuring the electrical current of the surrounding area The presence of a sample by measuring the electrical resistance of the surrounding area The presence of a clot in the sample

The presence of a sample by measuring the electrical capacitance of the surrounding area

Predictive value is defined as which of the following? The probability that a laboratory test will be positive in the absence of disease The probability that a laboratory test will be negative in the absence of disease A measure of how often the assay system detects the biomarker when the disease is present The probability that a disease is present when the test is positive or that a disease is absent when a test is negative

The probability that a disease is present when the test is positive or that a disease is absent when a test is negative

Diagnostic specificity is defined as which of the following? The probability that a laboratory test will be positive in the absence of disease The probability that a laboratory test will be negative in the absence of disease A measure of how often the assay system detects the biomarker when the disease is present The probability that a disease is present when the test is positive or that a disease is absent when a test is negative

The probability that a laboratory test will be negative in the absence of disease

The production of alpha fetal protein (AFP) in a healthy individual is best reflected by which of the following statements? The production of AFP remains the same through life The production of AFP rises rapidly at birth but healthy adults and grade school children have negligible or undetectable levels in serum The production of AFP declines rapidly at birth and healthy adults and children have higher than normal levels in serum The production of AFP declines rapidly at birth and healthy adults and children have negligible or undetectable levels in serum

The production of AFP declines rapidly at birth and healthy adults and children have negligible or undetectable levels in serum

Which of the following describes a colligative property? It is based on chemical reactions. The property is agnostic to the identity of the solvent or solute. Osmolality is defined as the number of moles of solute dissolved in a liter of solvent. Osmolality can only be measured by freezing point depression.

The property is agnostic to the identity of the solvent or solute.

The indicator reaction (what is actually measured) in Oliver-Rosalki is: Adenylate kinase. Pyruvate kinase. Lactate dehydrogenase. The reduction of NADP+.

The reduction of NADP+.

Regarding biochemical nomenclature, which of the following is false? The prefix "pro-" often indicates a precursor form. The suffix "-inogen" is converted "-in." The suffix "ase" is converted to "ise." All of these are correct.

The suffix "ase" is converted to "ise."

Board Review Question: Which of the following applies to cryoscopic osmometry? The temperature at equilibrium is a function of the number of particles in solution The temperature plateau for a solution is horizontal The freezing point of a sample is absolute The initial freezing of a sample produces an immediate solid state.

The temperature at equilibrium is a function of the number of particles in solution

The chief source of error in kidney evaluation using the excretion rate of substance is: The chemical method of analysis. The timing and completeness of collection. The test chosen for the evaluation. The day-to-day variation of renal function.

The timing and completeness of collection.

The atherogenic effect of homocysteine is: The toxic effect on the left ventricular wall of the heart. The toxic effect of homocysteine on the adventitia or outer lining the arterial wall. The toxic effect of homocysteine on the endothelial lining of the arteries, which causes plaque formation. Nontoxic effect of homocysteine on the intima lining of the arteries.

The toxic effect of homocysteine on the endothelial lining of the arteries, which causes plaque formation.

The urinary system consists of 2 [a], 2 [b], a [c] and a [d]. kidneys urethra bladder ureters uterus prostate

The urinary system consists of 2 kidneys, 2 ureters, a bladder and a urethra.

Which molecular form(s) is/are measured by an intact B-hCG assay? hCG core and "nicked" hCG or hCGn The whole molecule Only "nicked" hCG or hCGn á-hCG and free â-hCG subunits

The whole molecule

Which of the following compounds relaxes the smooth muscles of the bronchial passages? Acetaminophen Lithium Phenytoin Theophylline

Theophylline

Which of the following is true regarding byproducts of metabolism? There is a net excretion of acids. There is a net excretion of bases. Blood pH is neutral. None of these are correct.

There is a net excretion of acids.

Which metal is involved in Wilson's disease? There is excess iron and iron storage proteins. There is excess copper that can be deposited into the liver and central nervous system. There is a deficiency in zinc leading to atrial fibrillation and skin lesions. There is excess calcium as seen in malignancies.

There is excess copper that can be deposited into the liver and central nervous system.

Which of the following is more characteristic of type 1 diabetes as opposed to type 2 diabetes? Adult onset is more frequent. There is higher potential for diabetic ketoacidosis. Insulin is required less often. There is a higher association with obesity.

There is higher potential for diabetic ketoacidosis.

In a patient with diabetes, why do the glucose levels remain high relative to a healthy individual? There is impaired tissue sensitivity to insulin. High glucose levels indicate the presence of exogenous insulin which should have been discontinued. There is a previous history of hypoglycemia. Diabetics are more sensitive to the type of glucose used in the test.

There is impaired tissue sensitivity to insulin.

Which of the following describes the hypothalamic hormones? They act as inhibitor of selected enzyme reactions They act indirectly on endocrine glands They act as releasing hormones on the pituitary They are all glycoproteins

They act as releasing hormones on the pituitary

Calcium, phosphorus, and magnesium all have which of the following in common? They all exist in circulation as only free or ionized forms. They all exist as free or ionized forms, bound to proteins and complexes to radicals to form salts. Calcium exist as bound and free only, phosphorus exits only as bound and complexes to radical to form salts and magnesium exists as free or ionized forms, bound to proteins and complexes to radicals to form salts. Calcium blood levels are regulated by parathyroid hormones, phosphorus is regulated by testosterone, and magnesium is regulated by insulin.

They all exist as free or ionized forms, bound to proteins and complexes to radicals to form salts.

Amylase and lipase are about the same molecular weight. What is the expectation regarding release from damaged pancreas? They appear at the same time. Amylase is released earlier. Lipase is released earlier. Appearance in blood is not a function of the size of the protein.

They appear at the same time.

Which of the following characterizes free radicals? They are so named because they are unbound to proteins. They are highly reactive and cause cellular injury. They are highly protective of healthy tissue. They are responsible for most causes of cancer.

They are highly reactive and cause cellular injury.

Which is true concerning serum total carbon dioxide measurements? They largely reflect dissolved CO2 gas. They are largely equivalent to bicarbonate levels. They are a measure of carbonic acid concentrations. They are equivalent to carboxyhemoglobin levels.

They are largely equivalent to bicarbonate levels.

Which direction does the partial pressure of carbon dioxide in arterial or venous blood go when a blood gas sample is exposed to air? They both go up. They both go down. Arterial goes up; venous goes down. Arterial goes down; venous goes up.

They both go down.

Which direction does pH in arterial or venous blood go when a blood gas sample is exposed to air? They both go up. They both go down. Arterial goes up; venous goes down. Arterial goes down; venous goes up.

They both go up.

Which direction does the partial pressure of oxygen in arterial or venous blood go when a blood gas sample is exposed to air? They both go up. They both go down. Arterial goes up; venous goes down. Arterial goes down; venous goes up.

They both go up.

What is the unique quality that many porphyrin compounds possess that allows for their detection within body tissues and in a test tube? They emit gamma radiation that can be detected using a radiation sensor They fluoresce and are detected by exposing them to EMR at a specific wavelength They absorb heat and can be detected using a thermal sensor. They emit an odor that is characteristic of the particular type of porphyrin

They fluoresce and are detected by exposing them to EMR at a specific wavelength

Screening methods for drug abuse testing requires which of the following assay characteristics? They must be very specific They must be analytically sensitive They must be free of interferences They must be very accurate

They must be analytically sensitive

How do physicians decide what tests to order? They decide based on the previous history of what has been ordered before. They rely on medical history, physical exam, and other objective tests. They can only order FDA-cleared tests. They can only order tests that are reimbursed by insurance companies.

They rely on medical history, physical exam, and other objective tests.

Board Review Question: Beriberi is associated with deficiency of Niacin Vitamin C Vitamin A Thiamine

Thiamine

Lipid-soluble drugs are excreted from the body Through the lungs Into the urine Through the skin Through the bile

Through the bile

Possible risks of hepatocellular damage due to toxic blood levels of acetaminophen are evaluated based on blood levels and which of the following? Urine levels Months postingestion Time (hours) post ingestion Degree of level of consciousness (LOC)

Time (hours) post ingestion

All of the following are considered reasons for monitoring drug levels EXCEPT: To prevent toxicity of drugs with a low therapeutic index. To determine whether a patient is complying with the physician's instructions. To adjust dose if individual differences or disease alter expected response. To detect the presence of potential interferences.

To detect the presence of potential interferences.

Which of the following lab tests does not require the patient to be fasting for accurate results? Total cholesterol Triglycerides Calculated HDL Chylomicrons

Total cholesterol

Enzymes that catalyze the transfer of groups other than hydrogen between compounds are classified as belonging to which enzyme class? Hydrolases Lyases Oxidoreductases Transferases

Transferases

Which of the following is the major transport protein of iron? Transferrin Ferritin Albumin Hemin

Transferrin

The principal protein for transport of iron from the intestine to the liver, bone marrow, or spleen for storage is: Haptoglobin. Transferrin. Ceruloplasmin. Alpha-fetoprotein.

Transferrin.

___________ is characterized by low total protein levels. Exudate Lymphedema Ascites Transudate

Transudate

Imiprimine is classified as: Tetracyclic aminoglycosides. Tricyclic antidepressant. An opioid. Antiepileptic.

Tricyclic antidepressant.

The Friedwald formula for estimating LDL cholesterol should NOT be used when: HDL cholesterol is greater than 40 mg/dL. Triglyceride is greater than 400 mg/dL. Plasma shows no visible evidence of lipemia. Total cholesterol is elevated based on the age and sex of the patient.

Triglyceride is greater than 400 mg/dL.

The serum of a freshly drawn blood sample is slightly turbid. This is probably because: Triglycerides only are increased. Cholesterol only is increased. Both are increased

Triglycerides only are increased.

The troponin complex consists of which of the following? Troponin A, troponin C, and troponin T Troponin I, troponin C, and troponin T Troponin M and troponin H Troponin MM, troponin MB, and troponin BB

Troponin I, troponin C, and troponin T

Which of the following is NOT an NPN substance? Urea Ammonia Creatinine Troponin T

Troponin T

What is the correct relationship regarding peak and trough drug levels? Peak: immediately after a dose Peak: just before the next dose Trough: baseline levels before the first dose Trough: just before the next dose

Trough: just before the next dose

If a third of your liver was removed, your liver would regenerate istelf. True False

True

Interstitial fluid is an extracellular fluid. True False

True

Poly-saccharides are made up of chains of simple sugars. Examples of these sugars are: glucose, galactose, and glucuronic acids True False

True

The liver produces cholesterol. True False

True

Which of the following must be determined to calculate diagnostic specificity? True-negatives and false-positives True-positives and false-positives True-positives and false-negatives True-negatives and false-negatives

True-negatives and false-positives

Which enzyme serves as the activator for the remaining pancreatic enzymes? Chymotrypsin Phospholipase-A2 Trypsin Elastase

Trypsin

The globin portion of hemoglobin in normal adult humans is composed of which two amino acid chains? Two alphas, two betas (a2, b2) Three betas, three deltas (b3, d3) Two deltas, two betas (d2, b2) Two sigmas, two gammas (ó2, g2)

Two alphas, two betas (a2, b2)

Which form of diabetes usually manifests itself early in life, and is associated with ketosis, low insulin levels, and autoantibodies to islet cells? Gestational Type 1 Type 2 Congenital

Type 1

Some patients with HIV who are treated with Abacavir develop a significant life-threatening rash and disease known as Stevens-Johnson syndrome that is mediated by T-lymphocytes. Which type of hypersensitivity reaction is this an example of? Type I Type II Type III Type IV

Type IV

Which type of hypersensitivity reaction is cell-mediated and is delayed in the rate of development? Type I Type II Type III Type IV

Type IV

Thyroid hormones are derived from which of the following amino acids? Phenylalanine Methionine Tyrosine Histidine

Tyrosine

Calculate the LDL cholesterol from the following information using the Friedewald equation: Total cholesterol: 200, HDL cholesterol 60, and triglycerides 800 -20 mg/dL 20 mg/dL Unable to calculate due to triglyceride lab error Unable to calculate because the Friedewald equation is inaccurate when the triglycerides are greater than 400

Unable to calculate because the Friedewald equation is inaccurate when the triglycerides are greater than 400

Which of the following is false regarding bilirubin metabolism? Conjugated bilirubin is converted to urobilinogen by bacterial action. The liver performs conjugation of indirect bilirubin. Unconjugated bilirubin is insoluble and must be bound to albumin for circulation. Following the death of a red cell, hemoglobin is first converted to biliverdin and then to bilirubin.

Unconjugated bilirubin is insoluble and must be bound to albumin for circulation.

The addition of sufficient Fe3+ to saturate iron binding site of transferrin is referred to as which of the following? Total iron binding saturation Unsaturated iron binding capacity Serum transferrin saturation Total iron index

Unsaturated iron binding capacity

Which enzyme is produced by H. pylori to produce peptic ulcers? Renin Urease Uricase Creatininase

Urease

Which of the following urine crystals have clinical significance? Uric acid Cholesterol Cysteine Calcium oxalate

Uric acid

An individual who consumes massive amounts of vitamin C may develop kidney stones consisting of: Glycolic acid. Uric acid. Oxalic acid. Linoleic acid.

Uric acid.

The enzyme system that catalyzes the conjugation of bilirubin is known as: Leucine aminopeptidase. Glucose-6-phosphate dehydrogenase. Uridine diphosphate (UDP) glucoronyl transferase. Carbamyl phosphate synthetase. Lactate dehydrogenase.

Uridine diphosphate (UDP) glucoronyl transferase.

Which of the following biological fluids is the specimen of choice for screening and/or analyzing drugs of abuse? Serum Whole blood Urine CSF

Urine

All of the following are confirmatory of diabetes mellitus EXCEPT: Fasting glucose greater than 126 mg/dL. Urine glucose greater than 300 mg/dL 2-hour postprandial glucose greater than 200 mg/dl. 1- and 2-hour glucose tolerance values greater than 200 mg/dL.

Urine glucose greater than 300 mg/dL

Which of the following is true regarding urine pH in renal tubular acidosis? Blood and urine pH are equivalent. Urine pH is inappropriately high for the acidosis observed. Urine pH is inappropriately low for the acidosis observed. Low urine pH causes tubular damage.

Urine pH is inappropriately high for the acidosis observed.

Which is the correct equation for calculating the renal clearance of a test? Urine/serum concentration × urine volume/24 h Serum/urine concentration × urine volume/24 h Serum/urine volume/24 × urine concentration Urine + serum concentration × urine volume/24 h

Urine/serum concentration × urine volume/24 h

A breakdown product of bilirubin metabolism that is produced in the colon from the oxidation of urobilinogen by microorganisms is: Porphobilinogen. Urobilin. Stercobilinogen. Protoporphyrin. Protoheme.

Urobilin.

Given the following information, what is the alternative in measuring the LDL cholesterol content? Total cholesterol: 200, HDL cholesterol 60, and triglycerides 800 It cannot be determined on this patient. Divide the triglycerides by two instead of five. Use a direct assay for LDL. Measure the triglyceride using a different method then recalculate.

Use a direct assay for LDL.

Depakene or Depakote are proprietary names for which of the following compounds? Phenobarbital Dilantin Valproic acid Carbamazepine

Valproic acid

What is the drug of choice to treat MRSA? gentamicin vancomycin tobramicin chloramphenicol

Vancomycin

Which of the following is bacterialcidal for Streptococci, Corynebacteria, Clostridia, Listeria, and Bacillus species? Tobramycin Cyclosporine Vancomycin Methotrexate

Vancomycin

Which of the following GI peptides relaxes smooth muscles of gut, blood, and genitourinary system; increases water and electrolyte secretion; and stimulates the release of hormones from pancreas, gut, and hypothalamus? Gastrin Cholecystokinin Vasoactive intestinal polypeptide Secretin

Vasoactive intestinal polypeptide

Which of the following is a result of chemical mediators for inflammation? Vasodilation and increased vascular permeability Vasodilation and decreased vascular permeability Vasoconstriction and increased vascular permeability Vasoconstriction and decreased vascular permeability

Vasodilation and increased vascular permeability

Prior to their release, where are neurotransmitters such as norepinephrine, epinephrine, and dopamine stored within a neuron? Synapse space Vesicles Cytoplasm Dendrites

Vesicles

Which laboratory test is used to determine the progress of an HIV infection? Western blot CD4 and CD8 counts ELISA Viral load

Viral load

Cobalt is found in which of the following vitamins? Vitamin E Vitamin A Vitamin B12 Vitamin D3

Vitamin B12

A deficiency in ___________ causes a macrocytic anemia. Vitamin B12/Folate Vitamin B1 Biotin Pantothenic Acid

Vitamin B12/Folate

Which vitamin is a component of two redox coenzymes? Folic Acid Vitamin A Vitamin C Vitamin B2

Vitamin B2

Pellagra is associated with a deficiency of which of the following vitamins? Vitamin B2 Vitamin B3 Vitamin B12 Vitamin D

Vitamin B3

Scurvy is a disease caused by a deficiency in which of the following? Vitamin K Vitamin B2 Vitamin C Vitamin A

Vitamin C

Which of the following is not a cause of hypophosphatemia? Primary hyperparathyroidism Starvation Vitamin D intoxication Vomiting and diarrhea

Vitamin D intoxication

Rickets in children or osteoporosis in adults can be minimized though dietary supplementation with which of the following? Vitamin D, calcium, and phosphorus Vitamin K Vitamin A High doses of ascorbic acid

Vitamin D, calcium, and phosphorus

Which of the following vitamins has the highest antioxidant properties? Vitamin K Vitamin E Vitamin D Vitamin B12

Vitamin E

A direct assay for measurement of plasma phylloquinone is useful to assess: Vitamin D status. Vitamin B12 status. Folate deficiency. Vitamin K status.

Vitamin K status.

_______________ is not associated with a decreased immunoglobulin concentration. DiGeorge syndrome Waldenström's macroglobulinemia Bruton agammaglobulinemia Ataxia telangiectasia

Waldenström's macroglobulinemia

Which of the following casts is most indicative of urinary stasis? Waxy Coarse granular Hyaline Red cell

Waxy

In addition to genetic mutation analysis, the laboratory investigation of lipid storage diseases involves measurement of metabolite levels in White Cells Cultured Fibroblasts Red Cells White Cells and Cultured Fibroblasts

White Cells and Cultured Fibroblasts

A closed reagent chemistry analyzer: Allows the operator to use reagents from other manufacturers. Will not allow the operator to use reagent from other manufacturers. Allows the operator to dispense reagents with their bottle caps in place. Allows the operator to purchase only a given amount of reagents for a year.

Will not allow the operator to use reagent from other manufacturers.

The following disease is a recessive disorder of copper metabolism, which results in the accumulation of copper in the liver. Hereditary hemochromatosis Wilson's disease á1-antitrypsin Gilbert's disease

Wilson's disease

Mass spectrometry is an analytically more sensitive measurement procedure for testosterone than immunoassays. For which population would this be more useful? Men Women Children Women and children

Women and children

Why are there different hemoglobin anemia cutoff concentrations for men and women? Women generally have higher hemoglobin concentration during health. Women can tolerate a lower hemoglobin than men. Men can tolerate a lower hemoglobin than women. Women naturally lose more hemoglobin due to menstruation.

Women naturally lose more hemoglobin due to menstruation.

A designated area where a limited number of specific tasks are completed describes which of the following terms? Work area Work station Work room Core laboratory

Work station

Select the FALSE statement The periosteum has a function in bone repair Your bone mass is set once you have reached adulthood Your bone mass varies with age and with use The red marrow inside the bones is the site of hematopoeisis

Your bone mass is set once you have reached adulthood

The osmolal gap is the difference between the measured and calculated osmolality. What is the gap given the following data: measured osmolality: 300 mOsm/kg, sodium 140, BUN 28, glucose 180? Zero 280 mOsm/kg 300 mOsm/kg 10 mOsm/kg

Zero

Lead exposure causes an increase blood concentration in which of the following analytes? Zinc-protoporphyrin Iron-protoporphyrin Lead-protoporphyrin Copper-protoporphyrin

Zinc-protoporphyrin

Which portion of the adrenals produces glucocorticoids? Adrenal cortex Zona glomerulosa Zona fasiculata Zona reticularis

Zona glomerulosa

Board Review Question: The creatinine clearance (mL/min) is equal to [urinary creatinine in mg/L x volume of urine in mL/hour] / plasma creatinine in mg/L urinary creatinine in mg/L / [volume of urine in mL/hour x plasma creatinine in mg/L] urinary creatinine in mg/L/[volume of urine in mL/min x plasma creatinine in mg/L] [urinary creatinine in mg/L x volume of urine in mL/min] / plasma creatinine in mg/L

[urinary creatinine in mg/L x volume of urine in mL/min] / plasma creatinine in mg/L

Tubular reabsorption, using a passive transport of molecules, requires: ATP a carrier molecule a concentration gradient ATP and a carrier molecule a carrier molecule and a concentration gradient

a concentration gradient

Oligoclonal bands in the CSF are indicative of multiple myeloma. a disease associated with the demyelation of the myelin sheath. multiple sclerosis only. Waldenström's macroglobulinemia.

a disease associated with the demyelation of the myelin sheath.

Board Review Question: The preparation of a patient for the standard glucose tolerance testing should include a low carbohydrate diet for 3 days fasting for 48 hours prior to testing bed rest for 3 days a high carbohydrate diet for 3 days

a high carbohydrate diet for 3 days

The amount of a chemical capable of killing one half of the members of a tested population is called: a lethal dose a toxic dose a median lethal dose a poison

a median lethal dose

Board Review Question: During an evaluation of adrenal function, a patient had plasma cortisol determinations in the morning after awakening and in the evening. Laboratory results indicated that the morning value was higher than the evening concentration. This is indicative of: hypopituitarism a normal finding Cushing's syndrome Addison's disease

a normal finding

Board Review Question: For the past 3 weeks serum estriol levels in a pregnant woman have been steadily increasing. This is consistent with a normal pregnancy hemolytic disease of the newborn fetal death congenital cytomegalovirus infection

a normal pregnancy

The definition of microalbuminuria is a below-normal level of urine albumin. a slightly above-normal level of urine albumin. a degradation product of albumin. a slightly above-normal level of serum albumin.

a slightly above-normal level of urine albumin.

Board Review Question: The most consistent analytical error involved in the routine determination of HDL cholesterol is caused by incomplete precipitation of the LDL cholesterol inaccurate protein estimation of HDL cholesterol a small concentration of APO-B containing lipoprotein after precipitation coprecipitation of HDL and LDL cholesterol

a small concentration of APO-B containing lipoprotein after precipitation

Board Review Question: A one molal solution is equivalent to: a solute containing one mole of solute per kg of solvent 1000 mL of solution containing one mole of solute a solution containing one gram-equivalent weight of solute in one liter of solution a 1-L solution containing 2 moles of solute

a solute containing one mole of solute per kg of solvent

How long after fertilization, does the blastocyst implant in the uterus? right away 1-3 days 4-6 days a week (7 days) 2 weeks

a week (7 days)

Plasma calcium is about half ionized calcium and half bound to albumin about a third complexed to anions and two-thirds bound to albumin all as free calcium all bound to albumin

about half ionized calcium and half bound to albumin

If a patient has an inflammatory bowel disorder, which stage of drug metabolism will be affected? absorption distribution biotransformation excretion

absorption

Atherosclerosis means hardening of the arteries inflammation of the arteries accumulation of lipids in vascualr lesions all of the above

accumulation of lipids in vascualr lesions

Board Review Question: The extent to which measurements agree with the true value of the quantity being measured is known as precision accuracy reproducibility reliability

accuracy

The neurotransmitter that is released by the synaptic vesicles of the motor neurons and that induces muscle contraction is acetylcholine adrenaline dopamine somatostatin

acetylcholine

Myasthenia gravis is caused by antibodies that bind to the neurotransmitters, e.g., acetylcholine. acetylcholine presynaptic receptor. acetylcholine postsynaptic receptor. both the pre- and postsynaptic junctions.

acetylcholine postsynaptic receptor.

Board Review Question: Which of the following chemical determinations may be of help in establishing the presence of seminal fluid? acid phosphatase alkaline phosphatase LDH isocitrate dehydrogenase

acid phosphatase

Board Review Question: Which of the following chemical determinations may be of help in establishing the presence of seminal fluid? alkaline phosphatase acid phosphatase isocitrate dehydrogenase LDH

acid phosphatase

Board Review Question: Which of the following chemical determinations may be of help in establishing the presence of seminal fluid? lactic dehydrogenase alkaline phosphatase acid phosphatase isocitrate dehydrogenase

acid phosphatase

Board Review Question: Which of the following chemical determinations may be of help in establishing the presence of seminal fluid? LDH acid phosphatase alkaline phosphatase isocitrate dehydrogenase

acid phosphatase

Board Review Question: Serum from a patient with metastatic carcinoma of the prostate was separated from the clot and stored at room temperature. The following results were obtained: calcium 10.8 mg/dL(ref range: 8.8 -10.3 mg/dL) LD 420 U/L (ref range: 50-150 U/L) Acid phosphatase 0.1 U/L (ref range 0-5.3 U/L) The technician should repeat the acid phosphatase with freshly drawn serum LD with fresh serum tests using plasma LD using diluted serum

acid phosphatase with freshly drawn serum

Board Review Question: In electrophoretic analysis, buffers stabilize electrolytes maintain basic/alkaline pH act as a carrier for ions produce an effect on protein configuration

act as a carrier for ions

Board Review Question: Given the following results: ALP: slight increase ALT: marked increase AST: marked increase GGT: slight increase This is most consistent with : chronic hepatitis obstructive jaundice acute hepatitis liver hemangioma

acute hepatitis

Board Review Question: Given the following results: ALP: slight increase ALT: marked increase AST: marked increase GGT: slight increase This is most consistent with : acute hepatitis liver hemangioma chronic hepatitis obstructive jaundice

acute hepatitis

Board Review Question: The greatest activities of serum AST and ALT are seen in acute hepatitis metastatic hepatic carcinoma alcoholic cirrhosis primary biliary cirrhosis

acute hepatitis

Board Review Question: The greatest activities of serum AST and ALT are seen in metastatic hepatic carcinoma alcoholic cirrhosis primary biliary cirrhosis acute hepatitis

acute hepatitis

Board Review Question: A urine screening test for porphobilinogen is positive. The MOST likely disease state is erythrocytic protoporphyria lead poisoning porphyria cutanea tarda acute porphyria attack

acute porphyria attack

A patient is exposed to a foreign chemical antigen resulting in the production of an antibody. This is an example of innate immunity. adaptive immunity that is humoral-mediated. adaptive immunity that is cell-mediated. All of these are correct.

adaptive immunity that is humoral-mediated.

Board Review Question: A serum sample for acid phosphatase determination is best prepared for room temperature storage by adding an acid stabilizer adding NaF alkalinizing the serum centrifuging for 30 minutes

adding an acid stabilizer

Which gland secretes aldosterone? kidneys pituitary adrenals pancreas

adrenals

The arteriole entering the glomerulus is the ______________ arteriole, the one leaving the glomerulus is the _______________ arteriole.

afferent, efferent

Steady state is achieved for a drug after 4 to 6 times the drug's half-life immediately after a bolus dose just before the next dose after 1 week

after 4 to 6 times the drug's half-life

Board Review Question: Bromcresol purple at a pH of 5.2 is used in a colorimetric method to measure globulin albumin Bence-Jones protein immunoprotein

albumin

Which of these proteins is important in colloidal osmotic pressure and water balance? albumin alpha 1 antitrypsin gamma globulins tansthyretin

albumin

Board Review Question: Which of the following is a glycolytic enzyme that catalyzes the cleavage of fructose-1, 6=diphosphate to glyceraldehyde-3-phosphate and dihydroacetone phosphate? aldolase phosphofructokinase glucose-6-phosphate dehydrogenase pyruvate kinase

aldolase

Board Review Question: In the Jaffe reaction, creatinine reacts with potassium iodide to form a reddish-purple complex alkaline sulfasalazine solution to produce an orange-yellow complex alkaline picrate solution to yield an orange-red solution sodium nitroferricyanide to yield a reddish-brown color

alkaline picrate solution to yield an orange-red solution

Select the characteristics that are the hallmark of metabolic syndrome hypertension low HDL, high triglycerides high waist circumference fasting hyperglycemia atherosclerosis male gender

all

What is inflammation ? It is the body's response to injury It is designed to rid the body of the offending agent It is designed to repair injury from the offending agent all 3 statements are correct

all 3 statements are correct

A buffer solution contains a weak acid contains a conjugate base resists changes in pH all of the above

all of the above

Cholesterol can be used for: bile acid precursor cell membrane component steroid hormone precursor all of the above

all of the above

Eicosanoids made from arachidonic acid increase inflammation raise blood pressure induce labor activate platelet aggregation all of the above

all of the above

In the body calcium is found: in hydroxyapatite in skeletal muscles in plasma all of the above

all of the above

In which of these conditions would you expect to see an increase in amylase and lipase? acute pancreatitis intestinal obstruction cholecystitis all of the above

all of the above

Sphincter muscles compartmentalize the GI system allow the bolus to enter and leave sections of the GI tract are under voluntary and involuntary control all of the above

all of the above

The major renal function(s) is (are) glomerular filtration tubular reabsoption tubular secretion all of the above

all of the above

The most crucial role of the kidneys is: acid-base balance homeostasis of body water hormonal regulation removal of waste all of the above

all of the above

What is the function of lipids? energy storage hormone precursors structural components all of the above

all of the above

What is/are the function(s) of the liver? excretion detoxification metabolism storage all of the above

all of the above

Which of these conditions can cause hypoalbuminemia? liver disease nephrotic syndrome viral gastroenteritis all of the above

all of the above

Which of these are routes of exposure to toxins? absorption through the skin absorption through the GI tract (ingestion) inhalation through the lungs injection into a vein all of these

all of these

Which of these is a toxic alcohol ? methanol (wood alcohol) isopropanol (desinfectant) ethanol (wine, beer, liquor) all of these are

all of these are

Board Review Question: The following results from a 21-year old patient with a back injury who appears otherwise healthy: Whole blood glucose = 77 mg/dL serum glucose = 88 mg/dL CSF glucose = 56 mg/dL The best interpretation of these results is that the whole blood and serum values are expected but the CSF value is elevated the serum and whole blood values should be identical the whole blood glucose value should be higher than the serum value all values are consistent with a normal healthy individual

all values are consistent with a normal healthy individual

Board Review Question: Which of the following terms describes a graft between genetically unidentical individuals belonging to the same species? autograft isograft xenograft allograft

allograft

Which reaction is characteristic of a solid organ (like a kidney) transplant rejection? allergy anaphylaxis alloimmunity autoimmunity

alloimmunity

Board Review Question: In bilirubin determination, the purpose of adding a concentrated caffeine solution or methyl alcohol is to precipitate protein allow indirect bilirubin to react with the color reagent dissolve conjugated bilirubin prevent any change in pH

allow indirect bilirubin to react with the color reagent

Which of these proteins neutralizes leukocyte elastase and collagenase? albumin alpha 1 antitrypsin gamma globulins tansthyretin

alpha 1 antitrypsin

Which of these proteins is associated with Down's syndrome, Trisomy 18 and neural tube defects? alpha 1 antitrypsin alpha fetoprotein alpa 1 acid glycoprotein albumin

alpha fetoprotein

Board Review Question: Which of the following serum protein fractions is most likely to be elevated in patients with nephrotic syndrome? alpha-1 globulin and alpha-2 globulin beta globulin and gamma globulin alpha-1 globulin alpha-2 globulin and beta globulin

alpha-2 globulin and beta globulin

Cellular injury in an organ causes no issues to the health of the individual only localized injury to the individual alterations of body functions and chemistry death of the individual

alterations of body functions and chemistry

Which of these metals is toxic? aluminum chromium 3+ copper zinc

aluminum

This type of hormone is derived from amino acids, is small, is water soluble and needs to bind on a cell membrane receptors on the target cell. amines peptides steroids all of the above

amines

Board Review Question: A physician suspects hos patient has pancreatitis. Which test(s) would be the most indicative of this disease? B-hydroxybutyrate creatinine amylase LD-isoenzymes

amylase

Board Review Question: A physician suspects hos patient has pancreatitis. Which test(s) would be the most indicative of this disease? creatinine B-hydroxybutyrate LD-isoenzymes amylase

amylase

Board Review Question: Which of the following enzymes catalyzes the conversion of starch to glucose and maltose? malate dehydrogenase creatine kinase isocitric dehydrogenase amylase

amylase

Board Review Question: Which of the following are used in the diagnosis of acute pancreatitis? 5' nucleotidase and GGT amylase and lipase AST and ALT AST and LDH

amylase and lipase

Board Review Question: Following repeat exposure to an antigen, rapid antibody production to an elevated level that persists for a long period of time is called: an anamnestic response an Arthus reaction a primary response hypersensitivity

an anamnestic response

A pregnant woman who shows an hCG doubling every week instead of 2 to 3 days during the first trimester might have gestational diabetes. an ectopic pregnancy. preeclampsia. an aborted fetus.

an ectopic pregnancy.

Board Review Question: In the sweat test, the sweating stimulant is introduced to the skin by application of filter paper moistened with pilocarpine nitrate copper electrodes an electric current filter paper moistened in deionized water

an electric current

Board Review Question: The presence of C-reactive protein in the blood is an indication of a state of hypersensitivity recovery from a pneumococcal infection an inflammatory process a recent streptococcal infection

an inflammatory process

Board Review Question: Cerebrospinal fluid assay for glucose should be refrigerated analyzed immediately heated to 56C stored at room temperature after cenrrifugation

analyzed immediately

Board Review Question: Immediate hypersensitivity is most commonly associated with transfusion reaction contact dermatitis bacterial septicemia anaphylactic reaction

anaphylactic reaction

Which one of these sets of hormones are produced by the adrenal glands? androgens, catecholamines and steroids ADH and oxytocin estrogens, progesterone and testosterone thyroxine and triiodothyronine

androgens, catecholamines and steroids

The classical complement system is activated by antibody-antigen complexes the presence of antibodies bacterial carbohydrates gram-negative and fungal cell wall components

antibody-antigen complexes

Board Review Question: The protein portion of an enzyme complex is called apoenzyme coenzyme holoenzyme proenzyme

apoenzyme

Interstitial fluid is the fluid around the cells within the cells in the plasma in the kidneys

around the cells

Which of these statement is true? arteries carry oxygenated blood arteries carry blood away from the heart veins carry deoxygenated blood all statements are true

arteries carry blood away from the heart

Board Review Question: A characteristic of the Bence-Jones protein that is used to distinguish it from other urinary proteins is its solubility at 40 - 60 degrees Celsius in sulfuric acid at 100 degrees Celsius in ammonium sulfate

at 100 degrees Celsius

Board Review Question: Total glycosylated hemoglobin levels in a hemolysate reflect the average blood glucose for the past 2-3 months hemoglobin A1C level at the time the sample is drawn average blood glucose levels for the past week blood glucose level at the time the sample is drawn

average blood glucose for the past 2-3 months

Board Review Question: In the total bilirubin assay, bilirubin reacts with diazotized sulfanilic acid to form biliverdin azobilirubin diazo bilirubin bilirubin glucoronide

azobilirubin

In the Jendrassik-Grof method for the determination of serum bilirubin concentration, quantitation is obtained by measuring the color of urobilinogen bilirubin glucuronide urobilin azobilirubin

azobilirubin

A suitable method to use for quantitation of HIV in patient blood is: bDNA. DNA sequencing. SDA. Southern blot.

bDNA

Board Review Question: Tricyclic antidepressants are classified as basic drugs neutral drugs structurally cycloparaffinic acidic drugs

basic drugs

An acidic solution would have a pH between 0 and 7 between 6 and 8 between 7 and 14 between 8 and 20

between 0 and 7

Board Review Question: Acidosis and alkalosis are best defined as fluctuations in blood pH and CO2 content due to changes in carbonic anhydrase O2 content Bohr's effect bicarbonate buffer

bicarbonate buffer

Which buffer system is the most important and accounts for the majority of the total buffering capacity in the extracellular space? bicarbonate buffer system hemoglobin buffer system protein buffer system phosphate buffer system

bicarbonate buffer system

Board Review Question: Most of the carbon dioxide present in the blood is in the form of dissolved CO2 carbonic acid carbonate bicarbonate ion

bicarbonate ion

Board Review Question: In which of the following disease states is a conjugated bilirubin a major serum component? hemolysis neonatal jaundice erythroblastosis fetalis biliary obstruction

biliary obstruction

Board Review Question: A breakdown product of hemoglobin is Bence-Jones protein lipoprotein hematoxylin bilirubin

bilirubin

In a patient with subarachnoid hemorrhage, testing for _________ can differentiate between a traumatic bleed and blood from a subarachnoid hemorrhage that has had time to metabolize. oxyhemoglobin reduced hemoglobin bilirubin urobilinogen

bilirubin

Board Review Question: In the liver, bilirubin is converted to urobilin bilirubin diglucuronide bilirubin-albumin complex urobilinogen

bilirubin diglucuronide

Board Review Question: The T3 resin uptake test is a measure of binding capacity of thyroxine-binding globulin bound T3 total thyroxine-binding globulin circulating T3

binding capacity of thyroxine-binding globulin

Transformation of potentially harmful chemicals into inactive metabolites is called ______________ biotransformation drug inhibition first-order kinetics zero-order kinetics

biotransformation

If a patient has cirrhosis of the liver, which stage of drug metabolism will be affected? absorption and biotransformation distribution and excretion biotransformation and excretion absorption and excretion

biotransformation and excretion

Board Review Question: Most chemical methods for determining total protein utilize which of the following reactions? molybdenum blue ferri-ferrocyanide biuret resorcinol-HCl

biuret

Board Review Question: Antihistamines block histamine receptors stimulate IgE antibody production bind histamine stimulate IgG blocking antibodies

block histamine receptors

Board Review Question: The most heat-labile fraction of alkaline phosphatase is obtained from liver intestine bone placenta

bone

Kidneys maintain homeostasis by ____________ eliminating non essential components from the body retaining essential components for use in the body both eliminating non essential components and retaining essential components making urine

both eliminating non essential components and retaining essential components

Which of these molecules dilates blood vessels and induces pain? bradykinins complement C3 lectins histamine

bradykinins

Board Review Question: Kernicterus is an abnormal accumulation of bilirubin in heart tissue brain tissue liver tissue kidney tissue

brain tissue

Board Review Question: Estrogen and progesterone receptor assay are useful in assessing prognosis in which of the following? ovarian cancer breast cancer endometriosis amenorrhea

breast cancer

How does CO2 and O2 enter and leave the cells or the alveoli and enter the blood stream? by active transport by passive tranport by simple diffusion by facilitated diffuson

by simple diffusion

Board Review Question: A hospitalized patient is experiencing increased neuromuscular irritability (tetany). Which of the following tests should be ordered immediately? glucose calcium BUN phosphorus

calcium

Board Review Question: A reciprocal relationship exists between sodium and potassium calcium and phosphorus calcium and magnesium chloride and CO2

calcium and phosphorus

Board Review Question: Blood PCO2 may be measured by measurement of CO2-saturated hemoglobin measurement of CO2 consumed at the cathode direct colorimetric measurement of dissolved CO2 calculation of blood pH and total Co2 concentration

calculation of blood pH and total Co2 concentration

Board Review Question: Serum haptoglobin is increased in patients with prosthetic heart valves binds heme can be separated into two distinct phenotypes by starch gel electrophoresis is decreased in patients with tissue injury and neoplasm

can be separated into two distinct phenotypes by starch gel electrophoresis

Board Review Question: Antibodies composed of IgG immunoglobulins can be detected in saline crossmatches are larger molecules than IgM antibodies can cross the placenta from mother to fetus Occur during the primary response to antigens

can cross the placenta from mother to fetus

Board Review Question: An increase in serum acetone is indicative of a defect in the metabolism of urea nitrogen uric acid carbohydrates fat

carbohydrates

What is the name of the enzyme that converts CO2 to carbonic acid (H2CO3)? (short answer)

carbonic anhydrase

A glucose result is falsely elevated and it was discovered that the previous sample on the sample carousel has abnormally high serum glucose. Which of the following can cause this error? Pipetting an extra volume of diluents into the sample with the falsely elevated glucose Carryover A leak in the reagent-dispensing probe Double pipetting of the sample with the elevated glucose result

carryover

Match these fatty acids with their description: ? saturated fatty acids ? monounsaturated fatty acids ? polyunsaturated fatty acids a. alkyl chains with more then one double bond b. alkyl chains with one double bond c. alkyl chains with no double bonds

cba

Adherence to a gluten-free diet is useful for gastrinoma. celiac disease. diverticulosis. chronic pancreatitis.

celiac disease.

Board Review Question: 90% of the copper present in plasma is bound to transferrin ceruloplasmin albumin immunoglobulin

ceruloplasmin

Board Review Question: A potassium level of 6.8 mEq/L is obtained. Before reporting the results, the first step the technologist should take is do nothing, simply report the results check the age of the patient check the serum for hemolysis rerun the test

check the serum for hemolysis

An individual develops a myocardial infarction due to cocaine abuse. This is an example of _________ cell injury. chemical genetic nutritional immune

chemical

Board Review Question: The buffering capacity of blood is maintained by a reversible exchange process between bicarbonate and calcium sodium chloride potassium

chloride

Board Review Question: The parent substance in the synthesis of androgens and estrogens is cortisol catecholamines progesterone cholesterol

cholesterol

Select the 4 major lipids: cholesterol bile acids glycolipids phospholipids vitamin D triglycerides vitamin A

cholesterol, glycolipids, phospholipids, triglycerides

Which trace mineral enhances the action of insulin? chromium Manganese Selenium Zinc

chromium

Board Review Question: Given the following results: ALP: slight increase ALT: slight increase AST: slight increase GGT: slight increase This is most consistent with : liver hemangioma acute hepatitis obstructive jaundice chronic hepatitis

chronic hepatitis

Board Review Question: Given the following results: ALP: slight increase ALT: slight increase AST: slight increase GGT: slight increase This is most consistent with : obstructive jaundice chronic hepatitis liver hemangioma acute hepatitis

chronic hepatitis

Board Review Question: Turbidity in serum suggests an elevation of: cholesterol chylomicrons albumin total proteins

chylomicrons

Board Review Question: A fasting serum sample from an asymptomatic 43-year-old woman is examined visually and chemically with the following results: initial appearance: milky appearance of serum after overnight refrigeration: cream layer over turbid serum triglyceride level: 2000 mg/dL cholesterol level: 550 mg/dL The sample contains predominantly: chylomicrons and VLDL chylomicrons alone VLDL and LDL HDL

chylomicrons and VLDL

Where is the normal gut biota located? stomach liver small intestine colon

colon

Board Review Question: Which of the following is decreased in serum during the active stages of systemic lupus erythematosus? antinuclear antibody complement C3 immune complexes anti-DNA

complement C3

Board Review Question: Delayed hypersensitivity is related to bacterial septicemia contact sensitivity to inorganic chemicals transfusion reaction anaphylactic reaction

contact sensitivity to inorganic chemicals

Blockage of the _____________ causes an acute myocardial infarction. pulmonary artery aorta coronary arteries superior vena cava

coronary arteries

Which of these arteries supply blood and oxygen to the heart muscle so that it can pump? aorta coronary arteries pulmonary arteries subclavian arteries

coronary arteries

The kidneys are divided into 2 areas: the outer ___________ and the inner ____________ . cortex, medulla cortex, nephron nephron, medulla medulla, cortex

cortex, medulla

Board Review Question: Which of the following steroids is an adrenal cortical hormone? progesterone pregnanetriol angiotensinogen corticosterone

corticosterone

Board Review Question: The enzyme that exists chiefly in skeletal muscles, heart and brain, is grossly elevated in active muscular dystrophy and rises early in myocardial infarction is: creatine kinase lipase transaminase lactate dehydrogenase

creatine kinase

Board Review Question: The enzyme that exists chiefly in skeletal muscles, heart and brain, is grossly elevated in active muscular dystrophy and rises early in myocardial infarction is: creatine kinase transaminase lactate dehydrogenase lipase

creatine kinase

Board Review Question: The enzyme that exists chiefly in skeletal muscles, heart and brain, is grossly elevated in active muscular dystrophy and rises early in myocardial infarction is: transaminase lactate dehydrogenase lipase creatine kinase

creatine kinase

Board Review Question: The enzyme that exists chiefly in skeletal muscles, heart and brain, is grossly elevated in active muscular dystrophy and rises early in myocardial infarction is: transaminase lipase lactate dehydrogenase creatine kinase

creatine kinase

The Jaffe reaction is used to assess creatinine blood urea nitrogen uric acid ammonia

creatinine

Board Review Question: In monitoring glomerular filtration function, which of the following tests has the highest sensitivity? urea clearance BUN/creatinine ratio urine sodium creatinine clearance

creatinine clearance

Board Review Question: In monitoring glomerular filtration function, which of the following tests has the highest sensitivity? urine sodium BUN/creatinine ratio creatinine clearance urea clearance

creatinine clearance

Board Review Question: A serum sample drawn in the emergency department from a 42 year old man yielded the following laboratory results: CK 185 IU/L (normal = 15-160) AST 123 IU/L (normal = 0-48) CK-MB 6 IU/L (normal = 2-12) Which of the following conditions might account for these values? crush injury in the thigh cerebrovascular accident (CVA) early acute hepatitis Pulmonary infarction

crush injury in the thigh

Board Review Question: A serum sample drawn in the emergency department from a 42 year old man yielded the following laboratory results: CK 185IU/L (normal = 15-160) AST 123 IU/L (normal = 0-48) CK-MB 6 IU/L (normal = 2-12) Which of the following conditions might account for these values? crush injury in the thigh Pulmonary infarction early acute hepatitis cerebrovascular accident (CVA)

crush injury in the thigh

Board Review Question: Which of the following amino acids is associated with a sulfhydryl group? cysteine serine glycine tyrosine

cysteine

Fatty acid synthesis takes place in what part of the cell? cytoplasm mitochondria nucleoplasm ribosomes

cytoplasm

Board Review Question Macrophages are characterized by cytoplasmic receptor for the C3 complement surface CD3 expression larger amounts of rough endoplasmic reticulum in vitro synthesis of immunoglobulins

cytoplasmic receptor for the C3 complement

At what time of her cycle is a women most likely to get pregnant ? days 1-7 days 8-13 days 14-18 days 18-28

days 14-18

Board Review Question: Metabolic acidosis is described as a(n): increase in CO2 content with an increased pH decrease in CO2 content with an increased pH decrease in CO2 content and PCO2 with a decreased pH increase in CO2 content and PCO2 with a decreased pH

decrease in CO2 content and PCO2 with a decreased pH

Board Review Question: In the determination of lactic dehydrogenase at 340 nm, using pyruvate as the substrate, one actually measures the increase in lactate increase in NADH decrease in pyruvate decrease in NADH

decrease in NADH

If the hydrogen ion concentration increases, the pH ____________________; if the hydrogen ion concentration decreases, the pH ______________________.

decreases, increases

Board Review Question: Increased serum albumin concentrations are seen in which of the following conditions? chronic inflammation acute hepatitis dehydration nephrotic syndrome

dehydration

Board Review Question: In the Malloy and Evelyn method for the determination of bilirubin, the reagent that is reacted with bilirubin to form a purple azobilirubin is diazonium sulfate diazotized sulfanilic acid dilute sulfuric acid sulfobromophtalein

diazotized sulfanilic acid

Board Review Question The Porter-Silber method (phenylhydrazine in alcohol and sulfuric acid) involves which part of the steroid molecule? ketone group hydroxyl group steroid ring dihydroxyacetone side chain

dihydroxyacetone side chain

If a patient has a low albumin level, which stage of drug metabolism will be affected? absorption distribution biotransformation excretion

distribution

Column rentention factor, which affects chromatography resolution, is defined as: distribution of solutes between stationary phase and mobile phase ease of physiological interactions between solute molecules and column packing material measure of of the relative separation between the peak centers of two solutes measure of the ability of a column to sparate two or more analytes in a sample

distribution of solutes between stationary phase and mobile phase

An acid is a hydrogen ___________________, a base is a hydrogen ______________________.

donor, acceptor

Board Review Question: A 25-year old man became nauseated and vomited 90 minutes after receiving a standard 75 g carbohydrate dose for an oral glucose tolerance test. The best course of action is place the patient in a recumbent position, reassure him, and continue the test draw blood for glucose and discontinue test start the test over immediately with a 50 g carbohydrate dose give the patient a glass of orange juice and continue the test

draw blood for glucose and discontinue test

Hormones are secreted from ___________________ into _____________. serous glands, body cavities or body surfaces serous glands, the bloodstream ductless glands, body cavities or body surfaces ductless glands, the bloodstream

ductless glands, the bloodstream

Board Review Question: Arterial blood collected in a heparinized syringe but exposed to room air would cause which of the following changes in the specimen? decreased PO2, decreased PCO2, decreased pH unchanged PO2, elevated PCO2, unchanged pH elevated PO2, decreased PCO2, elevated pH decreased PO2, elevated PCO2, decreased pH

elevated PO2, decreased PCO2, elevated pH

Grave's disease is an example of ________ cell injury. ischemic nutritional endocrine infectious

endocrine

Board Review Question: The function of the major lipid components of the very low-density lipoproteins (VLDL) is to transport: endogenous triglycerides exogenous triglycerides cholesterol from peripheral cells to the liver cholesterol and phospholipids to peripheral cells

endogenous triglycerides

_____________________ cholesterol is produced by the liver; ___________________ cholesterol is absorbed in the diet.

endogenous, exogenous

Eicosanoids are built from essential amino acids essential fatty acids glucose nucleic acids

essential fatty acids

Lipids are actually _____________________ of ____________________ . terpenes fatty acids esters sterols

esters, fatty acids

A(n) __________ deficiency causes bone disease in postmenopausal women. estrogen testosterone FSH LH

estrogen

Board Review Question: Which family of steroid hormones is characterized by an unsaturated A ring? glucocorticoids androgens progestins estrogens

estrogens

To achieve "steady state", a drug should be administered _________ daily for 2 weeks every 6 hours for 4 days continously every time it reaches half-life

every time it reaches half-life

Board Review Question: Aminotransferase enzymes catalyze the exchange of amino and keto groups between alpha-amino and alpha-keto acids exchange of amino groups and sulfhydryl groups between alpha-amino and sulfur-containing acids reversible transfer of hydrogen from amino acids to coenzyme hydrolysis of amino acids and keto acids

exchange of amino and keto groups between alpha-amino and alpha-keto acids

Board Review Question: Aminotransferase enzymes catalyze the exchange of amino groups and sulfhydryl groups between alpha-amino and sulfur-containing acids reversible transfer of hydrogen from amino acids to coenzyme hydrolysis of amino acids and keto acids exchange of amino and keto groups between alpha-amino and alpha-keto acids

exchange of amino and keto groups between alpha-amino and alpha-keto acids

Board Review Question: Which of the following elevates carboxyhemglobin? nitrite poisoning exposure to carbon monoxide sulfa drug toxicity sickle cell anemia

exposure to carbon monoxide

Board Review Question: Unless blood gas measurements are made immediately after sampling, in vitro glycolysis of the blood causes rise in pH and a fall in PCO2 fall in pH and rise in PO2 fall in pH and a rise in PCO2 rise in pH and PCO2

fall in pH and a rise in PCO2

Diagnostic sensitivity means that the disease is absent if the test is negative. true false

false

True/False? The hydrogen ion concentration has no effect on the chemical reactions of the body. True False

false

You can get cholesterol from vegetables. True/False

false

Triglyerides are made of cholesterol and glycerol fatty acids and glycerol fatty acids and cholesterol all of the above

fatty acids and glycerol

Board Review Question: The formation of estriol in a pregnant woman is dependent on maternal ovarian function fetal and placental function fetal adrenal function maternal liver function

fetal and placental function

Oligoclonal bands are found in serum and CSF. found in CSF only. associated with multiple myeloma. indicative of a recent demyelinating event.

found in CSF only.

Of the analytes found in semen, ________ provides the energy source for sperm motility. fructose alkaline phosphatase zinc magnesium

fructose

Board Review Question: The most sensitive enzymatic indicator for liver damage from ethanol intake is alkaline phosphatase (ALP) gamma-glutamyl-transferase (GGT) aspartate aminotransferase (ALT) alanine aminotransferase (ALT)

gamma-glutamyl-transferase (GGT)

Board Review Question: The most sensitive enzymatic indicator for liver damage from ethanol intake is gamma-glutamyl-transferase (GGT) alanine aminotransferase (ALT) aspartate aminotransferase (ALT) alkaline phosphatase (ALP)

gamma-glutamyl-transferase (GGT)

This secretion helps reduce the solid components of food and sterilizes the upper gut pancreatic amylase gastic acid salivary amylase bicarbonate

gastic acid

Hydrogen ion concentration (pH) in blood is usually determined by means of which of the following electrodes? platinum-lactate platinum glass silver

glass

Board Review Question: Creatinine clearance is used to estimate the tubular secretion of creatinine glomerular secretion of creatinine glomerular filtration rate renal glomerular and tubular mass

glomerular filtration rate

Which hormone stimulates glycogenolysis? dopamine glucagon insulin TSH

glucagon

The disaccharide maltose is composed of which of the following? glucose + methanol glucose + fructose galactose + glucose glucose + glucose galactose + fructose

glucose + glucose

In glycolysis: it functions as a catabolic pathway to breakdown glycogen to glucose it represents an energy consumtion system which creates an ATP deficit. it is a controlled reaction in which ADP is produced glucose is converted to carbon dioxide, water and energy the phosphorylated glucose molecules are converted to glycogen

glucose is converted to carbon dioxide, water and energy

Board Review Question: Increased concentrations of ascorbic acid inhibit chromogen production in which of the following glucose methods? hexokinase ferricyanide glucose oxidase ortho-toluidine

glucose oxidase

Board Review Question: Which of the following would be an example of a glucose-specific colorimetric method? glucose oxidase o-toluidine alkaline ferricyanide hexokinase

glucose oxidase

Board Review Question: Pregnant women with symptoms of thirst, frequent urination, or unexplained weight loss should have which of the following tests performed? tolbutamide test lactose tolerance test epinephrine tolerance test glucose tolerance test

glucose tolerance test

Board Review Question: The substance that is measured to estimate the serum concentration of triglycerides by MOST methods is: fatty acids pre-beta lipoprotein glycerol phospholipids

glycerol

What is the storage form of carbohydrates in our body? glucagon glucose glucosamine glycogen

glycogen

Board Review Question: The conversion of glucose or other hexoses into lactate or pyruvate is called: glycolysis gluconeogenesis glycogenesis glycogenolysis

glycolysis

Board Review Question: Which two conditions can "physiologically" elevate serum alkaline phosphatase? viral hepatitis, infectious mononucleosis growth, third-trimester pregnancy rickets, hyperparathyroidism obstructive jaundice, biliary cirrhosis

growth, third-trimester pregnancy

Board Review Question: Which two conditions can "physiologically" elevate serum alkaline phosphatase? viral hepatitis, infectious mononucleosis rickets, hyperparathyroidism growth, third-trimester pregnancy obstructive jaundice, biliary cirrhosis

growth, third-trimester pregnancy

Which hormone is not low in patients with panhypopiuitarism? ACTH hCG TSH hGH

hCG

Which is the correct quadruplicate combination of biomarkers used for performing prenatal screening tests for Down syndrome, spina bifida, and other fetal abnormalities? hCG, hGH, AFP, and inhibin A Total estradiol, unconjugated estradiol, AFP, hCG hCG, AFP, unconjugated estradiol, inhibin A hcG, AFP, inhibin A, and pregnancy-associated plasma protein A

hCG, AFP, unconjugated estradiol, inhibin A

Board Review Question: Substances that are antigenic only when coupled with a protein carrier are haptens allergens adjuvants opsonins

haptens

Arteriosclerosis means hardening of the arteries inflammation of the arteries accumulation of lipids in vascualr lesions all of the above

hardening of the arteries

Board Review Question: The reason carbon monoxide is so toxic is because combines with cytochrome oxidase is a protoplasmic poison sensitizes the myocardium has 200 times the affinity of oxygen for hemoglobin binding sites

has 200 times the affinity of oxygen for hemoglobin binding sites.

Board Review Question: A patient has the following thyroid profile; total T4 = increased free thyroxine index = normal T3 uptake = decreased TSH normal The patient most probably is hypothyroid has a pituitary adenoma is hyperthyroid has increased protein-bound T4

has increased protein-bound T4

Board Review Question: The different water content of erythrocytes and plasma makes true glucose concentrations in whole blood a function of the: leukocyte count hematocrit erythrocyte count erythrocyte indices

hematocrit

Which of these proteins are NOT synthesized in the liver? albumin hemoglobin ferritin ceruloplasmin

hemoglobin

Board Review Question: Monitoring long-term glucose control in patients with adult-onset diabetes mellitus can best be accomplished by measuring glucose tolerance testing hemoglobin A1c weekly fasting 7 am glucose 2-hour post-prandial serum glucose

hemoglobin A1c

Under alkaline conditions, __________ migrates between A and S. hemoglobin F hemoglobin A2 hemoglobin Bart hemoglobin C

hemoglobin F

Which buffer system can transport protein-bound CO2, H+ and O2, and participate in the chloride shift? bicarbonate buffer system hemoglobin buffer system protein buffer system phosphate buffer system

hemoglobin buffer system

Board Review Question: Specimens for blood gas determination should be drawn into a syringe containing EDTA heparin no preservative oxalate

heparin

In the liver lobule, each portal triad is made of a branch of: hepatic artery, hepatic vein, bile duct hepatic artery, hepatic vein, sinusoid hepatic vein, portal vein, bile duct hepatic artery, portal vein, bile duct

hepatic artery, portal vein, bile duct

Urea is produced by hepatic ezymes the nephron bacteria in the intestines all of the above

hepatic ezymes

Board Review Question: In which of the following conditions would a normal level of creatine kinase be found? acute myocardial infarct hepatitis intramuscular injection progressive muscular dystrophy

hepatitis

Board Review Question: In which of the following conditions would a normal level of creatine kinase be found? intramuscular injection hepatitis acute myocardial infarct progressive muscular dystrophy

hepatitis

The reproduction of hepatitis delta (D) requires ___________ to be present. hepatitis B surface antigen human immunodeficiency virus hepatitis C hepatitis A

hepatitis B surface antigen

Board Review Question: Bile acid concentrations are useful to assess intestinal malabsorption kidney function diabetes mellitus hepatobiliary disease

hepatobiliary disease

The bulk of the liver is made up of epithelial cells hepatocytes Kupffer cells bile

hepatocytes

Board Review Question: The most specific method for the assay of glucose utilizes: hexokinase glucose-6-phosphatase glucose dehydrogenase glucose oxidase

hexokinase

Board Review Question: A patient is admitted to the emergency room in a state of metabolic alkalosis. Which of the following would be consistent with this diagnosis? low TCO2, decreased H2CO3 high TCO2, decreased H2CO3 low TCO2, increased HCO3- high TCO2, increased HCO3-

high TCO2, increased HCO3-

A patient with chronic bronchitis may have compensated respiratory acidosis characterized by low bicarbonate, low pCO2. high bicarbonate, high pCO2. low bicarbonate, high pCO2. high bicarbonate, low pCO2.

high bicarbonate, high pCO2.

Board Review Question: Systemic Lupus Erythematosus patients often have which of the following test results? high titers of anti-smooth muscle antibodies high titers of anti-mitochondrial antibodies decreased serum immunoglobulin levels high titers of DNA antibody

high titers of DNA antibody

What drives glomerular filtration? heart rate hydrostatic pressure from afferent and efferent arteriole diameter difference volume of blood entering the glomerulus all of the above

hydrostatic pressure from afferent and efferent arteriole diameter difference

Board Review Question: A patient has the following results: increased serum calcium levels decreased serum phosphorus levels increased levels of parathyroid hormone The patient most likely has hyperparathyroidism hypoparathyroidism nephrosis steatorrhea

hyperparathyroidism

Board Review Question: The TRH (thyrotropin-releasing hormone) stimulation test is useful in assessing which of the following? TRH concentration hyperthyroidism iodine deficiency depression

hyperthyroidism

Board Review Question: A common cause of respiratory alkalosis is vomiting asthma hyperventilation starvation

hyperventilation

The __________ secretes releasing hormones that stimulate the anterior pituitary to release other hormones with other targets in the body. pineal gland hypothalamus thymus pancreas

hypothalamus

Water metabolism is under the influence of the brain hypothalamus heart anterior pituitary

hypothalamus

Board Review Question: Which immunologic mechanism is usually involved in bronchial asthma? immediate hypersensitivity immune complex delayed hypersensitivity antibody-mediated cytotoxicity

immediate hypersensitivity

Board Review Question: A transfusion reaction to erythrocyte antigens will activate which of the following immunopathologic mechanism? delayed hypersensitivity immediate hypersensitivity immune cytolysis Arthus reaction

immune cytolysis

Which of these methods is the primary method for tumor marker assays? immunoassays mass spectrometry micro arrays gas chromatography

immunoassays

Board Review Question: The identification of Bence-Jones protein is best accomplished by immunofixation a sulfosalicylic acid test urine reagent strips electrophoresis

immunofixation

You review your Levey-Jennings chart for the level 1 control on assay X and you notice that the data is scattered all over the chart, past the +2SD line and the -2SD line, and your CV is 9%. This is an idication of: inaccuracy imprecison a bad calibration an acceptable Levey Jennings chart

imprecison

Board Review Question: immunoglobulin production begins at birth early in neonatal life at about 2 years of age in early fetal life

in early fetal life

Board Review Question: In developing the reference range for a new EIA for CEA, the range for the normal population was broader than that published by the vendor. Controls are acceptable with a narrow CV. This may be explained by inclusion of smokers and non-smokers in the study population population skewed to a younger age improper temperature control during the assay positive interference by another tumor marker

inclusion of smokers and non-smokers in the study population

Board Review Question: In developing the reference range for a new EIA for CEA, the range for the normal population was broader than that published by the vendor. Controls are acceptable with a narrow CV. This may be explained by inclusion of smokers and non-smokers in the study population positive interference by another tumor marker improper temperature control during the assay population skewed to a younger age

inclusion of smokers and non-smokers in the study population

Board Review Question: Respiratory acidosis is described as a(n): increase in CO2 content with an increased pH increase in CO2 content and PCO2 with a decreased pH decrease in CO2 content and PCO2 with a decreased pH decrease in CO2 content with an increased pH

increase in CO2 content and PCO2 with a decreased pH

Which of the following is FALSE concerning blood cholesterol concentrations? increased cholesterol is associated with diabetes mellitus increased cholesterol is associated with hyperthyroidism increased cholesterol is associated with nephrotic syndrome cholesterol levels decrease following strenuous exercise cholesterol levels are unchanged when comparing results from fasting and nonfasting blood

increased cholesterol is associated with hyperthyroidism

Board Review Question: The major action of angiotensin II include decreased adrenal secretion of aldosterone increased pituitary secretion of renin increased parathyroid hormone secretion by the parathyroid gland increased vasoconstriction

increased vasoconstriction

Board Review Question: The major action of angiotensin II include increased parathyroid hormone secretion by the parathyroid gland decreased adrenal secretion of aldosterone increased pituitary secretion of renin increased vasoconstriction

increased vasoconstriction

Board Review Question: In a specimen collected for plasma glucose analysis, sodium fluoride: serves as a coenzyme of hexokinase prevents reactivity of non-glucose reducing substances precipitates protein inhibits glycolysis

inhibits glycolysis

Lipids are ______________ in water.

insoluble

Synthesis of glycogen is stimualted by dopamine glucagon insulin TSH

insulin

Which of these hormones is the storage hormone that helps convert glucose to fat? epinephrine insulin glucagon growth hormone

insulin

Board Review Question: Urobilinogen is formed in the liver spleen intestine kidney

intestine

Board Review Question: Absorption of vitamin B12 requires the presence of: folic acid gastrin intrinsic factor secretin

intrinsic factor

Which of these metals is NOT toxic? arsenic iron lead mercury

iron

Board Review Question: A patient has the following results: serum iron: 250 ug/dL (ref range: 60-150 ug/dL) TIBC: 350 ug/dL (ref range: 300-350 ug/dL) The best conclusion is that this patient has: chronic disease iron-deficiency anemia normal iron status iron hemochromatosis

iron hemochromatosis

Board Review Question: A condition in which erythrocyte protoporphyrin is increased is: acute intermittent porphyria iron-deficiency anemia porphyria cutanea tarda acute porphyria attack

iron-deficiency anemia

Board Review Question: Decreased serum iron associated with increased TIBC is compatible with which of the following disease states? nephrosis anemia of chronic infection chronic liver disease iron-deficiency anemia

iron-deficiency anemia

Cortical bone is also known as compact bone is located in the interior of bones makes up 50% of your bone mass contains spiculaes

is also known as compact bone

Magnesium is the most abundant intracellular cation is the second most abundant intracellular cation is the most abundant extracellular cation is the second most abundant extracellular cation

is the second most abundant intracellular cation

If a drug concentration is above the therapeutic range _____________ it will have no pharmacologic effect it will have a smaller pharmacologic effect it will have toxic pharmacologic effects it will cause liver toxicity

it will have toxic pharmacologic effects

Postrenal azotemia is found in: Acute kidney disease Kidney stones Nephrotic syndrome. Dehydration.

kidney stones

Board Review Question: The enzyme present in almost all tissues that may be separated by electrophoresis into five components is transaminase creatine kinase lipase lactate dehydrogenase

lactate dehydrogenase

Board Review Question: Serum anion gap is increased in patients with renal tubular acidosis lactic acidosis metabolic acidosis due to diarrhea diabetic alkalosis

lactic acidosis

Board Review Question: Zinc protoporphyrin or free erythrocyte protoporphyrin measurements are useful to assess blood concentrations of: beryllium mercury arsenic lead

lead

The heart chamber that receives blood from the pulmonary veins is: right atria left atria right ventricle left ventricle

left atria

The heart chamber that pumps blood to the entire body via the aorta is: right atria left atria right ventricle left ventricle

left ventricle

Board Review Question: The most specific enzyme test for acute pancreatitis is: lipase amylase acid phosphatase trypsin

lipase

Eicosanoids such as the prostaglandins are derived from proteins. lipids. carbohydrates. heavy metals.

lipids.

Board Review Question: A 48-yr old woman with mild jaundice has the following serum enzyme results ALP 600IU/L (ref:0-150IU/L) GGT 230IU/L (ref:0-55IU/L) ALP after 10minutes' incubation at 56C 300IU/L (ref: 50% of original activity) AST 400 IU/L (ref: 0-50 IU/L) Which of the following sources most contributes to the patient's ALP activity? liver Regan isoenzyme bone placenta

liver

Board Review Question: A 48-yr old woman with mild jaundice has the following serum enzyme results ALP 600IU/L (ref:0-150IU/L) GGT 230IU/L (ref:0-55IU/L) ALP after 10minutes' incubation at 56C 300IU/L (ref: 50% of original activity) AST 400 IU/L (ref: 0-50 IU/L) Which of the following sources most contributes to the patient's ALP activity? bone placenta Regan isoenzyme liver

liver

Board Review Question: AST is characteristically elevated in disease of the intestine kidney pancreas liver

liver

Board Review Question: AST is characteristically elevated in disease of the pancreas intestine kidney liver

liver

Which organ processes and distributes lipids? intestines liver brain heart

liver

Board Review Question: A 68-year old man arrives in the emergency room with a glucose level of 722 mg/dL and serum acetone of 4+ undiluted. An arterial blood gas from this patient is likely to indicate which of the following? low pH low PO2 high PO2 high pH

low pH

Board Review Question: A 68-yr old man arrives in the emergency room with a glucose level of 722 mg/dL, and serum acetone of 4+ undiluted. An arterial blood gas from this patient is likely to indicate which of the following? low PO2 low pH high PO2 high pH

low pH

Board Review Question: Serum levels that define hypoglycemia in preterm or low birth weight infants are lower than in adults the same as in adults the same as in a normal full-term infant higher than in a normal full-term infant

lower than in adults

Smoking is dangerous to the cardiovascular system because it decreases blood pressure. lowers HDL cholesterol. increases HDL cholesterol. increases triglycerides.

lowers HDL cholesterol.

Board Review Question: Antinuclear antibody tests are performed to help diagnose acute leukemia hemolytic anemia rheumatoid arthritis lupus eythematosus

lupus eythematosus

Board Review Question: Which of the following mediators is released during T-cell activation? thymosin immunoglobulins lymphokines serotonin

lymphokines

Which one of these is an example of innate immunity? vaccination against hepatitis B macrophages eating bacteria in a knee scrape B-Lymphocytes making antibodies to Staph aureus T-Lymphocytes killing a HSV infected cell

macrophages eating bacteria in a knee scrape

Cancer grading and staging is based on which of the following except tumor size. metastatic status. microscopic features. macroscopic features.

macroscopic features.

Which of the following is most likely to be ordered in addition to serum calcium to determine the cause of tetany? phosphorous sodium vitamin D magnesium

magnesium

Board Review Question: The primary function of serum albumin in the peripheral blood is to maintain blood viscosity increase fibrinogen formation maintain colloid osmotic pressure increase antibody production

maintain colloid osmotic pressure

Board Review Question: When performing a manual protein analysis on a xantochromic spinal fluid the technician should make a specimen blank perform the test as usual centrifuge the specimen dilute the specimen with deionized water

make a specimen blank

Board Review Question: When performing a manual protein analysis on a xantochromic spinal fluid the technician should dilute the specimen with deionized water perform the test as usual centrifuge the specimen make a specimen blank

make a specimen blank

Trabecullar bone is the outer layer of bones makes up 20% of our bone mass is made of osteons contains lamellae

makes up 20% of our bone mass

Which of these methods can generate proteomic patterns? immunoassays mass spectrometry micro arrays gas chromatography

mass spectrometry

To determine if there is hemolytic disease of the newborn, the optical density (OD) 450 test is used to measure bilirubin concentrations from a mother's blood. measure bilirubin concentrations from amniotic fluid. measure hemoglobin concentrations from amniotic fluid. measure Rh antibody titer from the mother's blood.

measure bilirubin concentrations from amniotic fluid.

Board Review Question: The first step in analyzing a 24-hr urine specimen for quantitative urine protein is add the appropriate preservative measure the total volume screen for albumin using a dipstick subculture the urine for bacteria

measure the total volume

The correct order of steps for tumor metastasis is extravasation, angiogenesis, intravasation, adhesion to the basement membrane. metastatic subclone, intravasation, extravasation, angiogenesis. angiogenesis, tumor cell embolus, adhesion to basement membrane, metastatic subclone. intravasation, passage through extracellular matrix, extravasation, metastatic deposit.

metastatic subclone, intravasation, extravasation, angiogenesis.

Which of these methods looks as genomic alterations? immunoassays mass spectrometry micro arrays gas chromatography

micro arrays

Board Review Question: Clinical assays for tumor markers are most important for confirming the absence of disease screening for the presence of cancer identifying patients at risk for cancer monitoring the course of a known cancer

monitoring the course of a known cancer

Tumor marker test are the most beneficial for: diagnosing cancer screening for cancer monitoring therapy all of the above

monitoring therapy

Overexpression of one B-cell clone is termed polyclonal gammopathy. oligoclonal gammopathy. monoclonal gammopathy. immunoglobulin deficiency.

monoclonal gammopathy.

Board Review Question: Analysis of CSF for oligoclonal bands is used is used to screen for which of the following disease states? multiple myeloma von Willebrand's disease myasthemia gravis multiple sclerosis

multiple sclerosis

An individual with metabolic syndrome is not at increased risk for high blood pressure. adult onset diabetes. multiple sclerosis. hypercholesterolemia and hypertriglyceridemia.

multiple sclerosis.

Multiple myeloma is characterized by all of the following except osteolytic lesions. renal failure. anemia. multiple sclerosis.

multiple sclerosis.

Board Review Question: In performing a spinal fluid for protein determination, the specimen is diluted 1 part spinal fluid to 3 parts saline to obtain a result low enough to measure. To calculate the protein concentration, the results must be: multiplied by 3 multiplied by 4 divided by 3 divided by 4

multiplied by 4

Essential amino acids must be obtained from our diet must be manufactured by the liver must be synthesized from other amino acids none of the above

must be obtained from our diet

Board Review Question: The presence of increased CK-MB activity on a CK electrophoresis pattern is most likely found in a patient suffering from acute muscular stress following strenuous exercise malignant liver disease myocardial infraction severe head injury

myocardial infraction

Which of these layers is made up of cardiac muscle and drives the pumping action of the heart: endocardium myocardium pericardium pleura

myocardium

Board Review Question: Nonspecific killing of tumor cells is carried out by antibody and complement helper T cells natural killer cells cytotoxic T cells

natural killer cells

The hypothalamus senses a decrease in the hormone level, and stimulates the release of a releasing hormone and/or a stimulating hormone, which in turns leads to an increase in the hormone level. This is a _________________ negative-feedback loop positive-feedback-loop pulsatile hormone prostaglandin feedback

negative-feedback loop

The hypothalamus senses an increase in the hormone level, and shuts down the production of the releasing hormone and/or the stimulating hormone, which in turns leads to a decrease in the hormone level. This is a _________________ negative-feedback loop positive-feedback-loop pulsatile hormone prostaglandin feedback

negative-feedback loop

What is the functional unit of the kidney? cortex medulla nephron urethra

nephron

What is portal circulation? blood circulating from your heart to the rest of your body blood that enters the liver from the hepatic artery network of arteries and veins in the liver network of veins that carry blood from the intestines to the liver

network of veins that carry blood from the intestines to the liver

Board Review Question: Which of the following is an important cellular mediator of immune complex tissue injury? monocyte eosinophil neutrophil basophil

neutrophil

Board Review Question: Which of the following is an important cellular mediator of immune complex tissue injury? neutrophil basophil monocyte eosinophil

neutrophil

Board Review Question: Cells known to be actively phagocytic include: monocytes, lymphocytes, neutrophils neutrophils, monocytes, basophils neutrophils, eosinophils, monocytes lymphocytes, eosinophils, monocytes

neutrophils, eosinophils, monocytes

Board Review Question: Pellagra is associated with deficiency in which of the following vitamins? niacin B1 A thiamine

niacin

Which element does protein contain that is not present in carbohydrates or lipids? carbon hydrogen oxygen nitrogen

nitrogen

Board Review Question: Oligoclonal bands are present on electrophoresis of concentrated CSF and also on concurrently tested serum of the same patient. The proper interpretation is: CNS involvement by acute leukemia nondiagnostic for multiple sclerosis diagnostic for primary CNS tumor diagnostic for multiple sclerosis

nondiagnostic for multiple sclerosis

Board Review Question: The prevalence of immune complexes indicates polyclonal hypergammaglobulinemia inflammatory tissue injury protection from complement-dependent neutrophil chemotaxis normal host response to antigenic exposure

normal host response to antigenic exposure

Board Review Question: A 45-yr old woman has a fasting serum glucose concentration of 95 mg/dL and a 2-hour postprandial glucose concentration of 105 mg/dL. The statement that best describes the patient's fasting serum glucose concentration is: abnormal, indicating hypoglycemia normal, reflecting glycogen breakdown by the liver normal, reflecting glycogen breakdown by skeletal muscle abnormal, indicating diabetes mellitus

normal, reflecting glycogen breakdown by the liver

DNA is contained in the cell's nucleus ribosomes endoplasmic reticulum Golgi apparatus

nucleus

Board Review Question: Given the following results: ALP: marked increase ALT: slight increase AST: slight increase GGT marked increase This is most consistent with osteitis fibrosa chronic hepatitis obstructive jaundice acute hepatitis

obstructive jaundice

Board Review Question: Given the following results: ALP: marked increase ALT: slight increase AST: slight increase GGT marked increase This is most consistent with acute hepatitis obstructive jaundice osteitis fibrosa chronic hepatitis

obstructive jaundice

Board Review Question: A stool specimen that appears black and tarry should be tested for the presence of occult blood trypsin fecal fat excess mucous

occult blood

Board Review Question: Blood received in the laboratory for blood gas analysis must meet which of the following requirements? on ice, thin fibrin strands only, no air bubbles on ice, no clots, fewer than 4 air bubbles on ice, no clots, no air bubbles room temperature, no clots, no air bubbles

on ice, no clots, no air bubbles

Triglycerides contain three glyceride molecules with three fatty acids. one glyceride molecule with two fatty acids. one glyceride molecule with three fatty acids. one glyceride with a variable amount of fatty acids but usually three.

one glyceride molecule with three fatty acids.

Board Review Question : Macrophage phagocytosis of bacteria in enhanced by which of the following hapten opsonins antigen secretory piece

opsonins

The _____________ test is most useful for diagnosis of gestational diabetes. fasting blood glucose oral glucose tolerance hemoglobin A1c urinary albumin

oral glucose tolerance

Which cell promote bone formation? osteoblasts osteoclasts osteocytes all of the above

osteoblasts

Which of these cells has a function in bone building? osteoblasts osteoclasts osteocytes osteons

osteoblasts

Which cell promote bone resportion? osteoblasts osteoclasts osteocytes all of the above

osteoclasts

Which of these cells has a function is bone resorption (tear down)? osteoblasts osteoclasts osteocytes osteons

osteoclasts

Which cell is encased into the bone? osteoblasts osteocytes osteoclasts all of the above

osteocytes

What is the effect of FSH in the female reproductive system? production of estrogen production of progesterone ovulation menstruation

ovulation

Board Review Question: Malic dehydrogenase is added to the AST reaction to catalyze the conversion of alpha-ketogluterate to malate aspartate to oxaloacetate alpha-ketoglutarate to aspartate oxaloacetate to malate

oxaloacetate to malate

Board Review Question: Which of the following is the Henderson-Hasselbalch equation? pH = pKa + log (acid/salt) pKa = pH + log (acid/salt) pH = pKa + log (salt/acid) pKa = pH + log (salt/acid)

pH = pKa + log (salt/acid)

Which of the following can affect the concentration of ionized calcium in blood? Barometric pressure pH and temperature Magnesium concentration Partial pressure of carbon dioxide

pH and temperature

Board Review Question: Most automated blood gas analyzers directly measure: HCO3-, PCO2, and PO2 pH, PCO2, and PO2 pH, HCO3- and %O2 saturation pH, PO2 and % O2 saturation

pH, PCO2, and PO2

Amylase, lipase, trypsin and chymostrypsin are all secreted by the liver pancreas stomach small intestine

pancreas

Which organ of the GI system is both an endocrine and exocrine gland? liver pancreas stomach small intestine

pancreas

Board Review Question: Fasting serum phosphate concentration is controlled primarily by the pancreas parathyroid gland skeleton small intestine

parathyroid gland

Board Review Question: The regulation of calcium and phosphorus metabolism is accomplished by which of the following glands? adrenal gland thyroid pituitary parathyroid gland

parathyroid gland

Board Review Question: Calcium concentration in the serum is regulated by thyroxine insulin parathyroid hormone vitamin C

parathyroid hormone

Which hormone causes a rise in ionized calcium? calcitonin parathyroid hormone thyroid hormone cortisol

parathyroid hormone

Which cells secrete hydrochloric acid? stomach surface epithelial cells chief cells enterochromaffin cells parietal cells

parietal cells

Board Review Question: The IgM molecule is a dimer pentamer trimer tetramer

pentamer

Board Review Question: The biuret reaction for the analysis of serum protein depends on the number of peptide bonds free amino acids free carboxyl groups tyrosine residues

peptide bonds

What links amino acids together? covalent bonds ionic bonds peptide bonds all of the above

peptide bonds

Which of these layers encases the heart: endocardium myocardium pericardium pleura

pericardium

Board Review Question: An elevated serum iron with normal iron-binding capacity is most likely associated with septicemia iron-deficiency anemia pernicious anemia renal damage

pernicious anemia

Board Review Question: The principle of the occult blood test depends on the coagulase ability of blood hydrogen peroxide in hemoglobin peroxidase-like activity of hemoglobin oxidative power of atmospheric oxygen

peroxidase-like activity of hemoglobin

The study of the biochemical and physiologic effects of drugs and their mechanisms of action is called: pharmacology phamacodynamics pharmacokinetics personalized medicine

phamacodynamics

The assessment of the rate of absorption, distribution, biotransformation and excretion is called: pharmacology phamacodynamics pharmacokinetics personalized medicine

pharmacokinetics

Board Review Question: The anticonvulsant used to treat tonic-clonic (grand-mal) seizures is digoxin acetaminophen lithium phenytoin

phenytoin

Which buffer system is essential in the red cell, is found in the form of 2,3-DPG and enables thr kidneys to excrete H+? bicarbonate buffer system hemoglobin buffer system protein buffer system phosphate buffer system

phosphate buffer system

Board Review Question: The stimulant that causes localized sweating for the sweat test is pilocarpine nitrate potassium sulfate polyvinyl alcohol lithium sulfate

pilocarpine nitrate

You did a 1/10 dilution on your CK test and you get the results off the analyzer, you must multiply the result by the dilution factor, which phase of testing does this fall into? preanalytical analytical postanalytical

postanalytical

You pick up a sample to load it on the analyzer and you notice that it is hemolyzed. You kick it back to the phlebotomists for a redraw. Which phase of testing is this? preanalytical analytical postanalytical

preanalytical

Board Review Question: Which of the following methods for quantitation of high-density lipoprotein is most suited for clinical laboratory use? precipitation column chromatography Gomori procedure agarose gel electrophoresis

precipitation

Board Review Question: The term used to describe reproducibility is sensitivity specificity accuracy precision

precision

If your patient is in hypovolemic shock, you would expect to see: prerenal azotemia renal azotemia postrenal azotemia none of the above

prerenal azotemia

An elevation in chloride in the presence of normal sodium and potassium is seen in primary hyperparathyroidism. excess water consumption. excess diuretic use. hyperaldosteronism.

primary hyperparathyroidism.

Which one of these protein structures is determined by the sequence of amino acids? primary structure secondary structure tertiary structure quaternary structure

primary structure

What is the effect of LH in the female reproductive system? production of estrogen production of progesterone ovulation menstruation

production of progesterone

Board Review Question: Measurement of the serum acid phosphatase is used to detect neoplastic disease of the ovary prostate lung liver

prostate

The heme moiety of hemoglobin is an example of a prostetic group. glycoprotein. proteinphosphoprotein. simple protein.

prostetic group.

Which buffer system is the main cellular buffer? bicarbonate buffer system hemoglobin buffer system protein buffer system phosphate buffer system

protein buffer system

The definition of an oncofetal antigen is cancer of the neonate. protein produced in normal adults but not in normal neonates. proteins expressed during the fetal period that are not expressed in normal adults but are produced by cancerous cells. tumor markers that are very specific to one type of cancer.

proteins expressed during the fetal period that are not expressed in normal adults but are produced by cancerous cells.

After the blood is filtered through the glomerulus, the filtrate follows a certain path. Put the path of the filtrate in the right order. bladder renal calyces distal convoluted tubule ureters collecting duct urethra proximal convoluted tubule descending loop of Henle ascending loop of Henle

proximal convoluted tubule descending loop of Henle ascending loop of Henle distal convoluted tubule collecting duct renal calyces ureters bladder urethra

The Wroblewski and LaDue method uses the _____________ to ______________ reaction.

pyruvate, lactate

Which one of these protein structures is determined by arrangement of two or more polypeptides? primary structure secondary structure tertiary structure quaternary structure

quaternary structure

Board Review Question: The first to be followed if the blood gas instrument is out of control for all parameters is: replace electrodes, then repeat control report patient results after duplicate testing repeat control on next shift recalibrate, then repeat control

recalibrate, then repeat control

Board Review Question: The T3 uptake test is based on stimulation of the thyroid by TSH relative binding of T3 and T4 to globulin stimulation of the thyroid by T3 binding of T4 to charcoal

relative binding of T3 and T4 to globulin

Board Review Question: Magnesium carbonate is added in an iron-binding capacity determination in order to: remove excess unbound iron precipitate protein allow color to develop bind with hemoglobin iron

remove excess unbound iron

Some individuals who survived crush injuries suffered during World War II died a few days later of renal failure due to rhabdomyolysis. rhabdomyolysis due to renal failure. liver lacerations. congestive heart failure.

renal failure due to rhabdomyolysis.

Board Review Question: A serum sample demonstrates an elevated result when tested with the Jaffe reaction. This indicates pregnancy renal function impairment arrhythmia prolonged hypothermia

renal function impairment

Board Review Question: After a difficult venipuncture requiring prolonged application of the tourniquet, the serum K+ was found to be 6.8 mEq/L. the best course of action is to repeat the test using freshly drawn serum adjust the value based on the current serum N+ repeat the test using the same specimen cancel the test

repeat the test using freshly drawn serum

Board Review Question: After a difficult venipuncture requiring prolonged application of the tourniquet, the serum K+ was found to be 6.8 mEq/L. the best course of action is to repeat the test using freshly drawn serum repeat the test using the same specimen cancel the test adjust the value based on the current serum N+

repeat the test using freshly drawn serum

Board Review Question: An arterial blood specimen submitted for blood gas analysis was obtained at 8:30 AM but was not received in the laboratory until 11:00 AM. The technologist should request a venous blood specimen request a new arterial specimen be obtained perform the test immediately upon receipt perform the test only if the specimen was submitted in ice water

request a new arterial specimen be obtained

Board Review Question: The following laboratory results were obtained on arterial blood. These results are most compatible with _______ sodium 136 mEq/LpH7.32 potassium4.4 mEq/LPCO279 mmHg chloride92 mEq/L bicarbonate40 mEq/L metabolic acidosis metabolic alkalosis respiratory acidosis respiratory alkalosis

respiratory acidosis

The heart chamber that receives blood from the vena cava is: right atria left atria right ventricle left ventricle

right atria

The heart chamber that pumps blood to the lungs is: right atria left atria right ventricle left ventricle

right ventricle

High levels of homocysteine outside of the context of a genetic disease are associated with __________________ in adults. risk of cardiovascular disease risk of breast cancer risk of autoimmune disease risk of renal failure

risk of cardiovascular disease

Board Review Question: Serial bilirubin determination are charted below with the best explanation for the results due to Day 1, collected at 7 am, assayed at 8 am, result: 14.0 mg/dL Day 2, collected at 7 am, assayed at 6 pm, result: 9.0 mg/dL Day 3, collected at 6 am, assayed at 8 am, result: 15.0 mg/dL sample hemolysis and hemoglobin deterioration reagent deterioration sample exposure to light sample left in a warm location

sample exposure to light

The following results were obtained on a patient: free T 4 low, free T 3 low, TSH low. This patient suffers from Graves' disease primary hypothyroidism secondary hypothyroidism secondary or tertiary hypothyroidism

secondary or tertiary hypothyroidism

Which one of these protein structures is determined by the interaction of adjacent amino acids and the formation of hydrogen bonds? primary structure secondary structure tertiary structure quaternary structure

secondary structure

Board Review Question: T cells are incapable of secretion of lymphokines secretion of immunoglobulins collaborating with B cells in some antibody responses producing positive skin tests

secretion of immunoglobulins

Board Review Question: The first step in the quantitation of serum iron is direct reaction with appropriate chromogen iron saturation of transferrin free iron precipitation separation of iron from transferrin

separation of iron from transferrin

Board Review Question: Patients with Cushing's syndrome exhibit decreased cortisol secretory rate decreased plasma 17-hydroxysteroid concentration decreased urinary 17-hydroxysteroid excretion serum cortisol concentrations greater than 15 mg/dL

serum cortisol concentrations greater than 15 mg/dL

In what portion of the GI tract are the majority of the nutrients absorbed? stomach liver small intestine colon

small intestine

Which organ of the GI system has the greatest surface area due to the presence of villi? liver pancreas stomach small intestine

small intestine

Board Review Question: Which of the following electrolytes is the chief plasma cation whose main function is maintaining osmotic pressure? chloride sodium potassium calcium

sodium

Board Review Question: The anion gap is useful for quality control laboratory results for calcium, phosphorus and magnesium amino acids and proteins blood gas analysis sodium, potassium, chloride and total CO2

sodium, potassium, chloride and total CO2

Board Review Question: The following bilirubin results are obtained on a patient Day 1: 4.3 mg/dL Day 2: 4.6 mg/dL Day 3: 4.5 mg/dL Day 4: 2.2 mg/dL Day 5: 4.4 mg/dL Day 6: 4.5 mg/dL Given that the controls were within range each day, what is the probable explanation for the result on day 4? specimen had prolonged exposure to light specimen was hemolyzed no explanation necessary serum, not plasma was used for the testing

specimen had prolonged exposure to light

What is the effect of FSH on the male reproductive system? estrogen production testosterone production progesterone production spermatogenesis

spermatogenesis

Board Review Question: To ensure an accurate ammonia level result, the specimen should be stored at room temperature and tested spun, separated, iced, and tested immediately spun and separated immediately, tested as routine incubated at 37C prior to testing

spun, separated, iced, and tested immediately

This type of hormone is derived from cholesterol, insoluble in water, has a four-ring structure, circulates bound to carrier proteins, and does not need cell membrane receptors to act on its target cells. amines peptides steroids all of the above

steroids

The enzyme creatine kinase is used in muscles to build stronger muscle shorten myofibrils during contraction store and release energy release calcium for muscle contraction

store and release energy

Board Review Question: Erroneous ammonia levels can be eliminated by all of the following except storing the specimen protected from light until the analysis is done ensuring water and reagents are ammonia-free separating plasma from cells and performing the analysis as soon as possible drawing the specimen in a prechilled tube and immersing the tube in ice

storing the specimen protected from light until the analysis is done

Violation of the 2-2S, 4-1S or 10x Westgard rules is a strong indication of

systematic error

Contraction of the heart muscle is called _______________ , relaxation of the heart muscle is called ____________________ .

systole, diastole

Which of the following is an example of an inferential statistic? Mean Standard deviation t test Correlation coefficient

t test

In blood of healthy subjects, _____ are seen in CSF protein electrophoresis but not typically in serum protein electrophoresis. oligoclonal proteins prealbumin and transferrin tau band and oligoclonal proteins tau band and prealbumin

tau band and prealbumin

Muscles are anchored to bones by fascia ligaments periosteum tendons

tendons

Which one of these protein structures is determined by the the way the protein chain folds back upon itself? primary structure secondary structure tertiary structure quaternary structure

tertiary structure

Board Review Question: The biologically most active naturally occurring androgen is androstenedione dehydroepiandrostenone epiandrostenone testosterone

testosterone

What is the effect of LH on the male reproductive system? estrogen production testosterone production progesterone production spermatogenesis

testosterone production

The statistical values that assess precision are: the CV and the SD the mean and the SD the range and the mean the range and the CV

the CV and the SD

Atrial systole/depolarization corresponds to the P wave of the ECG the QRS complex of the ECG the T wave of the ECG all of the above

the P wave of the ECG

Ventricular systole/depolarization corresponds to the P wave of the ECG the QRS complex of the ECG the T wave of the ECG all of the above

the QRS complex of the ECG

Ventricular diastole/repolarization corresponds to the P wave of the ECG the QRS complex of the ECG the T wave of the ECG all of the above

the T wave of the ECG

Sensory neurons are found in the ascending tracts of the spinal cord the descending tracts of the spinal cord both ascending and descending tracts of the spinal cord the peripheral nervous system only

the ascending tracts of the spinal cord

What is the location of the internal convection process? the circulatory system the cells of the body the lungs the kidneys

the circulatory system

The renal threshold is the concentration of a substance that exceeds the active transport capacity in the PCT the concentration of a substance that is below the active transport capacity in the PCT the concentration of a substance that exceeds the passive transport capacity in the DCT the concentration of a substance that exceeds the active transport capacity in the DCT

the concentration of a substance that exceeds the active transport capacity in the PCT

Glycolysis is: the conversion of glucose into lactate or pyruvate and then CO2 and H2O. the conversion of glucose to glycogen for storage. the breakdown of glycogen to form glucose and other intermediate products. the formation of glucose from noncarbohydrate sources.

the conversion of glucose into lactate or pyruvate and then CO2 and H2O.

Board Review Question: Osmolal gap is the difference between molality and molarity at 4C the difference between the calculated and measured osmolality values the difference between plasma and water osmolality values the difference between the ideal and the real osmolality values

the difference between the calculated and measured osmolality values

Gluconeogenesis is: the conversion of glucose to glycogen for storage. the formation of glucose from non carbohydrate sources, for example, amino acids, glycerol, and lactate. the conversion of glucose into 3-C molecules, for example, lactate and pyruvate. the breakdown of glycogen to form glucose and other intermediate products.

the formation of glucose from non carbohydrate sources, for example, amino acids, glycerol, and lactate.

Board Review Question: Bioavailability of a drug refers to the availability of therapeutic administration the fraction of the drug absorbed into the systemic circulation drug transformation availability of the protein-bound fraction of the drug

the fraction of the drug absorbed into the systemic circulation

If a drug is metabolized in first order kinetics the higher the drug concentration the faster the liver metabolizes it. the lower the drug concetration the faster the liver metabolizes it. the drug concentration does not affect the rate of metabolism by the liver. it will be processed by the kidneys.

the higher the drug concentration the faster the liver metabolizes it.

Renin is produced in the brain the hypothalamus the pituitary the kidneys

the kidneys

The greatest CONCENTRATION of glycogen is found in the brain the liver the skeletal muscles the skin

the liver

What is the location of the external convection process? the circulatory system the cells of the body the lungs the kidneys

the lungs

The statistical value that assesses accuracy is: the CV the mean the range the SD

the mean

What is bioavailability? the portion of the drug that is absorbed by the GI system the portion of the drug that reaches the systemic circulation the portion of the drug that reaches the target tissue the portion of the drug that gets in the cell

the portion of the drug that reaches the systemic circulation

What distingishes one amino acid from another? the amino group the radical group the carboxyl group the hydrogen content

the radical group

Board Review Question: A serum sample was assayed for bilirubin at 10 am and the results was 12 mg/dL. The same sample was retested at 3 pm. The result is now 8 mg/dL. The most likely explanation for this discrepancy is a calculation error in the first assay the sample was not refrigerated the sample was exposed to light the reagent has deteriorated

the sample was exposed to light

Board Review Question: A drug that relaxes smooth muscles of the bronchial passages is acetaminophen lithium theophylline phenytoin

theophylline

Board Review Question: A drug that relaxes the smooth muscles of the bronchial passages is acetaminophen phenytoin lithium theophylline

theophylline

When measuring drugs in serum, the target range is normal range. reference range. therapeutic range. multiples of the median

therapeutic range.

Board Review Question: Which of the following is a characteristic shared by lactate dehydrogenase, malate dehydrogenase, isocitrate dehydrogenase, and hydroxybutyrate dehydrogenase? they are liver enzymes they are cardiac enzymes they are class III enzymes they catalyze oxidation-reduction reactions

they catalyze oxidation-reduction reactions

Hairy cell leukemia is so named because: they have hairlike projections from the nucleus. they were first descripted by Hairy Hodgkin. they have hairlike projections from the cytoplasm. presence of these cells invokes anxiety.

they have hairlike projections from the cytoplasm.

Board Review Question: Assay of transketolase activity in blood is used to detect deficiency of thiamine folic acid riboflavin ascorbic acid

thiamine

Board Review Question: The most widely employed screening technique for drug abuse is thin-layer chromatography gas-liquid chromatography UV spectrophotometry HPLC

thin-layer chromatography

Board Review Question: High titers of antimicrosomal antibodies are most often found in chronic hepatitis systemic lupus erythematosus thyroid disease rheumatoid arthritis

thyroid disease

Board Review Question: The major fraction of organic iodine in the circulation is in the form of thyroglobulin triiodothyronine diiodotyrosine thyroxine

thyroxine

Which one of these sets of hormones are produced by the thyroid gland? androgens, catecholamines and steroids ADH and oxytocin estrogens, progesterone and testosterone thyroxine and triiodothyronine

thyroxine and triiodothyronine

Board Review Question: Measurement of total T4 by competitive protein binding or displacement is based on the specific binding properties of thyroid-stimulating hormone albumin thyroxine-binding globulin thyroxine=binding pre-albumin

thyroxine-binding globulin

Board Review Question: A patient's blood was drawn at 8 am for a serum iron determination. The result was 85 ug/dL. A repeat specimen was drawn at 8 pm; the serum was stored at 4 degrees Celsius and run the next morning. The result was 40 ug/dL. These results are most likely due to: iron-deficiency anemia improper storage of the specimen possible liver damage time of day the second sample was drawn

time of day the second sample was drawn

Board Review Question: Blood specimens for digoxin assays should be obtained between 8 hours or more after drug administration because tissue and serum levels need to reach equilibrium serum digoxin concentrations will be falsely low prior to 6 hours all of the digoxin is in the cellular fraction prior to 6 hours digoxin protein-binding interactions are minimal prior to 6 hours

tissue and serum levels need to reach equilibrium

The purpose of the sodium-potassium ATP pump is to pump sodium and potassium out of the cell. to pump sodium and potassium into the cell. to pump sodium out of the cell and potassium into the cell. to pump sodium into the cell and potassium out of the cell.

to pump sodium out of the cell and potassium into the cell.

Board Review Question: If the LDL cholesterol is to be calculated by the Friedenwald formula, what are the two measurements that need to be carried out by the same chemical procedure? triglycerides and chylomicrons total cholesterol and triglycerides apolipoprotein A and apolipoprotein B total cholesterol and HDL cholesterol

total cholesterol and HDL cholesterol

The study of the adverse effects of chemicals on health is pharmacology pharmacodynamics pharmacokinetics toxicology

toxicology

Board Review Question: In centrifugal analyzers, centrifugal force is used to add reagents to the rotor transfer liquids from inner disc to outer cuvette measure changes in optical density in the centrifugal force field counteract the tendency of precipitates to settle int he cuvette

transfer liquids from inner disc to outer cuvette

Board Review Question: Total iron=binding capacity measures the serum iron transporting capacity of hemoglobin ferritin ceruloplasmin transferrin

transferrin

Which one of these is a primary function of proteins in our body? energy source energy storage digestion transport

transport

Board Review Question: Blood was collected in a serum separator tube from a patient who had been fasting since midnight. The time of collection was 7 am. The laboratory test that should be recollected is: LD iron sodium triglycerides

triglycerides

Board Review Question: Which of the following lipid results would be expected to be falsely elevated on a serum specimen from a nonfasting patient? cholesterol triglycerides LDL HDL

triglycerides

Phospholipids are _____________ with an additional group.

triglycerides

A ____ level is drawn before the antibiotic dose is administered and a ____ level is drawn soon after it has done infusing.

trough, peak

Analysis of variance (ANOVA) is an appropriate statistics to evaluate three or more sets of data among each other. True False

true

True or false? Random analytical error can be in any direction and indicates imprecision. True False

true

calcium is present in the bones as hydroxyapatite. True False

true

Acid-base balance homeostasis occurs during: glomerular filtration tubular reabsorption tubular secretion all of the above

tubular secretion

Board Review Question: The first step to be taken when attempting to repair a piece of electronic equipment is turn the instrument off check all the electronic connections replace all the fuses reseat all the circuit boards

turn the instrument off

Which hypersensitivity reaction is an anaphylactic reaction a to bee sting? type 1 type 2 type 3 type 4

type 1

Which hypersensitivity reaction is a transfusion reaction? type 1 type 2 type 3 type 4

type 2

Which hypersensitivity reaction happens in rheumatoid arthritis? type 1 type 2 type 3 type 4

type 3

Which hypersensitivity reaction is poison ivy dermatitis? type 1 type 2 type 3 type 4

type 4

Board Review Question: The principal excretory form of nitrogen is creatinine amino acids uric acid urea

urea

Board Review Question: The principal excretory form of nitrogen is urea creatinine uric acid amino acids

urea

Board Review Question: Which of the following represents the end product of purine metabolism in humans? DNA and RNA allantoin AMP and GMP uric acid

uric acid

__________________ is produced in the liver fron xanthine ammonia creatinine urea uric acid

uric acid

Board Review Question: The degree to which the kidney concentrates the glomerular filtrate can be determined by urine to serum osmolality ratio serum creatinine urine creatinine creatinine clearance

urine to serum osmolality ratio

Board Review Question: What substance gives feces its normal color? urobilin urochrome uroeryhtrin urobilinogen

urobilin

Board Review Question: Maple syrup urine disease is characterized by an increase in which of the following urinary amino acids? valine, leucine, and isoleucine cystine and cysteine tyrosine phenylalanine

valine, leucine, and isoleucine

Board Review Question: The urinary excretion product measured as an indicator of epinephrine production is: vanillylmandelic acid dihydrophenylalanine (DOPA) homovanillic acid dopamine

vanillylmandelic acid

Board Review Question: Antibody class and antibody subclass are determined by major physiochemical differences and antigenic variation found primarily in the constant region of heavy and light chains constant region of heavy chain variable region of heavy and light chains constant region of light chain

variable region of heavy and light chains

What is the effect of angiotensin II? vasoconstriction vasodilation increase in heart rate decrease heart rate

vasoconstriction

D-dimer is a product of thrombosis. A normal d-dimer test rules out venous thrombosis. myocardial infarction. stroke. pulmonary hypertension.

venous thrombosis.

Laboratories and instrument manufacturers who measure hCG levels after the first 8 weeks must be cautious because very high levels can produce a falsely low result due to the hook effect. very low levels are inaccurate at this stage. very high levels can precipitate and damage instrument probes. very high levels can indicate the presence of an ectopic pregnancy.

very high levels can produce a falsely low result due to the hook effect.

Board Review Question: Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) are both elevated in which of the following diseases? pulmonary emboli muscular dystrophy infectious mononucleosis viral hepatitis

viral hepatitis

Board Review Question: Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) are both elevated in which of the following diseases? viral hepatitis infectious mononucleosis muscular dystrophy pulmonary emboli

viral hepatitis

Coumadin (warfarin) acts on _________ to inhibit coagulation. vitamin D vitamin K niacin vitamin A

vitamin K

Board Review Question: A lipemic serum is separated and frozen at -20C for assay at a later date. One week later, prior to performing the assay for triglycerides, the specimen should be discarded and a new specimen obtained warmed to 37C and mixed thoroughly warmed to 15C and centrifuged transferred to a glycerated test tube

warmed to 37C and mixed thoroughly

The intracellular fluid compartment is made of all the water: around the cells within the cells in the plasma in the kidneys

within the cells

Which of the following terms is associated with the following description? A combination of a specimen manager with instruments or consolidated instruments of chemistry and immunoassay reagents that provide a broad spectrum of analytical tests. Workcell Workstation Point-of-care station Outpatient clinic

workcell

Which of the following functions as a chain-breaking antioxidant and is a pyroxyl radical scavenger that protects LDL and polyunsaturated fats in membranes from oxidation? Vitamin D α-tocopherol Thiamin Menaquinone

α-tocopherol

A decrease in this protein will result in an emphysema-like condition. α1-antitrypsin. α2-macroglobulin. β-lipoprotein. Hemopexin.

α1-antitrypsin.

A protein that is increased or normal in nephrotic syndrome is: α1-antitrypsin. α2-macroglobulin. Albumin. Hemopexin.

α2-macroglobulin.

___________ is not considered a date rape drug. Chloral hydrate Rohypnol β-hydroxybutyrate Alcohol

β-hydroxybutyrate

Which liver marker is the most sensitive for alcoholism? Alanine aminotransferase Aspartate aminotransferase Bilirubin, total γ-glutamyl transferase

γ-glutamyl transferase