genetics past exam questions
A man with normal color vision, XB Y has a large family of 13 children with a woman who is a carrier for color blindness, XB Xb. What percentage of their daughters would you expect to be color-blind? A) 0 B) 25 C) 50 D) 75 E) 100
a
A somatic mutation is A) never passed on to offspring. B) passed on to ½ of all offspring. C) passed on to ½ of all cells in each offspring. D) never repaired. E) always repaired.
a
All tRNA molecules A) have a secondary structure resembling a cloverleaf shape. B) have the sequence AAA at their 5' end. C) contain a triplet codon sequence. D) contain modified bases in place of all uracils. E) are transcribed as larger precursors from tandemly-repeated genes.
a
An allele A) is a variant form of a gene. B) is located in the nucleus of prokaryotes. C) is always identical in both members of a homologous pair of chromosomes. D) always produces a dominant phenotype. E) always produces a recessive phenotype.
a
An operon contains all of the sequences below EXCEPT _______. A) introns B) promoter C) structural genes D) operator E) All of the above are contained in an operon.
a
Deamination is a spontaneous chemical change that can A) convert a cytosine to a uracil. B) convert a guanine to a cytosine. C) result in a thymine dimer. D) result in double-stand breaks in DNA. E) None of the above.
a
Each cycle of a PCR reaction consists of the following steps in order: A) denature template, anneal primer, extend polymer B) anneal template, denature primer, extend polymer C) denature polymer, extend primer, anneal template D) extend template, anneal primer, denature polymer E) anneal polymer, denture template, extend primer
a
Geneticist use the rule of addition to predict A) the probability that one or the other of two independent events will occur. B) the probability that two independent events will both occur. C) the total number of offspring from a cross. D) the total number of chromosomes at the end of mitosis. E) B & C
a
Homologous chromosomes separate during A) anaphase I B) prophase I C) metaphase II D) anaphase II E) telophase II
a
If a deletion occurs in a gene that encodes DNA polymerase I so that no functional DNA polymerase I is produced, what will be the most likely consequence of this mutation? A) The replicated DNA strands would contain pieces of RNA. B) The DNA would remain in a supercoiled state. C) There would be no synthesis of leading or lagging strands. D) There would be no synthesis of RNA primers. E) The DNA will not be able to unwind to initiate replication.
a
If individuals 3 and 4 of the 3rd generation in the pedigree above were to mate and have 3 children, what is the probability that their 2nd child will have the heart disease? A) 0% B) 25% C) 50% D) 75% E) 100%
a
In humans, blood type alleles IA and IB are co-dominant to each other and each is dominant to allele i. A mother with blood type A has a child with blood type B. What are the possible blood types for the father of this child? A) B or AB B) A, B, or AB C) A or B D) A, B, or O E) A, B, AB, or O
a
Peptidyl transferase catalyzes _____ at the ribosome. A) formation of a new bond between amino acids B) joining of the two ribosomal subunits C) bonds forming between a codon and its anticodon D) transport of tRNAs to the small subunit E) termination of translation
a
Protein synthesis and preparation for DNA replication occurs during the ____ phase of the cell division cycle. A) G1 B) S C) G2 D) G0 E) M
a
RNA interference is a common form of regulation of eukaryotic gene expression. This can be carried out by a A) miRNA binding a target mRNA to prevent translation. B) crRNA binding a ribosome to prevent translation. C) siRNA binding a target DNA to prevent replication. D) double-stranded RNA binding DNA to attract chromatin-modifying enzymes. E) small riscRNA binding pre-mRNA to prevent transcription.
a
The chromatin remodeling complex requires energy to A) reposition nucleosomes. B) decrease the positive charge on histone tails. C) add methyl groups to CG dinucleotides. D) phosphorylate Serines. E) remove a single histone protein.
a
The distinction between heterochromatin and euchromatin is A) euchromatin encodes more transcribed gene sequences in its DNA. B) heterochromatin is more transcriptionally active. C) heterochromatin has more frequent recombination. D) heterochromatin is decondensed during interphase. E) euchromatin is more highly condensed than heterochromatin.
a
The figure to the right represents ____________. A) prokaryotic replication B) eukaryotic replication C) prokaryotic transcription D) eukaryotic transcription E) viral transcription
a
Thomas Hunt Morgan studied a white-eyed Drosophila variant. He concluded that the mutation was sex-linked because when he crossed a white-eyed female with a wild type red-eyed male, he found in the offspring A) all of the males had white eyes and all of the females had red eyes. B) all of the females had white eyes and all of the males had red eyes. C) one half of both females and males had white eyes. D) all of the offspring had white eyes. E) all of the offspring had red eyes.
a
What is the role of the antibiotic resistance gene ampR in a plasmid cloning vector? A) ampR enables positive selection for bacteria cells containing the plasmid. B) ampR contains a unique cloning site. C) ampR enables the plasmid to replicate independent of the bacterial chromosome. D) ampR produces a blue color for positive selection of a recombinant plasmid. E) ampR allows a foreign gene to be transcribed and translated in the bacterial cell.
a
When comparing DNA polymerase I and DNA polymerase III functions, we find that A) both DNA polymerases have exonuclease activity. B) only DNA polymerase III has polymerase activity. C) only DNA polymerase I adds a nucleotide to the 3' end of a polynucleotide. D) both DNA polymerases replace an RNA nucleotide with a DNA nucleotide. E) both DNA polymerases add a nucleotide to the 5' end of a polynucleotide.
a
Which of the following statements best describes a histone? A) Contains a large proportion of positively-charged amino acids. B) Contains a large proportion of negatively-charged methyl groups. C) Contains a large proportion of positively-charged phosphate groups. D) Contains a large proportion of negatively-charged acetyl groups. E) Contains a large proportion of chromatosomes.
a
Which of these sequences could form a hairpin? A) 5′-GGGGTTTTCCCC-3′ B) 5′-AAAAAAAAAAAA-3′ C) 5′-ACACACACACAC-3′ D) 5′-TTTTTTCCCCCC-3′ E) 5′-GGGTTTGGGTTT-3′
a
Which statement best describes RNA splicing? A) Noncoding introns are edited out and removed. B) Noncoding exons are edited out and removed. C) A string of adenines is added to the 3' end. D) A protective cap is added to the 5' end. E) A branch point adenine is added to an exon.
a
Which statement best describes linkage? A) It is a condition in which two or more genes do not show independent assortment. B) It is a condition where one parent in a cross is homozygous for two or more genes and the other parent is heterozygous. C) It is a condition where two genes are located on separate chromosomes. D) It is a condition where a heterozygous individual makes only one type of gamete. E) It is a condition that occurs in many types of organisms but not in humans because we do not produce enough different types of gametes.
a
While all cells in the human body contain the same set of genes, each tissue type is made up of cells that have different shapes and functions because A) different cell types express particular genes at different levels. B) different cell types replicate at different rates. C) different cell types are exposed to different hormones. D) different cell types obtain different types of nutrients from their surroundings. E) All of the above explanations are correct.
a
With respect to the orientation of their 3′ and 5′ ends, the two polynucleotide chains of a double-stranded DNA molecule are A) antiparallel. B) isotopes. C) tetranucleotides. D) identical. E) phosphodiester.
a
A DNA strand has the base sequence 5'-CAATGACTGC-3'. What is the base sequence of the complementary DNA strand? A) 5'-CAATGACTGC-3' B) 5'-GCAGTCATTG-3' C) 3'-CAATGACTGC-5' D) 5'-CAAUGACUGC-3' E) 3'-GCAGTCATTG-5'
b
A cell from a dog has a diploid number of 78. This cell would have _____ chromosomes and _____ DNA molecules at metaphase I of meiosis? A) 78; 78 B) 78; 156 C) 156; 156 D) 39; 78 E) 39; 39
b
A man with genotype AaBbCC and a woman with genotype aaBbcc have 8 children. How many of their children would you expect to have the same phenotype as the father? A) 2 B) 3 C) 4 D) 6 E) 8
b
A newly-discovered operon is controlled by a regulator protein. The regulator is inactive unless it is bound by a small molecule that causes a change in the shape of the regulator. If a mutation prevents the regulator from binding to the small molecule, the operon will be constitutively expressed. What type of operon is this? A) negative inducible. B) negative repressible. C) positive inducible. D) positive repressible. E) catabolite repressible.
b
A normal vision man and his color-blind wife have a Kleinfelder's syndrome son with normal vision. In which parent and in what cell division phase did the chromosomal nondisjunction occur to give rise to the son's genotype? A) in the mother in meiosis I. B) in the father in meiosis I. C) in the mother in meiosis II. D) in the father in meiosis II. E) in either parent in somatic cell mitosis.
b
A spliceosome is a large ribonucleoprotein complex located in the ___________. A) cytoplasm B) nucleus C) nucleolus D) endoplasmic reticulum E) golgi
b
A three-point testcross is key to genetic mapping because it allows one to determine A) the number of linkage groups on a chromosome. B) the frequency of double crossovers. C) which is the epistatic gene. D) the number of alleles at a locus. E) A + B
b
An XY individual who has a mutation that deletes the SRY locus A) would develop as a phenotypic male. B) would develop as a phenotypic female. C) would exhibit X-inactivation. D) A & C E) B & C
b
An anticodon is part of a _______ molecule. A) mRNA B) tRNA C) rRNA D) snRNA E) miRNA
b
Bacterial gene expression is controlled primarily at the level of A) chromatin modification. B) transcription initiation. C) RNA processing. D) mRNA transport. E) RNA silencing.
b
Claudia has two brothers who are colorblind, an X-linked recessive condition. Claudia and her parents have normal vision, but her mother's father is colorblind. Claudia marries Peter who has normal vision. Claudia and Peter have a daughter, Daisy and a son, James. What is the probability that James is colorblind? A) 0 B) 1/4 C) 1/2 D) 3/4 E) 1/8
b
Identify the 6-bp palindrome within the double-stranded DNA sequence below: 5' - ATTCAAGCTTGAGCTGAGTGGCGTTA - 3' 3' - TAAGTTCGAACTCGACTCACCGCAAT - 5' A) 5' - ATTCAA - 3' B) 5' - AAGCTT - 3' C) 5' - TTGAGC - 3' D) 5' - GAGCTG - 3' E) 5' - GCGCGT - 3'
b
In the "beads-on-a-string" description of eukaryotic chromatin, A) the bead is a nucleotide. B) the bead is a nucleosome. C) the string is a histone. D) the string is a nucleotide. E) A & C
b
Leber's optic neuropathy is degenerative disease that results in blindness. It is caused by a mutation that affects cellular respiration to reduce ATP production. This genetic disorder can be passed from an affected A) woman to her daughter but not her son. B) woman to her daughter or her son. C) man to his daughter but not his son. D) man to his son but not his daughter. E) man to his son or his daughter.
b
Okazaki fragments are produced because A) DNA polymerase synthesizes nucleic acid only in the 3' to 5' direction. B) lagging strands are synthesized discontinuously. C) DNA strands are parallel to each other. D) leading and lagging strands are synthesized at different times. E) All of the above.
b
Restriction endonucleases A) were identified as a defense mechanism against viruses by protists. B) can be used to create DNA fragments with cohesive ends. C) are used to cut DNA or RNA at defined sequences. D) All of the above. E) None of the above.
b
The difference between PCR and real-time PCR is that A) real-time PCR can amplify DNA a billion-fold within just a few hours, while standard PCR cannot. B) real-time PCR can measure the amount of DNA amplified as the reaction proceeds, while standard PCR cannot. C) real-time PCR can determine the DNA sequence, while standard PCR cannot. D) real-time PCR uses DNA polymerase, while standard PCR does not. E) real-time PCR requires primers, while standard PCR does not.
b
The somatic cell of a gorilla contains 48 chromosomes. How many chromosomes would be present in the first polar body produced during oogenesis? A) 48 B) 24 C) 12 D) 96 E) 6
b
Under which condition would the trp operon be transcribed at the highest level? A) high tryptophan concentration B) low tryptophan concentration C) a mutation in the promoter sequence D) a mutation in the regulator gene E) a mutation in one of the structural genes in the operon
b
Which feature of the rho protein is primarily responsible for its ability to cause termination of transcription? A) Recognizing secondary structure in RNA B) Helicase activity C) Exonuclease activity D) RNA-binding activity E) Polymerase activity
b
Which is NOT required for eukaryotic transcription? A) ribonucleotides B) RNA primers C) DNA template D) RNA polymerase E) promoter
b
Which statement is true for BOTH bacterial and eukaryotic transcription? A) Transcription occurs in the cytoplasm. B) Transcription produces rRNAs. C) Different genes have different promoters that are recognized by different RNA polymerases. D) Transcription termination is Rho-dependent. E) Core enzyme plus sigma factor are required together in the initiation step.
b
X-inactivation begins with expression of the Xist long noncoding RNA that coats one X chromosome. The coating RNA then recruits a protein complex that will A) acetylate histones to alter chromatin structure. B) methylate histones to alter chromatin structure. C) phosphorylate DNA to alter chromatin structure. D) form stronger hydrogen bonds between the DNA bases. E) activate the operator sequences at all operons.
b
Mitotic cell division has roles in all of the processes below, EXCEPT A) growth of multicellular organisms. B) reproduction of bacteria. C) cell regeneration after injury. D) asexual reproduction of unicellular organisms. E) fusion of eggs and sperm in sexual reproduction
b or e
A geneticist attempts to insert a fragment of cat DNA into the LacZ gene of the pUC19 cloning plasmid and uses the plasmid to transform bacteria. The transformed bacteria is then grown on selective media plus X-gal. How can the geneticist identify bacteria carrying a recombinant plasmid containing cloned cat DNA? A) Only bacteria with the recombinant plasmid will produce living colonies. B) Bacteria with the recombinant plasmid will produce blue colonies. C) Bacteria with the recombinant plasmid will produce white colonies. D) Bacteria with the recombinant plasmid will produce white and blue colonies. E) Bacteria with an empty (non-recombinant) plasmid will produce white colonies.
c
DNA replication in eukaryotes differs from replication in prokaryotes in that: A) DNA replication in eukaryotes is conservative, whereas in prokaryotes it is semiconservative. B) eukaryotes have bidirectional replication from an origin, whereas in prokaryotes replication proceeds in one direction from an origin. C) eukaryotic chromosomes have many separate origins of replication, whereas prokaryotic chromosomes have a single origin of replication. D) linear eukaryotic chromosomes are replicated by a mechanism called theta replication, whereas circular prokaryotic chromosomes are replicated by the rolling circle mechanism. E) eukaryotes synthesize Okazaki fragments, whereas in prokaryotes do not.
c
From the cross AB/ab ´ ab/ab, what is the recombination frequency if the progeny numbers are 38 AB/ab, 32 ab/ab, 16 Ab/ab, and 14 aB/ab? A) 14% B) 16% C) 30% D) 38% E) 70%
c
How does an alkylating agent modify DNA to cause a mutation? A) It will form pyrimidine dimers. B) It will oxidize a guanine base. C) It will add methyl or ethyl groups to a nitrogenous base. D) It will deaminate a cytosine base. E) It will do any of the above.
c
If the genetic distance between genes X and Y is 16 map units, the distance between Z and X is 4 map units, and the distance between Y and Z is 12 map units, what is the order of these 3 genes? A) Z X Y B) X Y Z C) X Z Y D) Z Y X E) Cannot be determined
c
In CRISPR technology, a guide RNA A) silences transcription of a target RNA. B) enables bacteriophage to evade bacteria defenses. C) directs an endonuclease to make a double-strand break at a target DNA sequence. D) prevents translation of a target RNA. E) interferes with Cas9 binding.
c
In a testcross for two genes, what types of gamete are produced if the genes are independently assorting? A) 100% recombinant B) > 50% but < 100% recombinant C) 50% recombinant D) > 0% but < 50% recombinant E) 0% recombinant
c
In cats, a curled ears allele (E) is dominant over normal ears (e). Black fur results from an independently assorting allele (G) that is dominant over an allele for gray fur (g). Your male gray cat with normal ears mates with your female black cat with curled ears. They have a litter of 10 kittens. All kittens have black fur and 5 have curled ears. When your female cat later mates with a stray gray cat with curled ears, she has a litter of 8 kittens, all of which have black fur and curled ears. What is the genotype of the stray male? A) GG EE B) Gg ee C) gg EE D) gg Ee E) gg ee
c
In humans, oculocutaneous albinism (OCA) is an autosomal recessive disorder characterized by the absence pigmentation in skin, hair, and eyes that is determined by a single gene. Normal pigmentation (A) is dominant over albinism (a). If both parents have normal pigmentation, what are the possible genotypes of their children? A) normal or albinism B) normal only C) AA, Aa, or aa D) AA or aa only E) aa only
c
Initiation of transcription in bacteria consists of all of the following steps EXCEPT: A) unwinding of DNA forming a transcription bubble. B) binding of the holoenzyme to the Pribnow box. C) recognition of the promoter by RNA molecules. D) movement of the RNA polymerase from the promoter. E) All of these are steps in initiation.
c
One way that bacterial and eukaryotic RNAs differ is that only eukaryotic mRNAs have _______________________. A) a 5' leader B) a 3' trailer C) a poly(A)tail D) codons E) a ribosome-binding site
c
Researchers hypothesized that the first genetic material was most likely a A) catalytic DNA. B) reverse transcriptase. C) self-replicating RNA. D) self-replicating DNA. E) DNA polymerase.
c
The 2 nucleic acid polymers that make up a double-stranded DNA molecule are A) found only in eukaryotes. B) each composed of only C and G or A and T. C) held together by hydrogen bonds. D) identical in nucleotide sequence. E) transported to a ribosome to form a polypeptide.
c
The chromosomes of both eukaryotic cells and prokaryotic cells A) have telomeres. B) are rod-shaped. C) have origins of replication. D) have centromeres. E) bind spindle microtubules.
c
The mismatch repair system of enzymes A) is only present in bacterial cells. B) can repair a thymine dimer. C) can identify the old (parent) strand in a double helix because it is methylated. D) can identify the newly-synthesized strand in a double helix because it is methylated. E) can recognize a mismatch in a double helix because it is methylated.
c
The nucleotide base composition for a newly-discovered virus is listed below. What canyou say about its genome? A G C T U 21.8% 23.0% 26.2% 0.0% 29.0% A) It is composed of single-stranded DNA. B) It is composed of double-stranded DNA. C) It is composed of single-stranded RNA. D) It is composed of double-stranded RNA.
c
Two genes R and T are 16 map units apart. The heterozygote shown below is mated to a homozygous recessive r t / r t. What proportion of the offspring is expected to be dominant for both traits? R t r T A) 32% B) 16% C) 8% D) 4% E) 16% R and 32% T
c
What is the function of cAMP in regulation of the lac operon? A) It reduces the lactose concentration. B) It increases the glucose concentration. C) It activates an activator protein. D) It activates a repressor protein. E) It reduces the glucose concentration.
c
What would Avery, Macleod, and McCarty have concluded if their results had shown that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence? A) that DNA was the genetic material B) that protein was the genetic material C) that RNA was the genetic material D) that DNAse or protease, but not RNase, stimulates transformation E) none of the above
c
Which of the following statements about the role of histone proteins in regulating gene expression is correct? A) Acetylation of histone proteins usually results in repression of transcription. B) Addition of methyl groups to the tails of histone proteins always results in activation of transcription. C) Highly condensed DNA bound to histone proteins represses gene expression. D) Modification of the H1 histone always activates transcription. E) All statements above are correct.
c
Which statement about eukaryotic transcription is NOT correct? A) The TATA box is a consensus sequence crucial for transcription initiation. B) RNA polymerase II transcribes protein-coding genes. C) TAATAA is the consensus transcription termination sequence. D) Rat 1 is an exonuclease that degrades RNA. E) A gene may be transcribed by multiple RNA polymerases simultaneously.
c
Which statement below does NOT correctly describe one possible route for the flow of genetic information that produces a virus? A) Viral DNA that is transcribed into RNA. B) Viral RNA that is transcribed into RNA. C) Viral DNA that is reverse transcribed into RNA. D) B and C are both NOT correct. E) A and B and C are all NOT correct.
c
Which statement can NOT be concluded from Mendel's experiments with pea plants? A) Only one allele determines the phenotype in heterozygous individuals. B) Combinations of alleles found in parents may differ from the combinations found in their offspring. C) Parents with dominant phenotypes always have offspring with dominant phenotypes. D) Offspring inherit only one of two possible alleles per gene from each parent. E) All of the statements above can be concluded from Mendel's experiments.
c
Which statement is true? A) The separation of the two alleles at a heterozygous locus during gamete formation demonstrates the principle of independent assortment. B) When a Bb individual is crossed to a bb individual, the phenotypic ratio of the offspring is 3:1. C) An individual inherits its genotype, not its phenotype. D) A cross between two true-breeding individuals that differ in a characteristic is a dihybrid cross. E) Mendel's pea plant experiments demonstrated the concept of incomplete dominance.
c
You are studying a new bird species. You measure the amount of DNA in cells at various stages of meiosis, and find that each contains either 5 pg or 10 pg or 20 pg. Which amount of DNA was found in a cell in Prophase I? A) 5 pg B) 10 pg C) 20 pg D) either 5 pg or 10 pg E) either 10 pg or 20 pg
c
You just found a cute tortoiseshell cat hiding in your shed with a litter of 5 new kittens: an orange female, 2 black males, and 2 tortoiseshell females. What can you say about the cat that fathered the kittens? A) He must have tortoiseshell fur. B) He must have black fur. C) He must have orange fur. D) He could have either orange fur or black fur. E) He could have orange or black or tortoiseshell fur.
c
A loss-of-function mutation will behave as a _______ allele. A) dominant B) co-dominant C) incompletely-dominant D) recessive E) silent
d
A recombination frequency of 14% translates to what distance on a genetic map? A) 0.14 m.u. B) 1 m.u. C) 7 m.u. D) 14 m.u. E) 28 m.u.
d
Cell division by mitosis produces A) four daughter cells that are genetically the same. B) daughter cells with half the number of chromosomes. C) daughter cells that are genetically variable. D) two daughter cells with identical chromosomes. E) daughter cells with twice the number of chromosomes
d
Coat color in Labrador retrievers depends on two interacting loci. The pigment producing locus has Black (B) and brown (b) alleles. The Extended locus (E) allele allows pigment to be deposited and the (e) allele prevents pigment deposition. A dog breeder mated his prized yellow Labrador male to a new brown Labrador female, hoping to produce more yellow puppies, but the litter consisted of 5 black puppies and 4 brown puppies. What can you tell him about his dogs? A) His yellow male must have genotype BB ee. B) The brown female must have genotype Bb ee. C) His yellow male must have genotype Bb Ee. D) The black puppies must have genotype Bb Ee. E) The brown puppies must have genotype bb EE.
d
Codons that specify the same amino acid are said to be _______. A) wobbly B) sense codons C) hypothetical D) synonymous E) anonymous
d
Crossing over occurs during A) late anaphase I. B) metaphase II. C) early anaphase II. D) prophase I. E) Telophase I.
d
How would the deletion of the Shine-Dalgarno sequence affect a bacterial mRNA? A) Replication would not occur. B) Transcription would not occur. C) Transcription would occur at a slower rate. D) Translation would not occur. E) Translation would occur at a slower rate.
d
If it occurs in a gene's protein-coding sequence, _______ may result in a frameshift mutation. A) a nucleotide deletion B) an unequal crossover event C) strand slippage during replication D) Any of the above may change the reading frame. E) None of the above would change the reading frame.
d
In dusky moths, long wings (W) are dominant over short wings (w) and red eyes (R) are dominant over orange eyes (r). A moth homozygous for long wings and red eyes is crossed with a short wing orange eye moth. The F1 offspring are intercrossed and produce F2 offspring. The F2 moths will have the phenotypic ratio: A) all long wings and red eyes B) 1/2 long wings and red eyes; 1/2 short wings and orange eyes C) 1/4 long wings and red eyes; 1/4 long wings and orange eyes; 1/4 short wings and red eyes; 1/4 short wings and orange eyes D) 9/16 long wings and red eyes; 3/16 long wings and orange eyes; 3/16 short wings and red eyes; 1/16 short wings and orange eyes E) all short wings and orange eyes
d
In horses, some coat colors are determined by the incompletely dominant genes CB and CW. Palomino horses have a golden coat, while chestnut horses a have a brown coat, and cremello horses have a creamy white coat. Over the years, your pair of palominos have produced offspring in the following ratio: 1 chestnut: 2 palomino: 1 cremello. Which genotype below matches the correct coat color phenotype? A) CB / CW cremello B) CB / CB palomino C) CW / CW chestnut D) CB / CW palomino E) CB / CW chestnut
d
In the XX/XO sex-determining system A) a female has one X chromosome, and it is inherited from her father. B) a male has one X chromosome, and it is inherited from his father. C) a female's X chromosome could be inherited from her father's father. D) a male's X chromosome could be inherited from his mother's father. E) a female's X chromosome could be inherited from either her mother's mother or her father's father.
d
One of the differences between bacteria and eukaryotic cells that affect how their genes are regulated is that A) transcription and translation are uncoupled only in bacteria. B) splicing is regulated only in bacteria. C) regulatory proteins bind DNA sequences only in eukaryotes. D) histone proteins are chemically modified only in eukaryotes. E) cis-regulatory elements are present only in eukaryotes.
d
Primase requires a _______ template and _______ nucleotides to initiate primer synthesis. A) DNA; DNA B) RNA; RNA C) RNA; DNA D) DNA; RNA E) lagging; DNA
d
Special regions of chromosomes called A) telomeres serve as the assembly point for spindle microtubules. B) centromeres have a high frequency of crossovers. C) telomeres contain the sequence GGGCCC repeated 15 times. D) centromeres are composed of heterochromatin. E) telomeres have a relatively high concentration of gene sequences.
d
Supercoiling of DNA is usually A) positive, because it compacts the chromosome more efficiently than negative. B) positive, because it makes unwinding the DNA easier than negative. C) negative, because it compacts the chromosome more efficiently than positive. D) negative, because it makes unwinding the DNA easier than positive. E) None of the above.
d
Termination of translation requires A) a Kozak sequence. B) binding of the poly(A) tail of an mRNA to the ribosome. C) an aminoacyl-tRNA synthetase. D) a stop codon. E) binding of release factors to the P site of the ribosome.
d
The Watson-Crick model of the DNA double helix predicted rules for base-pairing, including A) 3 bonds between G and T. B) 2 bonds between G and C. C) 3 bonds between A and T. D) 2 bonds between A and T. E) 3 bonds between C and T.
d
The genetic makeup of an organism is referred to as its ________. A) phenotype B) locus C) chromatin D) genome E) phylogeny
d
Under which condition would the lac operon produce the greatest amount of betagalactosidase? A) lactose plus glucose both present B) no glucose and no lactose present C) The presence of either lactose or glucose will result in same amount. D) lactose present but not glucose E) glucose present but not lactose
d
Unicorn coat brightness results from a genetic maternal effect. An autosomal allele for sparkly coat (D) is dominant over the allele for dull coat (d). A sparkly male Dd is crossed to a dull female of genotype dd. We expect their herd of unicorn offspring to have the following genotypes and phenotypes: A) 50% Dd sparkly and 50% dd dull B) 50% Dd dull and 50% dd sparkly C) 50% Dd sparkly and 50% dd sparkly D) 50% Dd dull and 50% dd dull E) 100% Dd sparkly
d
What is the function of dideoxyribonucleoside triphosphates (ddNTPs) in Sanger DNA sequencing? A) ddNTPs serve as primers for DNA polymerase. B) ddNTPs serve as primers for reverse transcriptase. C) ddNTPs prevent DNA synthesis from continuing at the 5' end of a growing strand. D) ddNTPs prevent DNA synthesis from continuing at the 3' end of a growing strand. E) ddNTPs carry more energy than dNTPs.
d
Which DNA region is located upstream of the eukaryotic transcription start site? A) terminator B) intron splice site C) sigma factor D) core promoter E) rut site
d
Which combination of DNA sequences make up a transcription unit (gene) in bacteria? A) transcription start site, RNA coding region, terminator B) transcription start site, RNA coding region C) RNA coding region D) promoter, transcription start site, RNA coding region, terminator E) promoter, transcription start site, RNA coding region
d
Which of the following statements about translation is correct? A) A special tRNA that does not have an attached amino acid binds to a stop codon to terminate translation. B) The first three bases at the 5' end of every RNA are AUG. C) The codon methionine appears only at the beginning of the protein coding region of an mRNA, not in the middle or at the end. D) In eukaryotes, the 5' cap and the 3' poly(A) tail are involved in translation initiation. E) Ribosomes move along an mRNA in the 3' to 5' direction.
d
Which statement describes epigenetic gene regulation? A) Processing of exons in mRNA that results in a single gene coding for multiple proteins. B) mRNA modifications such as 5' cap addition and 3' polyA tail addition. C) Modifications to a polypeptide product such as cleavage or folding. D) Heritable changes in gene expression that occur without altering the DNA sequence. E) A gene cluster controlled by a single promoter that transcribes a single mRNA.
d
You are studying a fish that has 4 chromosome pairs (2n = 8). How many different combinations of chromosomes can this fish generate in its gametes? (Assume that no crossing over occurs between homologous chromosomes.) A) 2 B) 4 C) 8 D) 16 E) 32
d
________ is an example of post-transcriptional gene regulation. A) RNA interference B) mRNA degradation C) Pre-mRNA splicing D) A and B and C are all examples. E) A and B are both examples.
d
______ is not an example of aneuploidy. A) Trisomy 21 B) Turner's syndrome C) XYY D) Tortoiseshell coat color E) Colorblindness
d or e
A brown dog Ruff is mated with a beige dog Petunia. They have a litter of 5 beige puppies and 4 brown puppies. When the beige puppies are interbred, they produce all beige puppies. What can you conclude about the genotypes of these dogs? A) Ruff must be BB. B) The brown puppies must be bb. C) Petunia must be Bb. D) The beige puppies could be either Bb or BB. E) None of these genotypes are correct.
e
A gene that codes for a protein that interacts with other nucleotide sequences to affect their transcription or translation is called a A) constitutive gene. B) structural gene. C) protein-coding gene D) cis-acting gene. E) regulatory gene.
e
A restriction enzyme cleaves a 10 kbp (=10,000 bp) linear DNA molecule into 4 fragments. The fragments, sized 4 kbp, 3 kbp, 2 kbp, and 1 kbp are separated in an agarose gel by electrophoresis. Which fragment would you expect to find closest to the positive electrode of the gel by the end of the experiment? A) 10 kbp B) 4 kbp C) 3 kbp D) 2 kbp E) 1 kbp
e
Consider the following three-point testcross: A B C ´ a b c a b c a b c Which of the following is NOT a possible progeny genotype? A) A B C a b c B) a B C a b c C) A b C a b c D) a b c a b c E) A B C A B C
e
Eukaryotic chromosomes differ from bacterial chromosomes in all of the ways described below EXCEPT: A) Only eukaryotic genomes are divided among multiple linear chromosomes. B) Only eukaryotic DNA is wrapped around histones. C) Only eukaryotic chromosomes have a centromere. D) Only eukaryotic chromosomes have telomeres. E) Eukaryotes and bacteria differ in all of these ways.
e
For a(n) ______ operon, transcription normally does NOT take place, and it is kept off by a(n) ______. A) repressible; activator B) repressible; repressor C) constitutive; silencer D) inducible; activator E) inducible; repressor
e
GAL4 functions as a/an _________ to control expression of genes required for galactose metabolism in yeast. A) position-dependent transcriptional regulatory element B) translational regulator C) operator D) cis-acting regulatory DNA sequence E) trans-acting regulatory protein
e
If a genetic disease is passed from a father to both of his daughters but not his son, you can conclude that the disease allele must A) be an autosomal dominant. B) be an autosomal recessive. C) be an X-linked dominant. D) be an X-linked recessive. E) not be Y-linked.
e
In a newly sequenced insect, scientists determine that 29% of the bases in its DNA are guanosine (C). What percentage of the bases are expected to be adenine (A)? A) 71% B) 58% C) 42% D) 29% E) 21%
e
In apple trees, tall (D) is dominant over dwarf (d) and red fruit (Y) is dominant over yellow fruit (y). A true-breeding tall plant with red fruit is cross to a true-breeding dwarf plant with yellow fruit. One F1 progeny plant is testcrossed. It produces 100 progeny plants that fall into the following 4 genotypic classes: Dd Yy 41 dd yy 39 Dd yy 12 dd Yy 8 These results indicate that: A) the heterozygous F1 parent is D y / d Y. B) the heterozygous F1 parent is D Y / d y. C) these loci for plant height and fruit color are not linked. D) these loci for plant height and fruit color are linked and 20 m.u. apart. E) Both B and D are correct.
e
In bacteria, the holoenzyme consists of the core enzyme plus __________________. A) rho factor B) TFIID C) TBP D) omega subunit E) sigma factor
e
In eukaryotes, assembly of the basal transcription apparatus requires all of the components below EXCEPT A) core promoter B) general transcription factors C) TATA box D) RNA polymerase E) enhancer
e
Mendel's Principle of Segregation applies to which chromosome behavior during cell division? A) Arrangement of chromosomes along metaphase plate of mitosis B) Alignment of homologous chromosomes during prophase I C) Separation of sister chromatids during meiosis I D) Duplication of chromosomes during S phase E) Separation of homologous chromosomes during meiosis I
e
One source of genetic variation in the cells produced by meiosis is A) the arrival of chromosomes at the spindle poles in Telophase I. B) chromosomes condensing at Prophase II. C) the formation of the nuclear envelope at interkinesis. D) the division of the cytoplasm at cytokinesis. E) crossing over at Prophase I.
e
Telomerase uses _____________ to synthesize new DNA. A) exonuclease activity B) a replication fork C) an Okazaki fragment D) a DNA template E) an RNA template
e
The Watson Crick model proposed the following characteristics for the 3D structure of the DNA double helix, EXCEPT: A) the polynucleotide strands are antiparallel. B) the nitrogenous bases extend perpendicularly to the inside of the helix backbone. C) the diameter of the double helix is 2 nm. D) the double helix consists of 10 base pairs per turn. E) the base-pairing is specifically purine with purine or pyrimidine with pyrimidine.
e
What type of bond does DNA ligase create between adjacent nucleotides? A) Hydrogen B) Ionic C) Metallic D) Ribonucleotide E) Phosphodiester
e
Which of the following RNA molecules participates in the process of translation in both eukaryotes and bacteria? A) crRNA B) snRNA C) snoRNA D) siRNA E) tRNA
e
Which of the following is NOT a typical characteristic of human traits that follow an autosomal recessive inheritance pattern? A) They often "skip" generations. B) They appear equally in males and females. C) Parents of affected children are often phenotypically normal themselves. D) All of the above are characteristic of autosomal recessive inheritance. E) Approximately half of the children of carriers will be affected.
e
Which of the following is an example of an epigenetic change in eukaryotes? A) the addition of acetyl groups to thymines in a gene B) the removal of guanines from a gene C) the addition of phosphate groups to cytosines in a gene D) the removal of an AT base pair from a gene E) the addition of acetyl groups to amino acids of a histone tail
e
Which statement regarding ribosomes and ribosomal RNA is correct? A) The large subunit of a ribosome is made up entirely of ribosomal RNA molecules. B) The small subunit of a ribosome is made up entirely of ribosomal proteins. C) A single tRNA binding site forms at the junction of each small and large subunit. D) Only eukaryotic rRNAs undergo extensive processing before assembly into ribosomes. E) Both eukaryotic and prokaryotic genomes contain multiple copies of rRNA genes.
e
