Final

What percentage of cancer cases are thought to be associated with inherited mutations that predispose individuals to cancer?

5-10%

Repetitive DNA sequences account for approximately what proportion of the human genome?

50%

What are the approximate rates of cancer that develop in people carrying a mutation of one of these genes?

For mutations in MSH2MSH2, the lifetime risk of developing some type of cancer was 91% for males and 69% females.

Which kingdom does Fusarium redolens belong to?

Fungi

Suppose you have identified a yeast mutant in which transcription of the galactose utilization pathway genes is constitutive (transcription occurs even in the absence of galactose). What gene is likely mutated?

GAL80

Enter the complete DNA sequence, which should contain 24 bases.

GATGACATGGCGTCAGTCGATGCG

What is the consensus sequence from Part B that has coverage included on at least 3 of the 5 DNA fragments (3x coverage)?

GGCCATC

In yeast, which protein is bound to the UASG in the galactose utilization pathway?

Gal4

Which of the following regulatory components would be classified as trans-acting?

General transcription factors (GTFs)

What general role does acetylation of histone protein amino acids play in the transcription of eukaryotic genes?

Histone acetylation events are most often associated with transcription activation.

One group of Su(var) mutations are caused by a loss of HP-1, a protein found in constitutive heterochromatin. Another group of Su(var) mutations affect genes encoding which enzymes?

Histone methyltransferases (HMTs)

Which of the following organisms would have the LOWEST predicted gene density (number of genes per megabase of DNA) in genomic DNA?

Homo sapiens (human)

If you create a mutant that expressed Gal3 constitutively, what phenotype would you expect to see?

Transcription in the presence or absence of galactose.

Which complex is recruited to the cis-acting regulatory sequences of Hox genes to acetylate histones?

TrxG

How to differentiate between proto-oncogene and tumor suppressor gene? Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

Tumor suppressor genes normally function to inhibit or limit cell proliferation, whereas proto-oncogenes normally function to inhibit or limit cell proliferation.

Which of the following components is a cis-acting regulatory element in yeast?

UASG

Using this knowledge, how would you screen for Drosophila mutants that have an impaired circadian rhythm? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms can be used once, more than once, or not at all.

Using eclosion at times other than dawn as the mutant phenotype, it is possible to conduct an F3 screen for recessive mutations that affect the time pupae eclose. Male flies homozygous for dark body (db) are fed EMS to induce mutations and then mated to females heterozygous for a balancer chromosome 3 containing the db allele and the dominant marker, CyO, which causes curly wings. Individual F1 males that have curly wings and dark bodies are selected and mated back to a female from the chromosome 3 balancer strain to create many independent F2 lines. F2 progeny with curly wings and dark bodies will be heterozygous for the new mutations. Interbreeding the F2 will create many independent F3 populations. If the F2 were heterozygous for a circadian rhythm mutation, about one-third of the progeny would eclose at times other than dawn.

How does the Xist RNA facilitate the formation of a Barr body?

Xist RNA coats the inactive X chromosome, attracting HMTs to deacetylate and methylate histones H3 and H4.

Can a tumor arise from a single mutated cell? Are all the cells in a tumor identical?

Yes, a tumor can arise from a single, mutated cell, and it typically contains cells that are genetically heterogeneous

Do you think it is possible that significant increases in the incidence of other types of cancer will occur in the future among people who were exposed to the Fukushima radiation? Why?

Yes, it is possible, because radiation causes DNA damages in most/all cell types.

Shotgun sequencing requires all of the following except?

a genetic map

Label the sequences in the eukaryotic gene below that could be used by a computer program to identify a gene

a. transcription regulatory sequences b. promoter c. start codon d. splice sites e. stop codon f. transcription termination

How are all codons in mitochondrial transcripts accommodated by only 22 tRNAs?

by allowing more flexibility for base pairing in the third position of codons

The Plasmodium mitochondrial genome does not encode any tRNAs; how are genes of the Plasmodium mitochondrial genome translated?

by using nuclear-encoded tRNAs, which are imported from the cytosol

A researcher measures the quantity of cDNA that corresponds to the exons of a particular gene in mice using RNA-seq. They find that RNA for this gene isolated from the brain contains 4 exons, while RNA from the liver heart and skin contains 5 exons. What phenomenon likely explains this result?

cells of the brain splice this mRNA differently than other cells in the mouse

Select the organelles involved in organelle heredity. Select all that apply.

chloroplast, mitochondria

Plastids can differentiate into ________ that carry out photosynthesis.

chloroplasts

Which type of sequencing involves first creating a physical map?

clone-by-clone sequencing

In general, which part of a coding gene shows the most evolutionary conservation?

coding sequences

A genome sequence is considered to be complete when all its ________ are included, as well as reasonable amounts of repetitive sequences

euchromatic sequences

Dicer

is the enzyme complex that is active in RNAi, where it cuts double-stranded regulatory RNAs into 21-bp to 26-bp segments that are subsequently denatured by RISC

RISC

is the protein complex that is part of the RNA interference (RNAi) mechanism. It denatures short double-stranded RNAs to single strands that carry out RNAi.

The movement of genes from one species into the genome of another is referred to as _____.

lateral gene transfer

Previously unidentifiable microorganisms have now been identified through ________.

metagenomics

Sequencing of DNA from a community of organisms rather than from a single individual is known as ________.

metagenomics

The term ________ refers to cells that are not confined in their growth and invade normal tissues.

metastasis

What is the name of the area of the organelle in which organelle DNA is packaged?

nucleoid

The BLAST program from NIH enables a researcher to look for homologous genes. It does so in general by searching for identity in what?

nucleotide sequence

Interspecific (between species) genome studies show us conserved sequences, but intraspecific (within species) comparisons identify what? Interspecific (between species) genome studies show us conserved sequences, but intraspecific (within species) comparisons identify what?

polymorphisms

The feature of DNA fragment preparation that ensures fragment end overlap is _______.

random breakage of genomic DNA by physical shearing

Epigenetics

refers to heritable states of chromatin structure

Conserved noncoding sequences (CNGs) are usually sequences involved in what kinds of functions?

regulation

Open promoters are ________.

transcriptionally active, with nucleosomes displaced

The set of transcripts present in a cell or organism is called the ________.

transcriptome

As an approach to understanding the function of a certain funfun gene, you wish to create a loss-of-function allele. How will you accomplish this?

transformation and homologous recombination

You wish to know the physical location of the encoded protein product. How will you ascertain such information?

translational fusion with GFPGFP gene

In both cases, how would you clone the genes you identified by mutation?

using positional cloning

Mammalian genomes all have a number of genes for globin polypeptides. Several of these genes are functional, but several are never expressed. What are the nonfunctional ones known as?

pseudogenes

Which of the following best describes the role of chaperone proteins in the regulation of gene expression by steroid hormones?

Chaperone proteins maintain functionality of the receptor.

Which of the following regulatory components is a large protein complex that directs DNA bending into a loop to encourage transcription?

Enhanceosome

Explanation from the observation that ME1 expression appears to turn on and off at various times during normal mouse development?

Expression of ME1 is regulated by an enhancer and a silencer, which can be regulated such that ME1 expression is activated at some developmental stages and then repressed at others.

Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTRCFTR gene? Select the three correct answers.

- Consider genes that code membrane proteins. - Consider genes that code secretory pathway proteins - Consider genes that are expressed only in epithelial tissues.

Which statements about the regulation of transcription initiation in these genes are true? (Regulation of transcription initiation)

- Control elements C, D, and E are distal control elements for the imaginin gene. - The fantasin gene will be transcribed at a high level when activators specific for control elements A, B, and C are present in the cell. - Both the fantasin gene and the imaginin gene will be transcribed at high levels when activators specific for control elements A, B, C, D, and E are present in the cell.

What differences and similarities might you expect to see in the annotation of the sequences - for example, in number of genes, gene structure, regulatory sequences, repetitive DNA? Check all that apply.

- Genes in the Gorilla gorilla sequence will be separated by large intergenic DNA sequence - Genes in the Bacillus anthracis sequence will not have introns. - The Gorilla gorilla sequence will lack operons. - The Bacillus anthracis sequence will contain more annotated genes than the Gorilla gorilla sequence.

Based on the inheritance patterns shown in this pedigree, select all of the true statements in the following list.

- Individual I-3 did not contribute his Y chromosomal DNA to the most recent generation. - Individual I-4 did not contribute her mtDNA to the most recent generation.

There are two types of Lynch syndrome, what are they?

- Lynch syndrome I (hereditary nonpolyposis colorectal cancer) - Lynch syndrome II (noncolonic cancer of stomach endomentrium, biliary and pancreatic systems)

What genes are most commonly mutated in Lynch syndrome?

- MLH1 gene - MSH2 gene

Choose the normal functions of the protein products of these genes. Select all that apply.

- MSH1MSH1 codes for a protein that is part of a complex of proteins that repairs the DNADNA in the region identified by MSH2 - MSH2MSH2 codes for a protein that identifies regions of DNADNA that contain mistakes in DNADNA replication by binding to DNADNA that contains mismatched base pairs.

Which statements about the modification of chromatin structure in Eukaryotes are true? (Modification of Chromatin Structure)

- Methylation of histone tails in chromatin can promote condensation of chromatin. - Acetylation of histone tails in chromatin allows access to DNA for transcription. - Acetylation of histone tails is a reversible process. - DNA is not transcribed when chromatin is packaged tightly in a condensed form. - Some form of chromatin modification can be passed on to future generations of cells.

List examples illustrating the phenomenon of epigenetics:

- Prader-Willi syndrome - Angelman syndrome

How can you prove that your chosen candidate is the CFTRCFTR gene? Select the three correct answers.

- Show that parents of people with cystic fibrosis are both heterozygous for mutant variants of the gene. - Search for polymorphism of the gene between normal people and people with cystic fibrosis. - Show that people with cystic fibrosis are homozygous for mutant variants of the gene.

Sometimes, a mother who is affected with a mitochondrial disease will have an unaffected child. Which of the following could explain this observation? Select all that apply.

- The mitochondrial disease may have a variable age of onset, and asymptomatic children may develop the condition later in lif - The affected mother could be heteroplasmic. - The phenotype could be affected by nuclear genes, which could differ among children.

Other than the genus and species information, what characteristics do most of the top hit sequences share? Select the two best answers.

- They contain a sequence of an internal transcribed spacer (ITS). - They contain a ribosomal RNA (rRNA) sequence.

Some of the following statements are true for chloroplasts; others are true for mitochondria. Which statements are true for chloroplasts? Select the three that apply.

- They contain the green pigment chlorophyll. - They have membranous sacs called thylakoids that are surrounded by a fluid called stroma. - They are the sites of reactions that convert solar energy into chemical energy.

A genetic network can be determined by identifying genes that show synthetic lethality.Yeast strains were identified with the mutations listed below. Select the strain(s) that alone would not show a lethal phenotype. Select all that apply.

- a null mutation in a nonessential gene - a conditional mutation in an essential gene

In addition to inheriting a BRCA1BRCA1 mutation, what else must happen for a woman to develop breast or ovarian cancer?

- environmental factors - mutations in tumor suppressor genes - mutations in proto-oncogenes

Enhancer sequence is likely to be:

- located upstream of the gene it controls - located downstream of the gene it controls - located either nearby or at great distance from the gene it controls - orientation independent

Compare and contrast promoters and enhancers with respect to their location (upstream versus downstream), orientation, and distance (in base pairs) relative to a gene they regulate. Promoter sequence is likely to be:

- located upstream of the gene it controls - located within a few dozens nucleotides of the gene it controls - orientation dependent

Several isolated haploid petite mutants and wild-type cells were mated with each other on complete media to form diploid cells. The diploid cells were then starved so they would go through meiosis and form haploid spores. The spores were grown on minimal media plates that contained glycerol as the only carbon source (so no fermentation could occur). Which of the following crosses would be able to produce haploid spores that could grow on the minimal media plus glycerol plates? Select all that apply.

- segregational petite x wild type - segregational petite x neutral petite - neutral petite x wild type

Which of the following methods could be used to ensure that sequencing data is correct? Select all that apply.

- sequence the genome multiple times and compare the reads from each sequence. - Sequence the complementary DNA strands at the same time and use base pairing to check the sequ

A synthetic lethal interaction is one in which two yeast stains with non-lethal phenotypes are crossed and the resulting double mutant is lethal.Of these yeast strains, what are all the possible combinations that could be crossed to look for synthetic lethal interactions? Strain A: a null mutation in a nonessential gene Strain B: a null mutation in an essential gene Strain C: a conditional mutation in an essential gene Select all that apply.

- strain A x strain A - strain C x strain C - strain A x strain C

Choose the correct possible biological causes for the difference in expression patterns of the two transgenes. Select the three correct answers.

-Expression of the gene is controlled post-translationally. - Expression of the gene is controlled translationally. - Expression of the gene is controlled post-transcriptionally.

Select the approaches you might take to examine the temporal and spatial expression pattern at the cellular level. Select the three correct answers.

-in situ hybridization -fusion with GFP gene -fusion with lacZ gene

Drag the colors on the left to the appropriate blanks on the right. Colors can be used once, more than once, or not at all.

1. A spot containing a gene that is overexpressed in cancer cells: red 2. A spot containing a housekeeping gene that is expressed equally in both cell types: yellow 3. A spot containing the p24 gene, which is present and expressed in normal cells, but absent in cancer cells: green 4. A spot containing the p90 gene, which is normally repressed by the p24 gene: red

Identify the type of genomics employed in each of the examples below. Terms may be used more than once.

1. DNA that represented approximately 1800 different genomes was isolated from the Sargasso Sea. metagenomics 2. This method was used to identify members of the human hemoglobin gene family. The members of this gene family descended from a single ancestral gene. evolutionary genomics 3. Genes were identified in a novel bacteriophage genome using bioinformatics programs that use algorithms to look for common features of open reading frames. structural genomics 4. Genomes of several species of bacteria were compared to identify common organization of genes. evolutionary genomics 5. A sample of contaminated ground water was sequenced to identify the species diversity and relative abundance of bacteria in the sample. metagenomics 6. A protein domain in a protein with unknown function was identified as an ion channel. functional genomics

Part C - CRISPR-Cas9: Focus on DNA Interference

1. From the CRISPR array in the bacterial genome, crRNA is transcribed and processed to help direct the Cas protein to the target DNA. 2. Cas9 is an endonuclease, encoded by cas genes in the bacterial genome, that cleaves invasive viral DNA. 3. Cas9 associates with crRNA and tracrRNA, forming a complex that is capable of targeting and cleaving viral DNA with a specific sequence. 4. Cas9 proteins consist of two signature nuclease domains that cleave the phage DNA: HNH cleaves the strand that is complementary to the crRNA, and RuvC cleaves the strand that is not. 5. Cas9 employs a strategy to distinguish the bacterium's own DNA from invasive viral DNA, and will not cleave DNA lacking a PAM sequence.

The CRISPR-Cas defense system in bacteria is described as DNA-encoded because a specific locus in the bacterial genome encodes the RNA that helps carry out cell defense against pathogens.

1. In the CRISPR array, repeats are multiple short sequences that all have the same sequence. 2. The spacers are variable sequences derived from invading phage DNA. 3. The cas genes encode proteins involved in several functional roles such as spacer acquisition, crRNA biogenesis, and interference. 4. New spacers derived from invading phage DNA are inserted in the CRISPR array by Cas proteins. 5. The spacers are the molecular memory of previous phage attacks, enabling this immune system to be adaptive.

Drag the terms on the left to the blanks on the right to complete these sentences about the microarray procedure. Not all terms will be used.

1. Isolate mRNA from both the normal cells and the cancer cells. 2. Use the enzyme reverse transcriptase and fluorescently labeled nucleotides to make cDNA from the starting material isolated in Step 1. 3. Denature the fluorescently labeled molecule created in Step 2, and incubate it with the microarray. The fluorescently labeled molecules from the two different cell types will hybridize to single-stranded DNA on the microarray. 4. Wash and then scan the microarray to measure the fluorescence at each spot on the array.

Which of the following lists has the steps involved in the whole genome shotgun approach to Sequencing in the correct order?

1. Isolation and shearing of genomic DNA2. Insertion of genomic fragments into cloning vector3. Transformation of E. coli with cloning vector4. Sequencing of cloned fragment ends5. Sequence assembly

Drag the labels to their appropriate locations on the flowchart. Only some labels will be used.

1. Multiple copies of the same chromosome are prepared2. Chromosome copies are broken into 1-kb fragments.3. 1-kb fragments are cloned into plasmids4. The plasmids are sequenced.5. A computer combines the fragment sequences.

Below are several examples of gene duplication events. Choose the term that best describes each example.

1. The beta-globin gene has sequence similarity to the other genes in the beta globin family, but it lacks a start codon. pseudogene 2. Hemoglobin consists of an alpha chain and a beta chain, each produced by a different but similar gene. Neither gene alone can make a functional hemoglobin molecule. subfunctionalization 3. A duplicated gene in mosquitos accumulated mutations that allow it to break down a chemical found in a common pesticide. neofunctionalization 4. In most vertebrates, the pax transcription factor acts during development in the eye and brain. In zebra fish, each tissue has a different but similar transcription factor (paxA and paxB) and both transcription factors are necessary for normal development. subfunctionalization 5. The olfactory receptor gene family in humans contains 16 genes. Six of these genes contain mutations such that the genes do not encode functioning proteins. pseudogene

Drag the correct answer to the blank after each question. Labels can be used once, more than once, or not at all.

1. Which group of genes showed increased expression in the cancer cells after the addition of the drug? Group C 2. Which group of genes showed repressed expression in the cancer cells after the addition of the drug? Group D 3. Which group of genes returned to baseline levels of expression in the cancer cells by the end of the experiment? Group A 4. Which group of genes remained highly expressed in the cancer cells throughout the experiment? Group C

In how many positions are there nucleotide differences between your query sequence and the sequence of accession AY259214.1?

10

Based on genomic analysis, the human genome is thought to include approximately how many protein-coding genes?

20,000

If this sequence contains one gene, which frame is most likely the correct reading frame for this gene? (Remember that Met represents a potential start codon and Stop represents a stop codon.)

5'- 3' direction, Frame 3A E Met R D G G A F S G P L L L E T P G P E P G Q Q E P L V F G S G D T V E L T C P S P I D S P T G P S I W V K D G V G L V P S D R I L V G P R R L Q V L N A S H E D A G T Y S C R Q R L T Q R I L C H F S V Stop

Where is the enhanced sequence located?

6

How many possible open reading frames can a bioinformatics program translate from one DNA sequence? Enter your answer numerically (for example: 2).

6.00

Where is the silencer located?

9

Which of the following statements is true of a heteroplasmic gene?

A heteroplasmic gene is found in multiple allelic forms in DNA molecules that make up the genomes of organelles in the cells of an organism.

Which statement best describes the results shown in the Descriptions section?

A hit derived from Fusarium redolens is the best match to the query sequence.

What is most likely molecular abnormality causing disease allele?

A pre-mRNA spicing mutation causes a deletion of exon 3.

Yeast are actively growing in the presence of both glucose and galactose. What would you expect to observe at the transcriptional level?

A repressor complex bound to the silencer between the UASG and GAL1.

Consider the predominant types of alternative splicing events that occur in mammals. Which of the following choices represent mRNA molecules that could be produced from the primary RNA transcript by alternative RNA splicing? (in each choice, the yellow part on the left represents the 5' cap, and the yellow part on the right represents the poly-A tail.) --Alternative RNA splicing

ACGI, ACEI, ACEGI

In a simple bioinformatics exercise, students are asked to locate the beginning of an ORF among the six possible reading frames for a hypothetical DNA molecule. The first step in their process should involve looking for what sequence?

ATG

In which section of the search results can you find nucleotide-by-nucleotide comparisons between your query sequence and similar database sequences?

Alignments

Sigma virus infection in Drosophila melanogaster causes flies to become paralyzed and then die in high concentrations of CO2. The virus is passed on extrachromosomally. Two isogenic strains of Drosophila cultures are maintained: R (resistant to CO2 or wild type) and S (susceptible to CO2, infected with sigma). After crosses between male R and female S flies, subsets of offspring of each sex are tested for CO2 sensitivity. Which of the following results do you expect?

All the offspring are sensitive.

What type of genomic imprinting would you predict to observe on maternal chromosome 11?

An enhancer drives expression of H19, while an insulator bound to the ICR blocks expression of IGF2.

What protein binds to heterochromatic DNA to initiate the transition to euchromatin?

Pioneer transcription factors

Which of the genes circled in red is most likely to be an essential gene?

BIM1

Describe the difference between a benign tumor and a malignant tumor. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.

Benign tumors are composed of pre-cancerous cells that are growing excessively and are contained within their tissue. Malignant tumors are composed of cancer cells whose growth is extensive and highly disorganized. Cells of this type of tumors have the potential to metastasize, escaping their tissue and spreading to other locations within the body.

Define the "two-hit hypothesis" for retinoblastoma. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.

Both copies of one gene must be mutated in order for retinoblastoma to develop. This hypothesis was based on the finding that hereditary retinoblastoma always affected both eyes, whereas sporadic retinoblastoma only affected one eye.

Place the fragments of DNA in the proper places to form the contig for this sequence of DNA, using the central CAT sequence as a guide.

CCAGGCC CCATCGA GGCCATC cat AGGCCAT CATCGAG

Which of the following characteristics is NOT one of the four general ways in which cancer cells differ from normal cells?

Cancer cells are highly organized.

In certain Latin American countries during periods of political volatility, children were removed from their families and their parents were executed (then referred to as being "disappeared"). The methods with the best chance of reuniting those children with members of their extended family have used mtDNA matching. Why and how?

Children's mitochondria will have genomes that are identical to those of their maternal grandmothers.

What is the name given to regions of chromatin that is always densely compacted and transcriptionally inert?

Constitutive heterochromatin

Many eukaryotic genes exhibit transcriptional regulation in either an inducible, developmental, or cell-specific manner. Which of the following gene features would you expect to see in a gene whose transcription is being tightly regulated?

Covered promoter

A new gene was identified that has a synthetic lethal relationship with RAD27 (circled in blue on the genetic network map in Part C). Scientists would like to determine the molecular function of this gene. In which process would you predict this new gene plays a role?

DNA synthesis and repair

If a cell is unable to process pri-miRNA to produce miRNA, what gene is likely mutated?

Drosha

The activity of which of the following proteins is directly regulated by the pRB protein product of the RB1 gene?

E2F

Which of the following experimental questions is least suited to testing through microarray analysis?

How does the number of genes in the human genome compare to the number of genes in the chimpanzee genome?

How does the alignment of the FN397219.1 sequence to your query sequence compare to the alignment of the AY259214.1 sequence you examined in Part F?

In the FN397219.1 alignment, there are the same number of nucleotide differences but more gaps.

What advice would you give individual III-2?

It is likely that all children will have the trait and be affected with this disorder, depending on the penetrance of the trait.

What advice would you give individual III-6?

It is likely that all children will have the trait and be affected with this disorder, depending on the penetrance of the trait.

The human egg has about 2000 mitochondrial genomes, but somatic cells have a range of hundreds to thousands. Which of the following is most likely to account for the difference?

Large mitochondria in oocytes can divide into many smaller mitochondria, and smaller mitochondria can replicate their DNA.

What are the specialized enhancer elements that regulate transcription of multiple genes packaged in complexes of related genes in eukaryotes?

Locus control regions (LCRs)

What is the name of the enhanceosome that forms when Gal4 binds to the UASG?

Mediator

Which of the following products are always encoded by the mitochondrial genome

Mitochondrial rRNAs

Which of the following statements best describes what you would expect to see in a Su(var) mutation?

Most cells show active w+ transcription, so the eyes are red.

What is the acetylase protein found upstream of the promoter at the UASp1 element in the PHO5 gene of yeast?

NuA4

Can you say with certainty that a woman inheriting a mutation of BRCA1BRCA1 will definitely develop breast cancer in her lifetime? Why or why not?

One cannot conclude with certainty that a woman with a BRCA1BRCA1 mutation will get breast cancer. Only 60% of women with certain BRCA1BRCA1 mutations are expected to develop breast cancer by age 70.

What is the function of a "pioneer factor"?

Pioneer factors are the first to bind regulatory regions of the DNA.

What is the genotype of a normal cell in the retina in a person who has sporadic retinoblastoma?

RB1+RB1+

What is the normal cell genotype if the person has hereditary retinoblastoma?

RB1+RB1+ RB1−

Using RB1+RB1+ for the normal wild-type allele and RB1−RB1− for the mutant allele, identify the genotype of a cell in a retinoblastoma tumor.

RB1−RB1−

What name is given to the alteration of an RNA sequence after transcription?

RNA editing

What type of chromosomal rearrangement generates the c-ABL-BCR "fusion gene"?

Reciprocal translocation

Which chromatin remodeler complex both slides and relocates nucleosomes to expose promoters or regulatory sequences?

SWI/SNF complex

In most plants, such as Arabidopsis, genes whose encoded products have roles related to photosynthesis have expression patterns that vary in a circadian manner. Using this knowledge, how would you screen for Arabidopsis mutants that have an impaired circadian rhythm?

Seed from wild-type plants would be treated with a mutagen, allowed to develop and self-fertilize, and the progeny collected and screened for gene expression profile defects.

In eukaryotes, where do transcriptional repressor proteins bind?

Silencers

Did you find any sequences in the human genome that were statistically similar to your query sequence?

Similar sequences were found only with the blastn (lower similarity) search.

In studies of human families with polydactyly, which type of mutation has been identified?

Single base substitutions in the SHH enhancer

Which of the following best describes the mechanism by which steroid hormones control gene expression?

Steroid hormones that enter the cell activate receptors. These hormone-receptor complexes then bind HREs and influence gene expression.

Which of the following functions is NOT associated with the TP53 protein?

Stimulating angiogenesis

Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms can be used once, more than once, or not at all.

Symbiodinium minutum is a free-living organism, whereas Plasmodium falciparum is an obligate parasite. The difference in their genome complexity is likely due to their different lifestyles, since an obligate parasiteundergoes genome contraction relative to related, a free-living organism.

The conserved order of consecutive genes along a chromosome segment in different species is called __________.

Synteny

What gene discussed in this chapter might be responsible for pausing the cell cycle of dividing cells long enough for radiation-induced damage to be repaired in cells?

TP53 gene

How do the E values change as you go from the top of the list of hits to the bottom?

The E value get larger.

Identify the normal functions of the following genes whose mutations are associated with the development of cancer. Drag the terms on the left to the appropriate blanks on the right to complete the sentences.

The RB1RB1 The R B 1 gene encodes R B 1 (binds to and inhibits E2F, which is a transcription factor that promotes the G 1 to S cell cycle transition). gene encodes pRB The R B 1 gene encodes R B 1 (binds to and inhibits E2F, which is a transcription factor that promotes the G 1 to S cell cycle transition). (binds to and inhibits E2F, which is a transcription factor that promotes the G1G1 to SS cell cycle transition). The TP53TP53 The T P 53 gene codes for T P 53 protein (a cell cycle checkpoint regulator that prevents cell cycle progression in the presence of D N A damage). gene codes for p53 The T P 53 gene codes for T P 53 protein (a cell cycle checkpoint regulator that prevents cell cycle progression in the presence of D N A damage). protein (a cell cycle checkpoint regulator that prevents cell cycle progression in the presence of DNADNA damage). The c-MYCc-MYC The c - M Y C gene codes for a transcription factor whose expression promotes cell proliferation. gene codes for a transcription factor whose expression promotes cell proliferation. The APCAPC The A P C gene codes for the protein bearing the same name (limits the growth of epithelial cells that are in contact with other cells, which prevents hyperplasia and dysplasia in epithelial tissue). gene codes for the protein bearing the same name (limits the growth of epithelial cells that are in contact with other cells, which prevents hyperplasia and dysplasia in epithelial tissue).

Celiac disease (CD) is a common, usually inherited human disorder of intestinal inflammation that is triggered by eating gluten, a major protein in wheat and other cereal grains. It is the most frequent food intolerance. One of the three genes involved encodes SH2B3, a protein involved in innate, nonspecific immune response to bacterial pathogens. Celiac sufferers frequently have a particular allele of this gene, an allele so common in the human population that which of the following might be hypothesized?

The allele must have been positively selected for during a period of especially frequent bacterial infections.

What does the information in the table above indicate about interbreeding between humans, Neanderthals, and Denisovans? Select all of the true statements in the following list.

The autosomal DNA evidence supports the hypothesis that the ancestors of present-day Melanesians interbred with Neanderthals. - The autosomal DNA evidence supports the hypothesis that the ancestors of present-day Melanesians interbred with Denisovans - The autosomal DNA evidence supports the hypothesis that the ancestors of present-day Europeans interbred with Neanderth

Deletion of the Dicer gene would have what effect on a cell?

The cell would be unable to synthesize siRNA or miRNA.

A 50-year-old man has been diagnosed with MELAS syndrome. His wife is phenotypically normal, and there is no history of MELAS syndrome in either of their families. The couple is concerned about whether their children will develop the disease. As a genetic counselor, what will you tell them?

The children won't develop the disorder.

How does the rate of mutation in mammalian mitochondrial genomes compare to the rate of mutation in the nuclear genome?

The mitochondrial mutation rate is about 10 times greater than that of the nuclear genome.

The reason some cells respond to the presence of a steroid hormone while other do not is that_______.

The receptors necessary for regulation differ among cells of various types.

What is metagenomics?

The study of DNA sequences from entire natural communities that include a range of organisms

Which of the following is the most accurate comparison of the two yeast samples studied in the microarray analysis at the time of sporulation?

The two yeast samples share a common genome, but display differences in their transcriptomes.

Which of the following components of the strategy ensures that sequence reads are obtained from the ends of cloned fragments?

The use of primers that anneal to vector sequences near vector/cloned fragment boundaries

What are the different chromatin classifications, and what is their relationship to gene expression?

There are two classes of chromatin with respect to gene transcription: euchromatin and heterochromatin. The difference between them is that: euchromatin is less densely packed and is accessible to transcription proteins, whereas: heterochromatin is more tightly packed and less accessible. Moreover,: heterochromatin can be further divided into two types: constitutive heterochromatin and facultative heterochromatin. While: constitutive heterochromatin refers to chromosome regions that are always packaged as: heterochromatin, facultative heterochromatin refers to chromosome regions that can be packaged as: euchromatin or heterochromatin, depending on the environmental conditions, physiological conditions, or cell type.

Would your answer change if it were the mother who exhibited disease symptoms rather than the father?

There is a strong chance that the children will be affected irrespective of their sex.

What advice would you give individual III-1?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

What advice would you give individual III-4?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

What advice would you give individual III-8?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

What advice would you give individual III-9?

There is no chance that children will have the trait if this individual mates with a person without the disorder allele.

In their normal state, what is the primary function of the protein products of the BRCA1 and BRCA2 genes?

They detect and repair DNA damage.

How will you show that the fusion protein retains its normal biological function? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used.

This gene fusion could be introduced into a strain that is homozygous for a loss-of-function mutation of this gene to create a transgenic organism in which the only copy of the gene in question is the gene fusion. If the transgenic strain has the wild-type phenotype, then the gene fusion is functional. If the transgenic strain has the mutant phenotype, then the gene fusion is nonfunctional. If the transgenic strain has an intermediate phenotype, then the gene fusion has partial function.

An inherited human disorder, familial dysautonomia, results from a nucleotide mutation in the gene IKAP that is expressed in the nervous system. The decreased IKAP protein leads to abnormal development, and the resulting disease is usually fatal by age 30. The nucleotide change alters splicing. If this change affects only the nervous system and not the immune system, in which the gene is also expressed, what feature must be found in this gene?

alternative splicing

The process of finding the location of genes and functional (e.g., regulatory) sequences and their functions within a genome sequence is called ________.

annotation

Chloroplast mRNAs are not 5'-capped or polyadenylated, making them more like RNAs of ________.

bacteria

Often, in the absence of experimental data, computerized algorithms are used to predict gene structures from large sequences. What is this approach known as?

bioinformatics

Groups of genes that are evolutionarily related are called ________.

gene families

Which of the following defines the essential gene set of an organism such as a species of yeast?

genes whose deletion alleles are lethal

A cell or organism in which all copies of the cytoplasmic organelle gene are the same is said to be ________.

homoplasmic

In Leber's disease (LHON), degeneration of the optic nerve results in blindness due to a defect in NADH dehydrogenase affecting electron transport. If this is due to a mutation in a mitochondrial gene, which combination of the following effects would you expect to see when doing a pedigree analysis of a family with LHON? i. variable expressivity ii. incomplete penetrance iii. progressive blindness over time iv. maternal inheritance v. diminished muscle mass

i, ii, iii, and iv only

Transcomplementation is a name sometimes given for a test to see whether a gene from one organism can "rescue" a loss-of-function mutant of a different organism with a homologous gene. To which of the following processes might this term apply?

introduction of a human WEE1 gene into a yeast culture with wee1- mutant yeast

Human genes often occupy a larger part of the chromosome compared to the homologous gene in yeast, yet the number of amino acids in more homologous human and yeast proteins are not very different. What structure explains this difference?

introns

Silencer

is a DNA sequence that binds regulatory proteins that inhibit transcription.

Enhancer

is a DNA sequence that binds regulatory proteins that interact with promoter-bound proteins to activate transcription.

Promoter

is a DNA sequence where RNA polymerase binds and begins the process of trancription.

In a microarray analysis used to compare sporulating and nonsporulating yeast, a spot that appears yellow at a given time point is associated with a gene that is _______.

is expressed roughly equally in both sporulating and nonsporulating yeast

In 2000, when then-President Clinton along with Francis Collins of the Human Genome Project and Craig Venter of Celera announced the completion of a "draft" of the human genome, the event did not, in fact, represent true completion because most of what types of sequences were not included?

repetitive sequences

When a cell divides, chloroplasts are randomly distributed. What is this called

replicative segregation

A researcher has produced groups of contigs that are linked via paired-end sequences, although these include some sequence gaps. What are these groups called?

scaffolds

If an entire genome is fragmented and then a large number of pieces are sequenced, the approach is known as the ________ approach.

shotgun

________ is a strategy that compiles genome sequence from many overlapping DNA sequences each corresponding to a random location in the target genome.

shotgun sequencing

In mammals, the number of mitochondria per cell is highly variable. Which of the following would have the largest number?

skeletal muscle cells

Species whose ancestors might once have been free living may now be present as parasites. Would their genomes now tend to be larger, smaller, or approximately the same size and complexity?

smaller

Why does the deletion D effectively eliminate transcription of lacZ?

the deletion removes the promoter

Give an example of a benign tumor that becomes a malignant tumor.

the progression from polyp to malignant colon cancer

In 1718, the tsar of Russia, his wife the tsarina, and their five children were presumably assassinated and buried in an unmarked grave. Later, several women came forward and claimed that they were in fact Anastasia, one of the daughters whose bones had not been found. More recently, forensic scientists have extracted DNA, including mtDNA, from the skeletal remains. Which of the following samples of mtDNA had to be analyzed to discern which, if any, of the claimants was Anastasia?

the tsarina and the claimants

Does this information indicate the presence of enhancer and/or silencer sequences in the ME1 upstream sequence?

yes