Tingnan ang lahat ng mga set ng pag-aaral

Genetics Final

Pataasin ang iyong marka sa homework at exams ngayon gamit ang Quizwiz!

What region is labeled on the Giemsa stain to the right? The dotted line is the centromere. A. 2p31 B. 2p61 C. 2q23 D. 2q31 E. 3p33

2p61

A = White

You've been doing a lot of PCR and the carbon footprint of shipping enzymes overnight on dry ice to your research lab is too much. So, you want to clone and make your own DNA polymerase instead of buying it every time you do an experiment. Given this sequence of the 5' end of the gene encoding Taq DNA polymerase the best forward PCR primer would be: A. 5' ATGCCAGAATTAAATAATC B. 5' GATTATTTAATTCTGGCAT C. 5' TACGGTCTTAATTTATTAG D. 5' TCTTAACGAAAATGGAT E. 5' ATCCATTTTCGTTAAGA

A. 5' ATGCCAGAATTAAATAATC

12. Which one of these shows part of the events of translation, in order? A. 5' cap recognition, scanning, initiation, peptide bond, tRNA recycling B. methionine, initiation, scanning, polyadenylation C. histone deacetylation, separating the double helix, initiation, elongation, termination D. tRNA charging, rRNA unwinding, mRNA elongation, ribosome termination E. Kozak, Shine-Dalgarno, hairpin attenuation, methionine, tryptophan

A. 5' cap recognition, scanning, initiation, peptide bond, tRNA recycling

What are the haplotypes of the individuals shown? A. AGT, GTA, and AGA B. AGA, AGG, GTG, GTT, TAT, and AAA C. A, G, and T D. GATA and GATG E. AGAAGG, ATTCGTACGGAT, GTTCGTACTGAA, and ATTCGTACGGAA

A. AGT, GTA, and AGA

5. What (is/are) the consensus sequence(s) for the 5 aligned sequences shown? A. GATGCTAAGATCGTA B. GTTGCTAACAACGAA C. AGTA, ACAT, TCAA, and AGTT D. AAGATCA, AACAACT, TACAACA, AAGATCT, and AGGTTGT

A. GATGCTAAGATCGTA

You want to PCR the MYO5C gene and use DNA sequencing to test if you have the SNP variant that puts you at increased risk of developing type 2 diabetes. In what order might your experiments be? A. PCR your DNA using MYO5C-specific primers, then sequence the PCR product, then align with the genome and look for that particular SNP (rs3825801) B. Sequence your genome using SNP-specific primers, then do a GWAS for rs3825801 C. PCR the whole genome, then sequence only the MYO5C locus to look for a new mutation in rs3825801 D. Clone your MYO5C gene from some cheek cells, then overexpress it in a hepatocyte cell line in vitro or a mouse in vivo to test if it produces type 2 diabetes-like insulin resistance, compared to a wild-type MYO5C. E. Collect a blood sample now and freeze it, then see if you develop type 2 diabetes. If so, collect another blood sample and quantify the mRNA expression levels of MYO5C rs3825801 to compare before vs after

A. PCR your DNA using MYO5C-specific primers, then sequence the PCR product, then align with the genome and look for that particular SNP (rs3825801)

In peas, the genes controlling flower color (P) and pollen shape (L) are linked. Allele dominance relationships are as follows. P_ = purple flowers; pp = white flowers L_ = long pollen; ll = round pollen You perform a cross Pp Ll X pp ll and observe the following F1 offspring: 6 Purple flowered, Long pollen 46 Purple flowered, round pollen 43 white flowered, Long pollen 5 white flowered, round pollen What are the phases of alleles in the parental gametes? A. Pl/pL, uninformative for the second parent B. PL/pl, uninformative for the second parent C. Pp/Ll, uninformative for the second parent D. P_/L_, uninformative for the second parent

A. Pl/pL, uninformative for the second parent

Your dog Fluffy's extended family has some members with a mutation in a gene that determines cell fate and produces dew claws. Not surprisingly, Fluffy has dewclaws. When you characterize the protein encoded by this mutant gene, you discover a difference in only a single amino acid where a leucine becomes a proline. Which of the following is most likely to be the type of mutation in your dog's genome? A. SNP B. CNV C. translocation D. transposon E. deletion

A. SNP

11. What is the main difference between the two loci corresponding to the arrows on this Manhattan plot? A. The polymorphism on the right is significantly more common in patient cases (those displaying the trait) than in the control subjects, whereas the locus on the left isn't strongly associated with the trait B. They are on different arms of the same chromosome, p on the left and q on the right C. The one on the right has a higher P value, which means it's going to cause severe disease D. The one on the right has a different type of nucleotide base than the one on the left E. The one on the right causes the disease being studied, whereas the one on the left doesn't

A. The polymorphism on the right is significantly more common in patient cases (those displaying the trait) than in the control subjects, whereas the locus on the left isn't strongly associated with the trait

A surprising kind of mutation that can arise during recombination and eliminate heterozygosity in a region, preventing you from determining individual haplotypes at one or more loci, is: A. a gene conversion B. a photodimer C. a CNV D. a telomere E. a SNP

A. a gene conversion

Which of the following can affect (can change, or can occur to) a protein after it is translated? Select all that apply. A. acetylation B. phosphorylation C. transcription D. translocation E. mutation

A. acetylation B. phosphorylation D. translocation

Given this pedigree of a rare trait, select the type of inheritance it is most likely to represent: A. maternally inherited B. autosomal recessive C. X-linked D. Y-linked E. autosomal dominant with 100% penetrance

A. maternally inherited

Of the following people, who are obligate carriers? (i.e. P(Aa) = 1?) Choose all that apply. a. I-1 b. I-2 c. II-1 d. III-1 e. III-2

ABCDE All choices

9. Choose all of the following statements that apply to complex (a.k.a. quantitative) traits. a. In a population, the phenotypic variation of a quantitative trait is a continuous range rather than discrete, distinct traits. b. A quantitative trait is typically influenced by many genes (polygenic). c. A quantitative trait can be influenced by the diet, environment, circadian rhythms, or other conditions that control the expression and function of genes. d. Many human diseases and common traits are complex, quantitative traits. e. Quantitative traits do not follow the inheritance patterns described by Gregor Mendel.

ALL OF THE ABOVE a. In a population, the phenotypic variation of a quantitative trait is a continuous range rather than discrete, distinct traits. b. A quantitative trait is typically influenced by many genes (polygenic). c. A quantitative trait can be influenced by the diet, environment, circadian rhythms, or other conditions that control the expression and function of genes. d. Many human diseases and common traits are complex, quantitative traits. e. Quantitative traits do not follow the inheritance patterns described by Gregor Mendel.

B -> Black

B = Black

The chromosome number in the cell with the complete karyotype shown to the right is: (6 shown) A. 2N = 6, N = 3 B. 2N = 12, N=6 C. 4N = 12, N = 3 D. 4N = 24, N = 6 E. Impossible to tell with the information given

B. 2N = 12, N=6

Consider the following RNA that you hope to reverse transcribe in the lab later this week: 5'-CUCUAGGUCAAGGUCACUGUCAGUAACGCAAUGAAAAAAA -3' The bold, underlined sequence denotes your desired primer binding site.The sequence of the primer needed to reverse transcribe and make the complementary DNA is: A. 5'- GTCATTGCGTTACTTTTTTT -3' B. 5'- TTTTTTTCATTGCGTTACTG -3' C. 5'- UUUUUUUCAUUGCGUUACTG -3' D. 5'- TTTTTTTGUTTCGCTTUGAC -3' E. 5'- CAGTAACGCAATGAAAAAAA -3'

B. 5'- TTTTTTTCATTGCGTTACTG -3'

When we talk about genome-wide association, what do we mean by a significant association? A. Genes throughout a chromosome are associated with each other in haplotypes B. A genetic locus is associated with higher risk of a trait in cases, compared with controls C. Linkage occurs between the associated genes D. Genes are made up of nucleotides which are linked by phosphodiester bonds E. The association of SNPs that are observed explain all cases of the disease in a population.

B. A genetic locus is associated with higher risk of a trait in cases, compared with controls

Many geneticists would consider a high LOD score to be more interesting than a low LOD score because: A. A high LOD score means more subjects in your study population have the disease than you expected B. A high LOD score means you may have identified a significant linkage between a gene and a disease or another trait. C. A high LOD score means there are a lot of recombination hotspots (recombinants) in your population D. A high LOD score means the severity of disease is very high in the study E. A high LOD score means the parental haplotypes are found in most offspring in the study population

B. A high LOD score means you may have identified a significant linkage between a gene and a disease or another trait.

A form of vitamin D-resistant rickets, known as hypophosphatemia, is inherited as an X-linked dominant trait. If a male with hypophosphatemia marries a normal (unaffected) female, which of the following predictions concerning their progeny (biological offspring) would be most likely to come true? A. All of their sons would inherit the disease B. All of their daughters would inherit the disease C. About 50% of their sons would inherit the diseased. D. About 50% of their daughters would inherit the disease E. None of their daughters would inherit the disease

B. All of their daughters would inherit the disease

You are researching an isolated population of terrestrial animals called wallabies in Australia. Here is an allele frequency table for HbA and HbS in Australian wallabies. Are these likely to be in HWE? Assume 1 degree of freedom and a X2crit of 3.841 for the alpha threshold of 0.05. A. Yes B. No

B. No

Many geneticists would consider a nonsense mutation to be more interesting to study than a silent mutation because: A. Nonsense mutations affect the DNA template whereas silent mutations affect the non-template DNA B. Nonsense mutations end translation whereas silent mutations have little-to-no effect on the protein C. Silent mutations change only protein structure, whereas nonsense mutations change structure and function D. Nonsense mutations have a beneficial effect, whereas silent mutations have little to no effect. E. Geneticists don't consider how interesting a mutation is when they decide which allele to study.

B. Nonsense mutations end translation whereas silent mutations have little-to-no effect on the protein

Based on the data in this figure, which is the most appropriate conclusion? A. The 5' cap and 3' polyA tail have independent effects on protein production. B. The 5' cap and 3'polyA tail have synergistic effects on protein production. C. Only the 5' cap plays a role in translation D. Only the 3' polyA tail plays a role

B. The 5' cap and 3'polyA tail have synergistic effects on protein production.

What is the relationship among alleles, genes, chromosomes, genomes, and DNA? A. Each chromosome in a cell contains hundreds of genomes, which are composed of DNA B. The complete set of genes in a cell is made of DNA and comprises the genome. Genes can have one or more alleles and are found in distinct regions of a chromosome. C. A genome contains hundreds of genes, composed of a chromosome that is one long piece of double-stranded DNA per cell. D. Alleles are variations of a gene that change the binding properties of DNA, each of which has its own chromosome E. A genome contains hundreds of chromosomes, which are composed of DNA, all of which encodes genes

B. The complete set of genes in a cell is made of DNA and comprises the genome. Genes can have one or more alleles and are found in distinct regions of a chromosome.

What would be the effect of an E. coli strain that carried a deletion of the lac operon's operator sequence? A. The lacZ gene would not be expressed under any condition B. The lacZ gene would be expressed under all conditions C. The lacZ gene would only be expressed when glucose levels are low D. The lacZ gene would only be expressed when lactose levels are low E. The lacZ gene would only be expressed when lactose levels are high

B. The lacZ gene would be expressed under all conditions

Genetic interference occurs when: A. Recombination can't occur due to the binding of histone proteins in nucleosomes. B. The likelihood of a crossover event is lower than expected when in proximity to another crossover. C. The effect of one allele or gene masks the effect of another gene. D. Heterochromatin blocks the replication of a gene because histones and nucleosomes are interfering. E. Some genotypes can't be observed, due to recessive lethality.

B. The likelihood of a crossover event is lower than expected when in proximity to another crossover.

DNA damage can be caused by ___ and repaired by ___ A. evolution; mutation B. UV light; NER C. zinc oxide; ROS D. ions; X-ray irradiation E. haplotypes; inversion

B. UV light; NER

What do you think would happen if the Trp-encoding UGG codons in this mRNA were mutated to UGC? *codon table is found on p.3 A. increased transcription of the trpE gene when trp is low B. increased production of the stem-loop attenuation structure when trp is low C. increased corepressor binding when trp is low D. increased ribosome stalling when trp is low E. increased sensitivity to changes in Trp levels from high to low

B. increased production of the stem-loop attenuation structure when trp is low

You've collected some data on flower color in a population of monkeyflowers in the California wilderness. Your calculated X2 is much greater than the critical chi-squared value, so the difference between your observed and expected values is ______________________ and the null hypothesis will __________________________. A. large, fail to be rejected B. statistically significant, be rejected C. non-existent, be confirmed D. minimal, be confidently rejected E. not a major underlying cause for the trait of interest, fail to be rejected

B. statistically significant, be rejected

9. Which of the following does NOT require a particular RNA sequence? A. splicing- B. transcriptional initiation C. CRISPR D. Argonaute-mediated degradation E. translational initiation

B. transcriptional initiation

You're a geneticist with a test subject with the haplotype GCCTAT. Which population is the most likely to be part of their ancestry given the allele frequencies below? A. A B. B C. C D. D

You did a test cross to ask if two genes, A and B are linked. What is the genetic distance between these 2 loci? (The # individuals of each genotype is shown below it). A. 6 cM B. 11 cM C. 17 cM D. 25 cM E. 50 cM

C. 17 cM

Given the sequencing gel to the right, what is the DNA sequence in the region surrounded by the dotted line, which contains 8 bands? A. 5'- ATATAGCA B. 5'- ATGCATGA C. 5'- ACGATATA D. 5'- ATCGTATA

C. 5'- ACGATATA

Given the sequencing gel to the right, what is the DNA sequence in the region surrounded by the dotted line, which contains 7 bands? A. 5'- ATAGCAT B. 5'- ATGCATG C. 5'- TACGATA D. 5'- ATCGTAT E. unable to determine with the information given

C. 5'- TACGATA

Red flowers, R, are dominant to white, r, and variegated leaves, V, are dominant to green leaves, v. These two loci are 30 cM apart. Of 60 progeny, how many would be expected to have white flowers and green leaves? A. 3 B. 6 C. 9 D. 15 E. 30

C. 9

Because DNA replication is semi-conservative, if you shift a bacterial culture grown in a heavy radiolabeled 32P phosphate-containing medium to a lighter, conventional phosphate-only growth medium, you'd see: A. A change in the size (molecular weight) of the DNA where it has two different sizes after one cell division (aka one round of DNA replication) B. No change after one generation (cell division) but a difference after the second cell division C. A change in the size (molecular weight) of the DNA where, after one cell division, you observe a single band of DNA of lower density/size, representing one heavy P strand and one light P strand D. A change in the size of DNA so there are eventually three different sizes: heavy base paired with heavy, heavy base paired with light, and light base paired with light strands E. No growth because the 32P is a terminator nucleotide that stops DNA replication.

C. A change in the size (molecular weight) of the DNA where, after one cell division, you observe a single band of DNA of lower density/size, representing one heavy P strand and one light P strand

7. What are the haplotypes of the individuals shown? A. AGT, AGA, AGA B. AGA, AGG, GTG, GTT C. AGTA, ACAT, TCAA, and AGTT D. TAGGA and TAGGT E. TCAA, TGTA, TCAT

C. AGTA, ACAT, TCAA, and AGTT

When using CRISPR as a genetic tool, what role does the cell play? A. Cells provide the exonuclease activity to cut DNA B. Cells provide the viral genome to act as CRISPR substrate C. Cells repair the DNA after Cas9 cuts the DNA. D. Cells provide the plasmid that encodes Cas9 and the guide RNA. E. Cells are passive and don't do anything; the researcher provides everything needed to edit the genome.

C. Cells repair the DNA after Cas9 cuts the DNA.

26. This table shows the relationship between running speed and circulating testosterone in female athletes that competed in a professional athletic competition. (data from Bermon and Garnier, 2017) What conclusions can be drawn from the data shown here? A. Female athletes with higher testosterone perform significantly better in the 400 m event, but significantly worse in the 200 m race, compared to those with lower testosterone in this study. B. Females athletes with higher testosterone fare ran faster than those with low testosterone in both events. C. Female athletes with higher testosterone perform significantly better than those with low testosterone in the 400 m race, but there is no significant difference in performance between testosterone tertile groups for those competing in the 200 m event. D. Testosterone concentrations are not correlated with performance in either the 200 m or 400 m race events in the subjects analyzed in this study.

C. Female athletes with higher testosterone perform significantly better than those with low testosterone in the 400 m race, but there is no significant difference in performance between testosterone tertile groups for those competing in the 200 m event.

Gene A encodes a transcriptional activator of gene B. Gene B mRNA is increased when the cell is exposed to UV light. Which of the following is likely to explain the function of gene B? A. Gene B encodes a transcription factor that is activated by UV light B. Gene A encodes an enzyme that repairs the protein product of Gene B C. Gene B encodes an enzyme that repairs the DNA damage from UV light D. Gene B encodes a eukaryotic initiation factor that increases translation E. Gene B encodes an enzyme that repairs the protein product of Gene A

C. Gene B encodes an enzyme that repairs the DNA damage from UV light

The AMP-activated enzyme AMP kinase (AMPK) phosphorylates the transcription factor Nrf2 and increases the mRNA levels of its target genes. Which of the following would be the most plausible mechanism for this response? A. Nrf2 target genes encode proteins that synthesize AMP. B. AMP is a ligand for Nrf2 C. Nrf2 translocates to the nucleus and acts as a positive regulator of transcription when phosphorylated D. Nrf2 recruits histone acetylases (aka histone acetyl transferases) to the promoters of AMP-dependent genes to help make heterochromatin E. AMPK is a negative regulator of Nrf2 activity

C. Nrf2 translocates to the nucleus and acts as a positive regulator of transcription when phosphorylated

You are on the trail of a serial killer whose DNA has been recovered from a crime scene. Which of the following would not be good evidence to choose a suspect? A. Evidence placing the suspect at the crime scene when it occurred B. Two distant relatives for a suspect have similar haplotypes to the killer's DNA. C. The killer has the same height and skin color as your suspect. D. The killer has the same genotype as your suspect. E. The killer has the same haplotype as your suspect.

C. The killer has the same height and skin color as your suspect.

Which of the following is not a difference between the leading and lagging strands in a replication fork or bubble during DNA replication? (choose only one) A. The leading strand has one DNA polymerase whereas the lagging strand has a few B. The lagging strand has Okazaki fragments whereas the leading strand does not. C. The leading strand doesn't require gyrases and helicases to unwind it, whereas the lagging strand is slower due to a need for unwinding. D. The lagging strand needs ligase to complete the phosphodiester backbone between segments whereas the leading strand does not E. The lagging strand will be the reverse complement of the leading strand.

C. The leading strand doesn't require gyrases and helicases to unwind it, whereas the lagging strand is slower due to a need for unwinding.

A truncated protein results when: A. RNA polymerase encounters a hairpin B. A tRNA without a charged amino acid binds the ribosome's A site C. a point mutation in a codon upstream of the stop codon produces an early stop codon, and the ribosome is released prematurely D. RNA polymerase reaches a stop codon in the rRNA, which binds a release factor instead of a tRNA E. Poly-A polymerase fails to add the poly-A tail to the nascent polypeptide

C. a point mutation in a codon upstream of the stop codon produces an early stop codon, and the ribosome is released prematurely

You do a three-point test cross with two diploid mosquitos harboring three marker genes: s, sharpened proboscis (for sucking blood), b, brown body, and bl, black eyes. The genotypes (or haplotypes) of the parental gametes are: s, b, bl and s+, b+,bl+ The genotypes of DCO (double crossover) gametes are: s, b, bl+ and s+, b+, bl When we examine the genetic map, which locus is in the middle on the chromosome? A. s, sharpened proboscis B. b, brown body C. bl, black eyes

C. bl, black eyes

In genetics, the term polymorphic refers to: A. different structural states of chromatin that occur due to dosage compensation. B. different splice forms of the mRNA that can be produced from the same gene C. different nucleotides observed at the same location in a gene or locus throughout a population D. different phenotypes depending on the relative contributions of additive traits e. differences in sex development where criteria for both female and male are met.

C. different nucleotides observed at the same location in a gene or locus throughout a population

Which of the following could not be determined after you receive the sequence of a novel mRNA in an email from your collaborator? Select all that apply. A. sequence of amino acids that will be in the protein it encodes B. potential target sites for miRNAs C. the splice sites used to produce it D. the consensus sequence used to drive transcription from its promoter E. All of the above can be defined for a typed sequence if you know it's an mRNA

C. the splice sites used to produce it D. the consensus sequence used to drive transcription from its promoter

What is the probability that an individual with the haplotype GTCGAT is from Population B below? A. (0.85 + 0.35 + 1 + 0.95 + 0.15 + 0.55) ÷ 6 B. (0.85 + 0.35 + 1 + 0.95 + 0.15 + 0.55)6 C. (0.85 x 0.35 x 0.95 x 0.15 x 0.55) D. 0 E. 1

D. 0

How many informative events are found in this pedigree? Note that individual II-2 is not the offspring of these parents. A. 0 B. 1 C. 2 D. 3 E. not enough information

D. 3

The effect size of an HD disease variant of the HTT gene with 250 CAG repeats is probably closest to A. 0 B. 0.999 C. 1.5 D. 50 E. These repeats won't cause a trait to be expressed, so there is no effect size.

D. 50

A recent GWAS paper published in the journal Nature Genetics by Mahajan et al (May 2022) entitled "Multi-ancestry genetic study of type 2 diabetes highlights the power of diverse populations for discovery and translation" identified a significant association for MYO5C (rs3825801, P = 3.8 × 10−11). What does this mean? A. People with the MYO5C gene are more likely to have type 2 diabetes, compared with those who don't. B. The levels of MYO5C protein are increased in type 2 diabetes patients. C. Everyone with type 2 diabetes has the risk allele of MYO5C called rs3825801 D. An individual with the rs3825801 SNP in the MYO5C gene is more likely to develop type 2 diabetes than someone with a different allele at that location in the genome. E. MYO5C encodes a protein that functions in the progress or development of type 2 diabetes.

D. An individual with the rs3825801 SNP in the MYO5C gene is more likely to develop type 2 diabetes than someone with a different allele at that location in the genome.

Given the pedigree to the right, determine the most likely mode of inheritance for the gene that produces the dewclaw trait. A. X-linked dominant B. X-linked recessive C. autosomal dominant D. autosomal recessive E. mitochondrial

D. Autosomal Recessive

Which of the following describes FISH? A. FISH is when pieces of DNA move from one location in the genome to another. B. FISH is when you're fishing through the nucleus for a particular binding site. C. FISH is the conversion of heterochromatin into euchromatin to reveal a target sequence D. FISH is the use of a fluorescent probe to detect a specific sequence of nucleic acids E. FISH tells you where a new SNP has occurred.

D. FISH is the use of a fluorescent probe to detect a specific sequence of nucleic acids

What is being shown in this cartoon? A. Recruitment of the sigma (σ) subunit to begin transcription B. The A, P, and E sites of the complete ribosome ready to initiate translation C. The poly-A binding protein about to translate an mRNA · D. Translational initiation at the Shine-Dalgarno sequence by the small ribosomal subunit E. Cas9 looking for a guide RNA target site.

D. Translational initiation at the Shine-Dalgarno sequence by the small ribosomal subunit

What is being shown on this Manhattan plot? A. All of the genes sequenced in a GWAS study B. All of the traits studied in a GWAS study C. Each chromosome's sequence, in order from 5' to 3' D. Which SNPs exceed a significance threshold for association and therefore, could be a causal mutation for or simply linked to a trait-determining locus in the cohort of individuals who were studied E. Which loci are associated with having the longest beard

D. Which SNPs exceed a significance threshold for association and therefore, could be a causal mutation for or simply linked to a trait-determining locus in the cohort of individuals who were studied

"CRISPR" technology uses a _____ to find the correct target sequence in the genome. A. Cas9 B. exonuclease C. base pair D. guide RNA E. recombinase

D. guide RNA

The order of events in the synthesis of a new mRNA is: A. recognition of downstream consensus sequences, miRNA binding, Argonaute-mediated degradation B. phosphorylation, splicing, and initiation C. replication, transcription, translation D. helicase, elongation, spliceosome, poly-A polymerase E. A, P, E

D. helicase, elongation, spliceosome, poly-A polymerase

Two heterozygous carriers have the genotype HbA HbS and have phenotypically normal red blood cells but carry the HbS allele that produces sickled RBCs in an autosomal recessive inheritance pattern. If these two individuals produce offspring, what is the probability that all three of their children will have normal blood cells? A. 3/64 B. 9/64 C. 9/16 D. 18/64 E. 27/64

E. 27/64 = 0.421875

How does a TWAS differ from a GWAS? A. A GWAS can use cheek cells for a sample, but a TWAS cannot B. A TWAS provides whole-genome information whereas the GWAS is only measuring coding genes C. A TWAS measures the type of changes whereas the GWAS is not quantitative D. A TWAS analyzes mRNA whereas a GWAS analyzes all kinds of RNAs E. A TWAS analyzes transcription whereas a GWAS analyzes changes in DNA

E. A TWAS analyzes transcription whereas a GWAS analyzes changes in DNA

What information cannot be determined from a complete, thoroughly-researched pedigree? A. parentage of an individual B. # siblings of an individual C. whether two trait-associated loci are closely linked to each other or are more than 50 cM apart D. whether an allele might be associated with a trait E. All of the above can be determined from the most detailed pedigrees.

E. All of the above can be determined from the most detailed pedigrees.

Diploid cells can have two of each: A. gene B. chromosome C. allele D. genomic region E. All of the above could be answers to this question.

E. All of the above could be answers to this question.

Which of the following will not change Genetic Admixture? A. difference in the number of recombination events in a diverse population B. difference in the number of breeds in a mixed breed dog, who breeds a lot C. appearance of an inherited sterility phenotype in many families in a population D. a sudden isolation of populations by geology E. All of the above would affect the degree of admixture.

E. All of the above would affect the degree of admixture.

Which of the following events could affect the results of a GWAS? (Select one answer only). A. Expanding the range of different regional reference populations analyzed for the trait of interest B. Increasing the number of individuals sequenced in your study cohort. C. Increasing the number of affected individuals (carrying the trait or phenotype of interest) D. Using a correction factor to adjust the significance threshold, in order to draw a more conservative set of conclusions E. All of the above would affect the results of a GWAS.

E. All of the above would affect the results of a GWAS.

Which of the following would not disqualify the white-tailed deer (Odocoileus virginianus) population in Broome County from reaching Hardy-Weinberg equilibrium for a gene of interest? A. mixing between this population and another population that lives in Tompkins County (Ithaca area) B. non-random mating between deer based on coat appearance C. a small # of individuals that are able to breed and produce offspring D. a fitness advantage for one allele of the gene of interest, compared with other alleles (the allele make a pretty coat) E. All of the above would prevent a population from reaching HWE

E. All of the above would prevent a population from reaching HWE

Which individual has a haplotype showing evidence of recombination between these two loci (I and N)? A. I-2 B. II-1 C. II-2 D. III-1 E. III-2

E. III-2

23. The molecular machinery for _____ closely follows DNA polymerase and its replisome to fix any errors that DNA pol's proofreading exonuclease domain doesn't fix. A. nucleotide excision repair B. base repair C. homologous repair D. trinucleotide repeat repair E. mismatch repair

E. mismatch repair

What's the best definition of a gene? A. All genes are sequences of DNA that encode mRNAs that encode proteins B. A gene is one of many DNA regions that are found in the nucleus. C. The basic unit of inheritance in an organism's genome, a gene can encode a protein and can also affect a trait. D. A gene is a piece of DNA that varies across individuals E. A gene is the type of DNA that can have polymorphism

The basic unit of inheritance in an organism's genome, a gene can encode a protein and can also affect a trait.

LOOK AT QUESTION 4 EXAM 1 What types of genetic variation can be determined between 2 individuals of the same species through a standard karyotype analysis using Giesma staining? Choose all that apply SNPs Translocations allele differences made up of one-point mutations (a different nucleotide) chromosome number Heterochromatin and euchromatin differences

Translocations chromosome number Heterochromatin and euchromatin differences

Consider eye color, an X-linked trait in fruit flies. Wild type eyes are red and are dominant to white eyes. A white-eyed female was crossed to a red-eyed male. The F1s were crossed to their siblings to produce F2s. What are the expected proportions of offspring in the F2 generation? a. 25% red eyed female: 25% white eyed females: 25% red eyed males: 25% white eyed males b. 50% red eyed females: 25% white eyed males: 25% red eyed males c. 25% white eyed females: 25% red eyed females: 50% red eyed males d. 50% white eyed males: 50% red eyed females e. 50% red eyed males: 50% white eyed females

a. 25% red eyed female: 25% white eyed females: 25% red eyed males: 25% white eyed males

In birds, males are the homogametic sex while females are the heterogametic sex. Which of the following is true in this system of sex determination? a. The gender of the offspring is determined by the female parent's gamete. b. Male offspring have a ZW chromosome pattern due to the maternal contribution from their mothers. c. The gender of the offspring is determined by the male parent's gamete. d. Female offspring have a ZZ chromosome pattern due to the maternal Z they inherited. e. Males and females are determined by environmental conditions rather than chromosomes.

a. The gender of the offspring is determined by the female parent's gamete.

Consider the results from physical, genetic, and hormonal sex determination tests for an athlete that competes in the female category: Physical characteristics: female genitals fully formed Genetic test findings: one Barr body present in all cells, SRY gene absent Hormone test findings: Testosterone (T) = 11.8 nmol/L What is the most likely cause for high T in this individual? Keep in mind that a genetic mutation to a particular gene is unlikely to alter the chromosome structure. a. XX with a mutation in a gene that causes constitutive androgen hyperplasia b. XY with a mutation in the SRY gene c. XYY d. X0/XY mosaic e. XXY/XY mosaic

a. XX with a mutation in a gene that causes constitutive androgen hyperplasia

In cats, the allele for long hair (l) is recessive to the dominant short hair allele (L) so that heterozygous Ll cats have short hair. Your two cats, one short-haired and one long-haired, have mated and you want to predict the probabilities in their first litter.What will the offspring genotypes most likely be if your short-haired cat is Ll? What will the offspring genotypes be if your short-haired cat is LL? a. half short hair, all short hair b. all short hair, half short hair c. all short hair, all short hair d. 1/4 short hair, 3/4 short hair e. 3/4 short hair, 1/4 short hair

a. half short hair, all short hair

Serrate Drosophila flies are heterozygous for a dominant mutation that results in a notched wing. The mating of 2 Serrate flies produces 2 flies with notched wings and 1 normal winged fly.The mutation causing the serrate wing phenotype is likely a(n) ______ allele. a. lethal b. epistatic c. codominant d. pleiotropic e. variably expressed

a. lethal

In guinea pigs, smooth hair is due to a dominant allele (S) and curly hair is due to a recessive allele (s). Black coat color is due to a B allele that is dominant to brown coat (b). A third allele at the coat color locus, when homozygous, produces a white coat. When a true breeding* smooth-haired white guinea pig was crossed to a true breeding curly, brown guinea pig, the F1 offspring had smooth, brown-and-white spotted fur. *True breeding animals produce F1 offspring of the same genotype and phenotype as the parents when mated to each other. This is how researchers maintain "stocks" of a particular genotype for experiments. What is the relationship between the brown and white color alleles? a. they are codominant b. they show incomplete dominance c. brown is dominant to white d. brown is epistatic to white e. brown and black are both recessive to white

a. they are codominant

If 36% of a population show a recessive trait (aa), what will be the frequency of heterozygous individuals in the following generation, assuming Hardy-Weinberg equilibrium? a. 0.6 = 60% b. 0.48 = 48% c. 0.4 = 40% d. 0.36 = 36% e. 0.16 = 16%

b. 0.48 = 48%

In a variety of gerbils, a black coat color is a result of the biochemical pathway shown below. Enzyme X converts the compound represented by a circle into the compound represented by the open square. Enzyme Y converts the open square compound into a black-colored compound (black square). Protein T is a transporter that allows the hair follicle to take up the black compound made by enzyme Y to produce the final black coat color. Dominant alleles (X,Y,T) produce the functional proteins, while recessive mutations (x,y,t) do not. Indicate the predicted gerbil coat color for individuals with the indicated genotypes. What are the predicted phenotypic ratios of a cross between 2 gerbils with the genotypes XxYYTt (Note these are not X and Y chromosomes, but alleles of genes X and Y that are on different autosomes and segregate independently) a. 12 black: 4 white b. 9: black: 7 white c. 9 white: 7 black d. 8 black: 4 white e. 15 black: 1 white

b. 9: black: 7 white

In humans, an autosomal gene controls hair growth. In males, the B allele prevents head hair growth (complete baldness) and is dominant to the wild type allele that allows hair growth, so that Bb males are completely bald. By contrast, Bb females that are heterozygous for this same baldness allele have normal hair growth, while females that are homozygous for the baldness allele (BB) have reduced hair growth. What term best describes this allele conferring baldness? a. sex-linked b. sex-influenced c. recessive d. dominant epistasis e. pleiotropic

b. sex-influenced

Consider the following cross: AaBbDd X aabbDd. What proportion of the offspring is expected to show the dominant phenotype for all three traits? a. 9/16 b. 6/16 c. 3/16 d. 1/8 e. 1/16

c. 3/16 = 0.1875

In a woman, a nondisjunction event occurred during Meiosis I affecting an X chromosome.If all 4 gametes (eggs) were fertilized by a gamete (sperm) containing a Y chromosome, what proportion of her resulting offspring would have Klinefelter's syndrome (XXY)? a. 0% b. 25% c. 50% d. 75% e. 100%

c. 50%

In Labrador retrievers, the B allele is required for black fur and is dominant to the b allele which produces brown fur. A second gene called the extension locus determines whether the color is extended onto the fur. The E allele allows for color extension of black or brown and is dominant over the e allele, which leads to a yellow color. What would be the expected phenotypic ratios for the following cross? BbEe x BbEe a. 1 black: 1 brown: 2 yellow b. 2 black: 1 brown : 1 yellow c. 9 black : 3 brown : 4 yellow d. 9 black : 4 brown: 3 yellow

c. 9 black : 3 brown : 4 yellow

Is it....? a. autosomal dominant b. autosomal recessive c. X-linked dominant d. X-linked recessive e. mitochondrial

c. X-linked dominant

The phenomenon where sunlight increases the appearance of freckles in individuals who harbor two copies of the trait-associated allele of the mc1R gene is called: a. a monohybrid cross b. a translocation c. a gene-by-environment interaction d. a copy number variant e. dominance

c. a gene-by-enviornment interaction

What is the role of the SRY gene in humans? a. it is located on the Y-chromosome and initiates the X-inactivation process in females b. it is located on the Y-chromosome and causes the Y to pair with the X chromosome during meiosis in males. c. it is located on the Y chromosome and initiates the developmental pathway toward the male gonad. d. It is located on the Y chromosome and stimulates expression of X chromosome genes to balance their expression levels between males and femalese. it is located on the Y chromosome and prevents the formation of Barr bodies in males

c. it is located on the Y chromosome and initiates the developmental pathway toward the male gonad.

How does an update in reference genomes change an individual's predicted ancestry? a. the reference genome has sequenced more SNPs in regions of the genome that are conserved across all animals b. the reference population includes more individuals from the same family c. sequencing more individuals in each reference population allows the refinement of training algorithms that assign SNPs to specific reference populations d. whole genome sequencing of individuals from the reference population gives more detailed data than the old SNP arrays e. Updating reference genomes and how they are analyzed can't change ancestry predictions because ancestry doesn't change.

c. sequencing more individuals in each reference population allows the refinement of training algorithms that assign SNPs to specific reference populations

This pedigree shows the genotype at two loci, gene A and gene D. The haplotypes of each individual are shown. What can be determined about the gametes that produced individual II- 1? a. 1 parental/non-recombinant gamete, 1 unknown b. 1 non-parental/recombinant gamete, 1 unknown c. 2 parental/non-recombinant gametes d. 1 parental/non-recombinant and 1 non-parental/recombinant gamete e. not enough information to determine either gamete

d. 1 parental/non-recombinant and 1 non-parental/recombinant gamete

This pedigree shows the genotype at two loci, gene A and gene D. The haplotypes of each individual are shown. What can be determined about the gametes that produced individual II-1? a. 1 parental/non-recombinant gamete, 1 unknown b. 1 non-parental/recombinant gamete, 1 unknown c. 2 parental/non-recombinant gametes d. 1 parental/non-recombinant and 1 non-parental/recombinant gamete e. not enough information to determine either gamete

d. 1 parental/non-recombinant and 1 non-parental/recombinant gamete

What is the probability that IV-4 is a carrier? a. 1/4 b. 1/3 c. 1/2 d. 2/3 e. 3/4

d. 2/3 = 0.66

In guinea pigs, smooth hair is due to a dominant allele (S) and curly hair is due to a recessive allele (s). Black coat color is due to a B allele that is dominant to brown coat (b). A third allele at the coat color locus, when homozygous, produces a white coat. When a true breeding smooth-haired white guinea pig was crossed to a true breeding curly, brown guinea pig, the F1 offspring had smooth, brown and white spotted fur. What are the expected phenotype ratios for the F2 progeny from an F1 x F1 cross? A. all smooth with brown and white spotted coats b. 4/16 brown, smooth coat; 4/16 white, smooth coat; 12/16 spotted, smooth coat c. 3/16 brown, smooth coat; 3/16 white, smooth coat; 6/16 spotted, smooth coat, 4/16 curly spotted coat d. 6/16 spotted smooth, 3/16 brown smooth, 3/16 white smooth, 2/16 spotted curly, 1/16 brown curly, 1/16 white curly

d. 6/16 spotted smooth, 3/16 brown smooth, 3/16 white smooth, 2/16 spotted curly, 1/16 brown curly, 1/16 white curly

In cats, short hair is due to an allele (L) in FMG5 gene that is dominant to the recessive (l) allele. The amount of black color that is deposited into the fur in the cats you're fostering is controlled by the MLPH gene, where the D allele results in full color deposition and is dominant to the d allele, which leads to a diluted (faint- in this case, gray) color. Two short haired, black cats that are heterozygous at both loci (LlDd) are mated. What are the expected phenotypic ratios of their kittens? a. 9/16 long black hair: 3/16 short gray hair: 3/16 long gray hair: 1/16 short black hair b. 9/16 short black hair: 3/16 long gray hair: 3/16 short gray hair: 1/16 long black hair c. 9/16 short black hair: 3/16 short hair with black and gray stripes: 3/16 long hair with black and gray stripes : 1/16 long gray hair d. 9/16 short black hair: 3/16 short gray hair: 3/16 long black hair: 1/16 long gray hair e. 1/4 short black: 1/4 short gray: 1/4 long black: 1/4 long gray

d. 9/16 short black hair: 3/16 short gray hair: 3/16 long black hair: 1/16 long gray hair

Which of the following describes a likely genotype of a gamete produced by a germ line cell containing these chromosomes? a. RrDdBb b. RdD c. RrdDbB d. RDB e. RrDd

d. RDB

Is it....? a. autosomal dominant b. autosomal recessive c. X-linked dominant d. X-linked recessive e. mitochondrial

d. X-linked recessive

Dosage compensation can entail: a. red and white pigment genes combining to make a pink colored flower b. Sxl killing half the females to even out the number of X chromosomes in the population c. mating of yeast cells to make diploid male and female offspring d. condensing one copy of the X chromosome in XX individuals to reduce the expression of X-linked genes e. All of the above describe dosage compensation.

d. condensing one copy of the X chromosome in XX individuals to reduce the expression of X-linked genes

In humans, recessive alleles of the mc1R gene (and sun exposure) lead to freckles. Eyelash length is controlled by the FGF5 gene, where recessive alleles lead to very long lashes. Two nonfreckled people with normal eyelash length have a child with freckles and very long lashes. 19. What is the probability that their next child will be freckled with normal eyelashes? a. 3/4 b. 2/3 c. 1/2 d. 1/4 e. 3/16

e. 3/16 = 0.1875 = 18.75%

What is the probability that a child produced by the gametes from individual IV-3 and II-4 would be affected? a. 2/3 = 0.66 b. 1⁄2 = 0.5 c. 2/3 * 1⁄4 = 1/6 d. 4/9 = 0.4444 e. 4/9 * 1⁄4 = 0.1111

e. 4/9 * 1⁄4 = 0.1111

27. Consider the results from physical, genetic, and hormonal sex determination tests for an athlete that competes in the female category: Physical characteristics: genitals neither typically male nor typically female Genetic test findings: Barr body present in some cells and absent in others, SRY gene present Hormone test findings: Testosterone (T) = 3 nmol/L What is the most likely karyotype of this individual? Keep in mind that a genetic mutation to a particular gene is unlikely to alter the chromosome structure. a. XXX b. XY c. XXY d. X0/XY e. XXY/XY

e. XXY/XY

A haplotype refers to: a. part of the genome that contribute to the same phenotype b. part of the genome that is expressed only in haploid (gamete) cells c. part of the genome that is spatially restricted to the same chromosome and probably within a sub-section close to each other within the chromosome d. part of the genome that segregates (is likely to be inherited) together e. c. and d. are both correct

e. c. and d. are both correct

While doing field work on a remote island in the northern hemisphere, you discover a new species of turtles that appear to be members of the elusive genus known as Turtwig. You attempt to discover what sex determination system it uses by catching Turtwigs and performing a series of controlled crosses, using a pair of Turtwigs that you have placed in large enclosure to isolate them from other potential mates. You begin your work in coldest time of the year (February), when the average temperatures are only around 21°C (~70°F). Your first crosses yield only females. You complete your field work in June, when average temperatures are higher, around 30°C (~86°F). Your last set of crosses yield only males. Which of the following modes of sex determination best explains these data? a. ZZ/ZW b. XX/XY c. haplo/diploidy (XO/XX) d. sequential hermaphroditism e. environmental sex determination

e. environmental sex determination

Tingnan ang lahat ng mga set ng pag-aaral

Genetics Final

Kaugnay na mga set ng pag-aaral

Chapter 7 Nervous System

AREC 202

Chapters 18.1-18.14- 15.5-15.7

Chapter 31 Quizzes

Chapter 21 The Breast (WB)

Main characters of The Fifth of March

STAT1401 EXAM 4 STUDY GUIDE

2510 Exam One Study Guide

Cardiovascular System: Blood

Customer Service Test

Honan-Chapter 24: Nursing Management: Patients With Intestinal and Rectal Disorders

Business Mathematics Chapter 22 Statistics

Chapter 7, Chapter 8, Chapter 9, Chapter 10

Real Estate Principles

1.4 Stakeholders

chapter 1 biotech notes

evr chapter 16

Lesson 1 - BIOCHEM

Exam 1 - Developmental Psychology (Ch 1-5)

TeasV Math, TEAS Math