Genetics Exam 1

You are trying to isolate mature mRNAs from eukaryotic cells using target sequences fused to magnetic beads. Which of the following sequences will accomplish your task?

A string of Thymine bases

Upstream Element

A third consensus sequence that also takes a part in the initiation of transcription in some bacterial promoters found around -40 to -60

-10 Consensus Sequence

AKA the Pribnow box; 5'-TATAAT-3' and 3'-ATATTA-5'; in most prokaryotic promoters, the actual sequence isn't TATAAT

You have to decide on the temperature at which a small DNA molecule will dissociate from its complement. Which of the following will dissociate most easily, having the lowest melting temperature?

ATTATTTAA

How do tRNAs connect nucleic acid information to amino acid information?

Act as temporary carriers of amino acids by bringing amino acids to the ribosome based on the mRNA nucleotide sequence Act as intermediary b/w nucleotides and amino acid sequences

Meischer

Nucleic acid discovered; isolated nuclei from white blood cells in pus. Contained in acidic (negatively charged) material high in phosphorus - nuclein or nucleic acid

The result of gene expression is (blank) so transcriptome analysis is an (blank) measure of gene expression.

protein; approximate

Identify and give some idea of roles of different RNAs miRNA, siRNA, rRNA, tRNA, lncRNA, piRNA, CRISPR

rRNA: ribosomal protein units mRNA: coding instructions for polypeptide chain from DNA to ribosome tRNA: link between the coding sequence of nucleotides and the amino acid chains of a polypeptide chain micro (mi) RNA & small (si) RNA: regulate translation CRISPR: assists in the destruction of foreign DNA

A circular molecule of bacterial DNA contains 3,000,000 nucleotide pairs. How long will it take to replicated the chromosome using theta-replication if the polymerase operates at close to its theoretical maximum of 1,000 nuclotides/sec?

~30 minutes

What is the ribosome and what is it made of?

A complex molecule made of ribosomal RNA molecules and proteins that form a factory for protein synthesis in cells

Genetic Model Organisms Examples

E. coli (prokaryote): Useful in the study of basic genetic processes Yeast (eukaryote): Useful in the study of basic genetic processes as a eukaryote Arabidopsis (plant): One of the first plants to have their genome fully sequenced C. elegans (nematode, protist): Useful in the study of cell differentiation and development and cell potency (e.g. totipotency, pluripotency) D. melanogaster (fruit fly): Transmission Zebra Fish: Vertebrate model; useful in the study of melanin genes Mice: Mammalian model

Human genome has 6.4 billion nucleotide pairs How many new nucleotides would that require?

12.8 billion

You are analyzing DNA from different species. From sea urchin, young A+T=70%; while from human, A+T=40%. What would the percentage of A+G be in these two species?

50% for both

Given this sequence, how many possible complementary strands could be generated if A paired with T or C? AGTAGGCTTG

8

Analysis of DNA in a unique form of melanoma shows that the ends of chromosome containing the TTGGGG repeats are longer than in other cells. What is a case for this cancer?

An over-functioning telomerase

What does semi-conservative mean?

The replicated DNA contains one original strand and one synthesized strand

What are the different areas of genetics?

Transmission (mendelian genetics, non-mendelian genetics, and heredity) Molecular nature of genetic material (DNA structure, gene expression, and mutation/repair) Population genetics (allelic frequencies and evolution)

How does complementarity relate to information storage?

Complementarity allows for information found in DNA and RNA to be stored in a single strand - complementary strand can be determined from template strand and vice versa

Basal Transcription Apparatus

Complex of transcription factors, RNA pol, and other proteins that assemble on the promoter and are capable of initiating minimal levels of transcription

Components of DNA

Deoxyribose (pentose sugar), phosphate group 5'C and nitrogenous base 1'C (AT GC) Composed of smaller building blocks: nucleotides, which are made up of one sugar molecule and one of the bases (ATGC) - AG purine bases have double ring structure, TC(U) pyrimidine bases have only single ring --- contributes to double helix structure and weak-bonds between bases Primary structure = sequence of bases in the nucleic acid chain in the 5'->3' Secondary Structure = base-pairing of complementary nucleotides gives secondary structure of a nucleic acid

What reaction do ribosomes catalyze?

Peptidyl transfer (the formation of a peptide bond during protein synthesis Peptidyl hydrolysis (the release of the complete protein from the peptidyl tRNA upon completion of translation

A purine nucleotide measures 1.2 nm in diameter, whereas a pyrimidine measures 0.8 nm. Imagine a DNA molecule where a T pairs with a C, what affect would that have on the B-form double helix?

The helix would be too narrow (normal diameter is 2 nm) 10 nucleotides is 3.4 nm and 1 nucleotide is 0.34 nm

RNA Pol I

Transcribes large rRNAs; present in all eukaryotes

RNA Pol III

Transcribes other small RNA molecules (tRNAs, small RNAs, some miRNAs, some snRNAs); present in all eukaryotes

RNA Pol II

Transcribes pre-mRNAs, snoRNAs, some miRNAs, and some snRNAs; ; present in all eukaryotes; the promoters of genes transcribed by RNA pol II consist of two primary parts: a core promoter and a regulatory promoter

Why does transcription occur, or why is it important?

Transcription of RNA occurs so that later protein can be translated from the RNA strand

Sigma Factor

a protein needed for initiation of transcription in bacteria - a bacterial transcription factor that enables specific binding of RNA , the subunits for all bacterial RNA polymerases (controls RNA binding to promoter)

What is the structure of a mature mRNA?

mRNA has matured when the introns have been spliced out

What are the features of the genetic code? How does tRNA wobble pairing relate to the code?

(1) Genetic code is universal - all organisms use the same genetic code (2) genetic code is unambiguous, each codon codes for just one amino acid (3) genetic code is redundant, meaning most amino acids are encoded by more than one codon Wobble pairing lets the same tRNA recognize multiple codons for the amino acid it carries

Promoter

A DNA sequence that is adjacent to a gene and required for transcription; contain short consensus sequences that are important to the initiation of transcription. They are DNA sequences that the transcription apparatus recognizes and binds. Indicates the template strand and the direction of transcription.

Different DNA Helix Forms

A form-DNA slightly smaller; major groove B form-most common Z form-left turning (forms affected by presence of other molecules or water)

You have isolated a sequence of RNA: 5' UACCUGGAGUUGUCCAGGUCGG 3'. Can it form a secondary structure and if so, what shape?

A hairpin/stem-loop

DNA/RNA Carbon Numbering

A phosphate group is attached to the 5' carbon position (carbon outside the sugar ring). Each nucleotide includes one nitrogenous base, attached to the 1' carbon of the sugar DNA always has Hydrogen(H) attached to 2' Carbon, RNA always has Hydroxide (OH) attached to 2' carbon

How does the ribosome cycle relate to the addition of amino acids?

Amino acids are brought to the ribosome by tRNA, which then pairs up with the mRNA by matching up codons and anticodons (complementary nucleotides) to ensure the correct amino acid is added to the protein

What allows for the specificity of tRNAs?

Basepairing b/w codon and anticodon - 3 sets of nucleotide codons on mRNA w/corresponding tRNA anticodons tRNA charging

Chargaff

Chargaff's principle (A = T and G = C) A+T does not equal G+C A+G = T+C Purines (A, G) = pyrimidines (C, T, U) Order of nucleotides was variable, but it followed rules

Difference Between Core and Regulatory Promoters

Core promoters are located immediately upstream of a eukaryotic gene and is the site to which the basal transcription apparatus binds while regulatory promoters are located immediately upstream of the core promoter and contain consensus sequences to which transcription factors bind in order to regulate transcription

Going back to Fred Griffith's experiment with the mice - why was it likely that the transforming principle was DNA?

DNA is heat stable - it can denature, but will reanneal upon cooling

Difference Between DNA and RNA

DNA-A, G, C, T; Double stranded; Antiparallel helix; deoxyribose; nuclear or mitochondrial; long; trancription; Types: Nuclear DNA, mtDNA RNA-A, G, C, U; Single stranded; hairpin and loops; ribose; nuclear or cytoplasmic; short; translation; mRNA, tRNA, rRNA, miRNA, siRNA, ribozyme

Hershey & Chase

Demonstrate conclusively that DNA is the transforming principle A note on T2 bacteriophage infection o DNA contains P but not S o Proteins contain S not P o Simplification - phage virus binds to bacteria and transforms bacterium into a phage-making factory o Something passing from virus to bacteria o Can only be protein or nucleic acid

Why is genetics important to humans?

Genes contribute to phenotype Diseases Breeding programs Genetic testing Conservation Agriculture Medicine Climate Evolution Manipulation of the genome

How does genetics relate to the appearance of an individual? To the behavior of an organism?

Genetics encodes for the phenotype (with some environmental variation). One's phenotype is their expressed traits (ex. behavior, appearance, etc.)

How do the different components of replication work together to allow replication to occur? (bacteria)

Helicase opens up DNA @ replication fork Single-stranded binding proteins coat DNA around replication fork to prevent rewinding of DNA Topoisomerase works at the region ahead of replication fork to prevent supercoiling Primase synthesizes RNA primers complementary to DNA strand DNA polymerase III extends primers, adding to 3' end to make bulk of new DNA RNA primers removed and replaced w/DNA from DNA polymerase I Gaps b/w DNA fragments are sealed by DNA ligase

What would happen if the promoter was moved or even removed?

If a promoter were moved, then initiation would occur but earlier or later in the sequence of nucleotides, resulting in an RNA strand that does not properly encode the desired protein. If the promoter were entirely removed, then transcription would not occur because it cannot be initiated without the promoter.

How are introns and exons determined? How does that relate to informational aspects of nucleic acids?

Introns are non-coding information while exons are coding information

In must adult cells, telomeres are relatively short, whereas in reproductive cells, they are long. What does that tell you about telomerase?

It is mostly active in germ-line cells It has lower activity in adult cells

What benefit does a poly U:A stretch between nascent RNAs and the template DNA provide in transcription termination?

It weakens the RNA:DNA hybrid to allow easier dissociation.

Core Promoters

Located immediately upstream of a eukaryotic gene and is the site to which the basal transcription apparatus binds; typically includes one or more consensus sequences (usually the TATA box) located -25 to -30 bp upstream of

Regulatory Promoters

Located immediately upstream of the core promoter; contains consensus sequences to which transcription factors bind in order to regulate transcription/ affect levels of transcription

What are model organisms? What makes them useful?

Model organisms are organisms used in place of human subjects that have biological processes similar in some way to humans, so the things we learn from them can be applicable or parallel to human processes, especially given that humans are often not easily studied in a genetic capacity due to ethical or other reasons. A good model organism is **small, has a short generation time, and produces a lot of offspring.**

Eukaryotic Promoter

Multiple ORI/ORCs based on topology, not consensus sequence; promoter recognition is carried out by accessory proteins that bind to the promoter and then recruit a specific RNA polymerase (I, II, or III); the core promoter is located immediately upstream of the gene and is the site to which the basal transcription apparatus binds, typically including one or more consensus sequences

A mutation leads to the deletion of the OriC in a bacterial cell. What will result from this?

No replication

Levene

Nucleotides; Nucleic acid is made up of repeating units of 4, chemically similar components Each component composed of a sugar, a phosphate and one of 4 bases Called a nucleotide The tetra-nucleotide Single-stranded - box shape It was thought that there was no variability of A, G, C, or T - it was thought that they just repeated and DNA's purpose was not understood

What is an ORF? What determines the start of translation? What is a Shine Delgano sequence? A Kozak sequence?

ORF: Continuous sequence of DNA nucleotides that contains a start codon and a stop codon in the same reading frame; is assumed to be a gene that encodes a protein, but in many cases the protein has not been identified yet Shine Dalgarno Sequence: Site of ribosome binding during translation (only in prokaryotes) Kozak Sequence: a nucleic acid motif that functions as the protein translation initiation site in most eukaryotic mRNA transcripts.

What is the ORI and how do initiator proteins work in initiating replication?

ORI-origin of replication Initiator Proteins-bind to the OriC and cause a short section of DNA to unwind, allowing helicase and other singlestrand binding proteins to attach to the polynucleotide strand.

What are the products of replication? How do they differ on leading and lagging strands?

Products of DNA replication are two daughter DNA, each containing one strand from their mother DNA (Semi-Conservative) Leading strands: requires a primer made out of RNA, DNA polymerase, incorporates a dNMP onto the 3' end of the primer initiating leading strand synthesis (biggest difference, only one primer required for initiation and propagation of leading strand synthesis) Lagging strand: much more complex, involves 5 steps - dNMP incorporated onto 3' end of primer, polymerase extends primer for 1,000 nucleotides until coming in contact w/5' end preceding primer (short segments are known as Okazaki fragments) - DNA polymerase dissociates, then RNA removed by specialized DNA polymerase or by RNaseH, leaving a gap - gap is filled by DNA polymerase using an Okazaki fragment as a primer - lastly, 3' terminus are joined using DNA ligase to 5' phosphate of previously made lagging segment TLDR; primer synthesis, primer extension, primer removal, gap filling, joining of fragments

Internal Promoters

Promoter located within the sequences of DNA that are transcribed into RNA

What is the role of the promoter? What would happen if the promoter was moved or even removed?

Promoter: DNA sequence that the transcription apparatus recognizes and binds so as to initiate transcription; indicates the direction of transcription, which of the two DNA strands is to be read as the template, and the starting point of transcription If a promoter were moved, then initiation would occur but earlier or later in the sequence of nucleotides, resulting in an RNA strand that does not properly encode the desired protein. If the promoter were entirely removed, then transcription would not occur because it cannot be initiated without the promoter.

Transcription Factors

Protein that binds to DNA sequences in eukaryotic cells and affects levels of transcription (regulation)

A particular cell has a tRNA^(pro) that fails to be charged with the amino acid. What would result from this?

Proteins would lack proline Proteins might not get made

A particular cell has a tRNA^(pro) that is incorrectly charged with methionine. What would result from this?

Proteins would lack proline Proteins would contain methionine instead of proline

Purines v Pyrimidines

Purines: two rings (A, G) Pyrimidines: single ring (C, T, U)

What enzyme does transcription?

RNA Polymerase carries out all of transcription RNA Pol I: Transcribes large rRNAs; present in all eukaryotes RNA Pol II: Transcribes pre-mRNAs, snoRNAs, some miRNAs, and some snRNAs; ; present in all eukaryotes RNA Pol III: Transcribes other small RNA molecules (tRNAs, small RNAs, some miRNAs, some snRNAs); present in all eukaryotes RNA Pol IV: Transcribes siRNAs that silence transposons RNA Pol V: Transcribes siRNAs that affect chromatin; present in plants

How does replication proceed?

Replication occurs in three major steps: the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment. During separation, the two strands of the DNA double helix uncoil at a specific location called the origin. Involves the replication bubble

What is the replicon? What is the replisome?

Replicon: Unit of replication consisting of DNA from the origin of replication to the point at which replication on either side of the origin ends; a segment of DNA that undergoes replication; each replicon contains an ORI Replisome: A complex of all of DNA replication's main hoes (all the main proteins used to replicate DNA)

How does termination occur in prokaryotes?

Rho-dependent termination and rho-independent termination

Franklin, Watson, & Crick

Rosalind Franklin - x-ray image; Watson and Crick - DNA structure

Enhancers

Sequence that stimulates maximal transcription of distant genes; affects genes only on the same DNA molecule (is cis acting), contains short consensus sequences, is not fixed in relation to the transcription start site, can stimulate promoters in its vicinity, and may be upstream or downstream of the gene; the function of the enhancer is independent of sequence orientation

How do the different components of replication work together to allow replication to occur? (eukaryotes)

Similar to bacteria with small differences: Eukaryotes have multiple linear chromosomes, w/multiple origins of replication Five DNA polymerases w/important roles, not 1 Most chromosomes are linear, with lagging strand, some DNA is lost from the ends of linear chromosomes (telomeres) in each round of replication

Bacterial Promoter

Single ORI; promoter is adjacent to the RNA coding region; consensus sequences usually found upstream at -10 and -35 positions; some bacterial promoters have upstream elements; the holoenzyme (the RNA polymerase core enzyme plus the sigma factor) recognizes and binds directly to sequences in the promoter

Differentiate between spliceosomal splicing and self-splicing and think about in what group of organisms each occurs

Spliceosomal Splicing: spliceosome is assembled from small nuclear RNAs (snRNA), removes introns from transcribed pre-mRNA Spliceosomal introns are found in most eukaryotic genes Self-splicing: Introns don't need the help of enzymes to splice because they form complex secondary structures o Group I: protists, bacteria, bacteriophages o Group II (circularish): bacteria, archaea, eukaryotic organelles

Griffith

Streptococcus bacterium (1928) Transforming principle Heat stable

Avery, McCarty, MacLeod

Strong evidence that DNA is the transforming principle Used Griffith's model system Treated heat-killed strains with different enzymes (experimental results) o Protease o RNAse o DNAse

Explain the structure of tRNA and why it is important

Structure of tRNA: distinctive folded structure w/three hairpin loops that form a three-leafed clover One of these loops contains an anticodon, which can recognize and decode mRNA codons Each tRNA has its corresponding amino acid attached to the end

TATA Box

TATAAA; located -25 to -30 bp upstream

-35 Consensus Sequence

TTGACA

Why don't we ever see such deletion mutations of OriC in bacterial populations?

The cells can't replicate and so won't be able to divide

Assume a sequence has a melting temp of 67 degrees C. What would happen if you raised the temp above 60 and then cooled it back down to 50?

The sequences would separate and then come back together.

Consensus Sequence

The set of the most commonly encountered nucleotides among sequences that possess considerable similarity, or consensus; the presence of a consensus in a set of nucleotides usually implies that the sequence is associated with an important function; most common are -10 and -35 consensus sequences; any particular change in the sequence of consensus sequences can speed up or slow down the rate of transcription (down and up mutations)

What is genetics?

The study of heredity and how inherited variation is encoded, replicated, and expressed

You are trying to express a gene in frog cells. Your attempts have been unsuccessful. Some mRNA is being produced (you can detect it in the cytoplasm), but there is no protein. Which of the following could explain this?

There is an miRNA that is complementary to the gene

What is/are the functions for UTR's?

They're important for RNA stability and regulating translation

Assuming that bacterial respiration generates 32 ATP/glucose. How many glucose molecules would be required to fully replicate that 3,000,000 bp bacterial chromosome?

a bit less than 200,000

Holoenzyme

a catalytically active enzyme consisting of an apoenzyme combined with its cofactor

What are the different types of processing that occur?

does not occur in prokaryotes (at least for mRNA IDK AB TRNA MAN); in Eukaryotes, only processed, mature mRNAs can be exported from the nucleus 5' Cap, Methyl-G, Poly-A tail