Final study guide

Compared to eukaryotes, prokaryotes are typically

10 - 100 times smaller

When full, the innermost electron shell of an atom contains _________ electrons, and the next shell contains ________electrons.

2; 8

Which strand listed below is the complementary strand to this DNA strand: 5' ATCTCTGG 3'

3' TAGAGACC 5'

If the [H+] is 0.01 M, the the pH is ________.

4

You have designed a new drug for treating antibiotic resistant skin infections. You apply 10 units of the drug dissolved in 1gram of a cream base to drug resistant skin lesions on five mice everyday for 3 days. You record the % of mice showing symptoms of healing after three days. What is the most appropriate choice of control for this experiment?

5 Mice treated with 1 gram of a cream base without drug everyday for 3 days

In translation, a template strand of RNA is read in the _______________ direction in order to direct synthesis of a polypeptide in the _______________ direction.

5' > 3'; N > C

The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. 5' CGAGCAUGCAAUCUAAUUAAUC 3'

5'CAU3' ; 5'UUG3' ; 5'AGA3'

Oxygen is an element found in ALL biological molecules. How many electrons does it have in its valence shell? ; How many covalent bonds can it form with other atoms?

6;2

A particular eukaryotic protein is 300 amino acids long. Which of the following could be the number of nucleotides in the gene that codes for the protein?

900

A picture of two bases is shown to you below where the squiggly lines represent covalent attachment to another part of the molecule. How many hydrogen bonds would connect these two bases [ Select ] ["1", "2", "4", "3", "0"] Therefore this must be a picture of [ Select ] ["RNA", "A:T", "G:C", "peptides"] The bonds in CH3 are [ Select ] ["non-polar covalent", "hydrogen bonds", "polar covalent", "ionic"] The C double-bonded to the O is [ Select ] ["polar covalent", "hydrogen bonded", "non-polar covalent", "ionic"] Be careful and use these Electronegativity values : H 2.2, C 2.5, N 3.04, O 3.4

Answer 1: 2 Answer 2: A:T Answer 3: non-polar covalent Answer 4: polar

Use the table below to answer the questions, also the genetic code is provided to assist you. Assume that this table is read from LEFT to RIGHT.

Answer 1: 2 Answer 2: N Answer 3: Ala Answer 4: 3'GAA5' Answer 5: 5'GUC3'

The cells shown above are NOT from the same organism. For each, the metaphase plate is vertical and spindles are not shown. Please identify the ploidy and stage of cell cycle for each. In cell a. the chromosomes are different sizes. This is [ Select ] ["diploid, metaphase of Meiosis II", "diploid, metaphase of Meiosis I", "haploid, metaphase of Mitosis", "haploid, metaphase of Meiosis II", "haploid, metaphase of Meiosis I"] . In cell b. the chromosomes are the same size. This is [ Select ] ["diploid, metaphase of Meiosis II", "haploid, metaphase of Meiosis I", "haploid, metaphase of Meiosis II", "diploid, metaphase of Mitosis", "diploid, metaphase of Meiosis I"] . In cell c. the chromosomes are the same size. This is diploid, metaphase of Meiosis I . Cell d. is [ Select ] ["diploid, metaphase of Mitosis", "diploid, metaphase of Meiosis II", "haploid, metaphase of Meiosis II", "diploid, metaphase of Meiosis I", "haploid, metaphase of Meiosis I"] . In cell e. there are two sizes of chromosomes. This is [ Select ] ["tetraploid, metaphase of Meiosis I", "diploid, metaphase of Meiosis II", "diploid, metaphase of Mitosis", "haploid, metaphase of Meiosis II", "diploid, metaphase of Meiosis I"]

Answer 1:haploid, metaphase of Meiosis II Answer 2:diploid, metaphase of Meiosis I Answer 3:diploid, metaphase of mitosis Answer 4:haploid, metaphase of Meiosis II Answer 5:diploid, metaphase of Meiosis I

Which reactant will lose electrons in this reaction? What is the resulting oxidized product?C6H12O6 + O2 → CO2 + H2O + ATP

C6H12O6... CO2

Which of the following molecules are hydrophilic? Select all that apply.

D, A

Genetic information is stored within the sequence of _________. This information is transcribed into a sequence of ________ which are then translated into a sequence of _______.

DNA bases, RNA bases, amino acids

Which of the following statements below correctly describe the role of the protein during DNA replication? Select all that apply

Helicase breaks the hydrogen bonds between the nitrogenous bases, DNA polymerase adds nucleotides on the newly synthesized strand

Which of these statements is incorrect concerning homologous chromosomes?

Homologous chromosomes have identical alleles before crossing over.

Which of the following happens by the end of meiosis I?

Homologous chromosomes of a pair are separated from each other.

Which of these bond types involve the attraction between full opposite charges?

Ionic

If a cell has completed meiosis I and is just beginning meiosis II, which of the following is an appropriate description of its contents?

It has half the amount of DNA as the cell that began meiosis.

Two semi-permeable membrane bags containing 40% glucose solution (bag A) and 20% glucose solution (bag B), respectively, are placed in a beaker containing 30% glucose. The bags are permeable to water, but not glucose. What will happen?

Only bag A will gain mass

In which of the four phases of the cell cycle do sister chromatids form?

S phase

Sister chromatids form during

S phase of interphase

A specific enzyme has glutamic acid as part of its active site. Which of these amino acid substitutions would be most likely to prevent the enzyme from catalyzing its appropriate reaction.

THE CORRECT ANSWER IS C, ALL OTHER AMINO ACIDS ARE POLAR. C IS NON-POLAR

The following statements list events that occur during translation, from initiation through termination. Arrange the order of events that occur during translation by numbering them 1 (the first event) to 6 (the last event to occur). Note, not all the events are listed. Each answer should be a number, e.g. "1", "2", etc.

The first aminoacyl tRNA holding (f-Met) complementary base pairs to the start codon AUG,The large ribosomal subunit binds to the small ribosomal subunit,A new aminoacyl tRNA binds to the codon in the A site,A peptide bond is formed between the new amino acid at the A site to the polypeptide at the P site,A stop codon enters the A site,A release factor enters the A site

For an atom that is not an ion, which statement must be true?

The number of electrons equals the number of protons.

What is osmosis?

The overall movement of water, through a partially permeable membrane, from a region of low solute concentration to a region of high solute concentration

If you made a big deletion of DNA in the promoter sequence of a gene, which of the following is likely to happen?

[?] DNA polymerase would no longer be able to bind and carry out transcription

Which of the following is true of an enzyme? An enzyme____ (select all that apply)

[?] acts as a biological catalyst, lowers the energy barrier for a chemical reaction

Sexual reproduction increases the genetic variability of a population more than does asexual reproduction because of

[?] crossing over

During which phase of mitosis do spindles have equal and opposite tension?

[?] metaphase

A sample of DNA contains 20% guanine. What percentage of uracil does it contain?

[?]20%

Put the statements relating to DNA replication and the cell cycle in the correct order.

[PARTIAL] 53241

Genes A and D are independent. Two individuals with the genotypes AaDd x aaDd are crossed. What is the probability of those two individuals having an offspring with the phenotype aD? [ Select ] ["3/8", "5/8", "3/4", "1/2", "1/16", "3/16", "1/8", "1/4"] What is the probability of those two individuals having an offspring with the genotype AaDD? [ Select ] ["3/8", "1/16", "3/4", "0", "none of these answers are correct", "1/2"] What is the probability of those two individuals having a male offspring with the phenotype Ad? [ Select ] ["1/4", "3/16", "1/2", "1/16", "1/8", "none of these answers are correct", "3/32"]

[PARTIAL] Answer 1:3/8 Answer 2:3/8 Answer 3:3/16

In the graph shown below, determine what the 4 lines marked A-D represent. The reaction without an enzyme is illustrated by line [ Select ] ["none of these answers are correct", "A", "D", "B", "C"] , while the normal enzymatic reaction is illustrated by line [ Select ] ["D", "A", "C", "none of these answers are correct", "B"] . The reaction in the presence of an inhibitor that does NOT bind the active site but inhibits indirectly (non-competitively) is shown as line [ Select ] ["none of these answers are correct", "B", "A", "C", "D"] . In contrast, the reaction in the presence of a competitive inhibitor that binds the active site is shown as line [ Select ] ["A", "D", "C", "B", "none of these answers are correct"] .

[PARTIAL] Answer 1:A Answer 2:D Answer 3:C Answer 4:C

All of these lines (thin, thick, wiggle and dashed) are covalent bonds. The sugar in the figure below is part of a nucleotide, use letters A-D to answer the questions below. 1.On the figure above, the phosphate group of that nucleotide would attach to the sugar next to which letter? [ Select ] ["B", "D", "C", "A"] 2. On the figure above, the nitrogenous base would attach to the sugar next to which letter? [ Select ] ["D", "C", "A", "B"] 3. Which letter represents where you will add on the nextnucleotide? [ Select ] ["A", "C", "B", "D"] 4. Which letter represents the extra hydroxyl group present in RNA? [ Select ] ["C", "A", "B", "D"]

[PARTIAL] Answer 1:D Answer 2:D Answer 3:D Answer 4:A

In fruit flies, brown body color (B) is dominant to black body color (b). You have an individual fruit fly with a brown body, but you do not know their genotype. To determine the genotype of the brown body fruit fly, you do a test cross. This means you cross the brown body fruit fly with [ Select ] ["a black body fruit fly", "another brown body fruit fly", "a Bb fruit fly"] . Before the test cross, you know that the brown body fruit fly has the genotype BB or Bb . The first offspring is brown-bodied. This result shows you that you still don't know the genotype of the brown-bodied parent . The second offspring is black-bodied. This result shows you [ Select ] ["that we still don't know the genotype of the brown-bodied parent", "that the black-bodied parent was bb", "that the brown-bodied parent was Bb", "that the brown-bodied parent was BB"] . The probability of the third offspring being brown-bodied is 1/2 .

[PARTIAL] Answer 1:a Bb fruit fly Answer 2:BB or Bb Answer 3:that you still don't know the genotype of the brown-bodied parent Answer 4:that the black-bodied parent was bb Answer 5:1/2

Pick the best term for each definition or example [ Select ] ["alleles", "haploid organisms", "phenotypes", "sister chromatids", "genotypes"] aabb or AaBb or aaBB. phenotype The observable product of a gene. [ Select ] ["alleles", "haploids", "phenotypes", "sister chromatids", "genotypes"] Versions of a gene that may differ by as little as a single nucleotide. [ Select ] ["homozygous recessive", "heterozygous", "homozygous dominant", "hybrid", "homozygous"] Both alleles are the same. [ Select ] ["zygotes", "homozygous", "heterosexual", "homologous", "heterozygous"] The two alleles are different. [ Select ] ["recessive", "incomplete dominance", "dominant", "heterozygous", "a lethal gene"] The trait that does not show in a carrier.

[PARTIAL] Answer 1:alleles Answer 2:phenotype Answer 3:alleles Answer 4:homozygous Answer 5:heterozygous Answer 6:recessive

The following is a segment of double-stranded DNA from the middle of a gene during transcription. The promoter sequence is off the page to the RIGHT. 3' . . .GGCTAAGCGTCACCACA. . .5' (Top strand) Promoter 5' . . .CCGATTCGCAGTGGTGT. . .3' (Bottom strand) Which DNA strand, the top or bottom, is the sense (nontemplate) strand ? bottom In addition to RNA polymerase, what else is bound to the promoter sequence that helps control gene expression? transcription factors

[PARTIAL] Answer 1:bottom Answer 2:transcription factors

DNA has bases on the [ Select ] ["exterior", "interior"] of the molecule, strands that are [ Select ] ["antiparallel", "parallel"] , and guanine almost always pairs with [ Select ] ["thymine", "adenine", "guanine", "cytosine"] by (a/n) [ Select ] ["covalent", "ionic", "hydrogen"] bond(s).

[PARTIAL] Answer 1:interior Answer 2:parallel Answer 3:cytosine Answer 4:hydrogen

Select each true statement below

[PARTIAL] a 1n egg cell arose from a diploid cell and the process was called meiosis, a 2n skin cell will undergo meiosis to become haploid, a 2n muscle cell will always be diploid

In cats, long canines (A) is dominant to short canines (a). Having a tabby (striped) fur pattern (T) is dominant to having a single fur color (t). These traits assort independently. A cat with long canines and tabby fur could have which of the following genotypes? (select all that apply)

[PARTIAL] aATT, AaTt, AT

This figure is from your worksheet #5. The solid black line represents the backbone of the protein. The bond connecting functional groups 1 and 2 is a peptide bond . Functional groups 1 and 2 are [ Select ] ["on the side chains of some amino acids.", "about to form a peptide bond.", "on the side chains of all amino acids."] . When the pH is basic, the concentration of H+ is [ Select ] ["high", "equal to [OH-]", "low"] and functional group(s) 1 and 2 will be uncharged. When the pH is acidic, functional group(s) [ Select ] ["2", "1 and 2", "1"] will be uncharged. The bond connecting functional groups 1 and 2 is most likely to occur when pH is [ Select ] ["close to neutral", "basic", "acidic"] .

[PARTIAL] answer 1: a peptide bond Answer 2:on the side chains of some amino acids. Answer 3:low Answer 4:1 and 2 Answer 5:1 and 2 Answer 6:basic

Viruses are infectious agents made up of a protein coat surrounding a nucleic acid core. They can be of various shapes and some even have a lipid membrane. Viruses are inactive and inert in the outside environment but can enter other cells. Inside a cell, a virus uses the cell's machinery to make its proteins and nucleic acid and to replicate its genome and make more viral particles. Inside a hijacked cell it can controls its functions. These replicated viruses then exit the infected host cell and infect other cells. Viruses also evolve over time. Which properties of LIFE CAN apply to VIRUSES? Select ALL that apply.

[PARTIAL] controls functions, can replicate, is evolving, stores and follows instructions, uses energy

There may be some things wrong with this image. On the left is supposed to be a G1 cell and on the right is supposed to be the same cell in G2. Select each answer that correctly identifies something wrong with this image.

[PARTIAL] ploidy should not change between G1 and G2, ...

What molecule is shown below? H3C, NH3, O, O

amino acid

Cyclin-dependent kinase (Cdk) is ________.

an enzyme that attaches phosphate groups to other proteins

You have a solution with a Hydrogen ion concentration of 0.00001 A. What is the pH of this solution? [ Select ] ["0.00001", "4", "6", "1", "5"] B. Is this solution acidic, basic or neutral? [ Select ] ["acidic", "basic", "neutral"]

answer 1: 5 answer 2: acidic

The element nitrogen (N) has an atomic number of 7. An atom of N has [ Select ] ["4", "14", "7", "none of these answers are correct"] proton(s) and [ Select ] ["none of these answers are correct", "4", "8", "14"] electron(s). Its valence shell is the [ Select ] ["second", "third", "first", "none of these answers are correct"] shell and contains [ Select ] ["2", "none of these answers are correct", "7", "3", "5"] electron(s). N will typically make [ Select ] ["3", "5", "1", "none of these answers are correct"] bond(s).

answer 1: 7 answer 2: none answer 3: second answer 4: 5 answer 5: 3

In the picture below, proteins are likely to be found everywhere (structures A,B,C,D) and DNA is most likely to be found in structure C

answer 1: everywhere (structures ABCD) answer 2: structure C

Use the figure below to answer the following questions.Which stage of cellular respiration is being shown here?[ Select ] ["oxidative phosphorylation (electron transport chain and chemiosmosis)", "glycolysis", "pyruvate oxidation", "citric acid cycle"]Is the proton gradient being concentrated in the space above the membrane or below?[below]What should be written at arrow A?[ Select ] ["NAPDH -> NADP+", "O2 -> H2O", "NADP+ ->NADPH", "NAD+ ->NADH", "H2O -> O2", "NADH -> NAD+"]What should be written at arrow C?[ Select ] ["NADH -> NAD+", "NAPDH -> NADP+", "O2 -> H2O", "NADP+ ->NADPH", "NAD+ ->NADH", "H2O -> O2"]

answer 1: oxidative phosphorylation (electron transport chain and chemiosmosis)answer 2: below?answer 3: NADH -> NAD+answer 4: O2 -> H2O

Match these properties/functions with the appropriate biomolecules from the drop down menu. Not all biomolecules will be used. Small high energy molecule that is provides usable energy for cellular work. ATP Can form a hydrophobic/water repelling barrier. Lipids Carries a temporary code, relatively unstable, usually single stranded. RNA Structural channel stuck inside the cell membrane. Lipids Polar, forms Hydrogen bonds with other polar molecules. Life's solvent. Water

atp, lipids, rna, lipids, water

You are in charge of scheduling tutors for the Biology Learning Center (BLC). You need to cut hours because of funding limitations. You want to have tutors available when students use them most. Which two time slots make the most sense to cut out, given the data below showing when students start their tutoring sessions?

before 9 , after 4

The following is a segment of double-stranded DNA from the middle of a gene during transcription. The arrowheads (>) represent the 3' ends. The promoter sequence is off the page to the LEFT.-------------------------->Promoter <------------------------- Which strand is the template strand?

bottom strand

Match the functional group with the correct property (each property will only be used once).

carboxyl - acidic amino - basic carbonyl - polar hydrocarbon - non polar

You might have a question like this with a lot more details/more points on the final. Use this Cellular Respiration diagram below to answer the following questions.Process A is called Glycolysis and occurs in the cytoplasm . It requires [ Select ] ["no", "ten", "countless", "two"] enzymes to cut the 6 carbon glucose into two 3 carbon pyruvates. Glycolysis produces a little bit of the molecule F, which is [ Select ] ["ATP", "ADP", "NADPH", "FADH2", "NADH"] via a process called [ Select ] ["substrate-level phsophorylation", "oxidative phosphorylation", "electron carrier", "reduction", "hydrolysis"] .Process B is called pyruvate oxidation and occurs in the matrix of the mitochondria.Process C is called the Citric Acid Cycle or Kreb's Cycle and occurs in the [ Select ] ["inner membrane of the mitochondria", "matrix of mitochondria", "outer membrane of the mitochondria", "mitochondrial intermembrane space"] . A lot of energized electrons are transferred to [ Select ] ["NAD+", "H2O", "FADH2", "CoQ (ubiquinone)"] and carried to Process D.Process D is called [ Select ] ["oxidative phosphorylation", "cellular respiration", "reduction", "redox", "substrate-level phosphorylation"] and it includes the electron transport chain complexes I-IV and ATP synthase, all of which are embedded in the [ Select ] ["outermembrane of the mitochondria", "matrix of the mitochondria", "intermembrane space", "cytosol", "inner membrane of the mitochondria"] .In process D energized electrons harnessed from food are transformed into [ Select ] ["a concentration gradient of H2O", "a concentration gradient of Na+ and K+", "ATP", "NADH and FADH2", "a proton gradient"] and thentransformed into the energy currency of the cell via chemiosmosis.

cytoplasm, ten, atp, substrate-level phosphorylation, private oxidation, matrix of mitochondria, nad+, oxidative phosphorylation, inner membrane of mitochondria, proton gradient

Use the graph below to answer the following questions.Please select the correct letter (a-e) to match the description for the forward reaction A + B --> C + D.[ Select ] ["d", "c", "b", "e", "a"] ΔGb Activation energy with an enzyme[ Select ] ["d", "a", "e", "c", "b"] Activation energy without an enzymeWhich of the following best describes the forward reaction in figure above? [ Select ] ["endergonic, ∆G < 0", "exergonic, ∆G > 0", "exergonic (exothermic), ∆G < 0", "chemical equilibrium, ∆G = 0", "endergonic (endothermic), ∆G > 0"]Which letter (a-e) represents the activation energy needed for the noncatalyzed reverse reaction, C + D → A + B ? [ Select ] ["e", "c", "d", "b", "a"]Does the reverse reaction require an input of cellular energy? yes

d, b, c , exergonic (exothermic) ∆G < 0, e, yes

Which of these can denature proteins? Select ALL that apply.

heat, acidic environments, basic environments

A _______ substance could contain __________ bonds which cause it NOT to interact with water.

hydrophobic; nonpolar covalent

Order the sequence of events that take place to synthesize and deliver a protein to where it needs to be. Labeling the following from 1 (the event that occurs first) to 6 (the event that occurs last).

in order: mRNA attaches to ribosome, Ribosome starts to build a polypeptide, SRP attaches to the ER signal, Ribosome attaches to rough ER, the protein is transported to the Golgi, Protein is sorted by the Golgi apparatus and secreted from the cell

Select all that are true of a cell that is 2n = 10

it has 10 chromosomes, it is diploid, it has homologous pairs

Which of the four major macromolecule types is mostly hydrophobic?

lipid

Which of the following is NOT an important part of the scientific process?

peer review and publication probably

Water interactions are depicted in the figure below. Based on your knowledge of the polarity of water molecules, the shaded molecule depicted in the center is most likely ________.

positive?

What phase of M-phase is depicted in the figure below?

prophase

Homologs synapse (pair) only during _______

prophase I of meiosis

The diagrams below show the results of three FRAP experiments. Which graph depicts the protein that is the most mobile within the membrane.

protein b

In transcription, the dehydration synthesis reaction is catalyzed by which enzyme?

rna polymerase

In eukaryotic cells, transcription cannot begin until ________.

several transcription factors have bound to the promoter

DNA polymerase can catalyze a dehydration synthesis reaction only at the 3' OH of the daughter strand of DNA. This means that

since the strands are antiparallel, one strand will grow toward the fork as it opens, and the other strand will grow in fragments away from the fork

Which choice is an example of a hydrogen bond?

the bond that forms between a hydrogen atom in one water molecule and an oxygen atom in another water molecule

When the peptide bond is created between amino acid 1 and amino acid 2:

the carboxyl group of amino acid 1 is joined to the amino group of amino acid 2.

Cells are characterized by...

the enclosure of biological molecules by a membrane

How much DNA is present in a G1 phase cell compared to the same cell after cytokinesis of mitosis?

the same amount

Which of the following is the first event to take place in translation in eukaryotes?

the small subunit of the ribosome recognizing and attaching to the 5' cap of mRNA

The concentration of NaCl inside a red blood cell is 0.9%. Which of these describes the results if red blood cells are placed into a 9% solution of NaCl?

they will shrink

You've made a hot drink by dissolving a teaspoon of instant coffee and a teaspoon of sugar in a cup of hot water. Which of the following statements is true?

you've just prepared an aqueous solution