Intro to Cell - Moon - Exam 5

Pataasin ang iyong marka sa homework at exams ngayon gamit ang Quizwiz!

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. Write the third codon of this message and label the ends of the codon appropriately. For example if the codon was 5'AAA3' you would enter your answer in the following format: 5'AAA3'

5'GUU'3

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. What would be the template strand DNA for this third codon? Be sure to label the ends as described in the parts above.

3'CAA'5

True or false? Regulatory and basal transcription factors regulate transcription by binding to the promoter.

False

True or false? One possible way to alter chromatin structure such that genes could be transcribed would be to make histone proteins more positively charged.

False

Which of the following events in transcription initiation likely occurs last?

RNA polymerase binds to the promoter of the gene

Suppose that an induced mutation removes most of the 5' end of the 5' UTR of an mRNA. What is most likely to happen?

Removal of the 5' UTR also removes the 5' cap and the mRNA will quickly degrade.

Which of the following is a protein produced by a regulatory gene?

Repressor

Which of the following regulatory elements is not composed of DNA sequences?

Activators

Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus?

-A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA. -Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes. -A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA.

A DNA template strand has the following base sequence. 5' TTACACGTGGACTGAGGACCTCTCCAT 3' Answer the following: What is the complementary strand of this template? (label the ends) Input your answer by labeling the end with the prime number followed by a space and the the nucleotide letters suquentially (no spaces) and finally at the end of the base sequence, insert a space followed by the prime number for the end. For example if the answer was as follows use this format: 5' AAAGCATTAGCC 3'

3' AATGTGCACCTGACTCCTGGAGAGGTA 5'

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. What is the anticodon that would match the third codon in the mRNA, shown above. Again be sure to label the ends appropriately and write out the anticodon in the appropriate direction that it would pair with the codon (Hint remember the codon is 5' to 3')

3'CAA'5

A DNA template strand has the following base sequence same as above repeated for convenience. 5' TTACACGTGGACTGAGGACCTCTCCAT 3' Write the mRNA in the same direction that it would be produced by the RNA pol enzyme and label the ends using the same format as in Part A above.

5' AUGGAGAGGUCCUCAGUCCACGUGUAA 3'

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. What would be the coding strand DNA for the third codon? Be sure to label the ends as described in the parts above.

5'GTT'3

The start codon is followed by an open reading frame containing 27 more codon words that make sense (i.e. are code words for an amino acid), followed by a stop codon. This would suggest that the peptide hormone is 28 amino acids in length. It is known that the biologically active hormone vasopressin is only 9 amino acids in length. Explain this difference.

A start codon appears several times within the sequence, so even though it seems to have 28 parts at first, it can be cut down substantially by starting at a start codon rather than the first one you see. This means that the amino acids from met to Ala act as the signal sequence that will be cleaved off during post translational processing. The use of vasopressin in times of dehydration makes sense, because the peptide hormone should restart and work harder to retain water as dehydration continues to get more severe, and it won't reach a stop codon until the body is rehydrated. This is why the entire sequence has several start codons, but only one stop codon.

Use this information to answer the question(s) below. Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the promoter for the lac operon to the region between the beta galactosidase (lacZ) gene and the permease (lacY) gene, which of the following would be likely?

Beta galactosidase will not be produced.

There is a mutation in the repressor that results in a molecule known as a super-repressor because it represses the lac operon permanently. Which of these would characterize such a mutant?

It cannot bind to the inducer.

Which of the regulatory sequences above would be bound by transcription factors that would result in the production of uniquely different proteins in liver cell compared to muscle cells?

Enhancer

Give two reasons why this mutation might prevent the endopeptidase enzyme that cleaves the C peptide from being able to bind and catalyze this reaction.

Essay question

Which of the following regulatory DNA sequences might be located thousands of nucleotides away from the transcription start site of a gene?

Enhancer

What are the critically important functions of the 5'm7-Cap? Be sure that you include all important functions!

Main functions of the 5' cap are: 1) Regulation of nuclear export 2) Prevention of degradation 3) Promotion of translation 4) Promotion of 5' proximal intron excision

Use the three letter codes and separate each with a dash. For example Met-Ser-Try-Phe (no commas or spaces).

Met-Glu-Arg-Ser-Ser-Val-His-Val

Which of the following terms describes the DNA-protein complexes that look like beads on a string?

Nucleosome

Of the three modes of gene regulation shown in Figure 18.1, which is the fastest in response time?

Post-transcriptional control

According to the lac operon model proposed by Jacob and Monod, what is predicted to occur if the operator is removed from the operon?

The lac operon would be transcribed continuously.

Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the operator to the far end of the operon, past the transacetylase (lacA) gene, which of the following would likely occur when the cell is exposed to lactose?

The structural genes will be transcribed continuously.

Of the three modes of gene regulation shown in Figure 18.1, which is the most efficient in resource use?

Transcriptional control

Which codon is connected to the C-terminal of the sequence above? Use the 3 letter code for the amino acid

Val

Which of the following secondary mutations might restore normal regulation to the lac operon in a lacOc mutant?

a LACI mutation that produces a repressor than can recognize the mutated lacOc DNA sequence

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

a frameshift deletion at the beginning of the gene

Allosteric regulation occurs when ______.

a regulatory molecule binds to a protein to change its shape and activity.

Which of the following nucleotide triplets best represents a codon?

a triplet in the same reading frame as an upstream AUG

Jacob and Monod were intellectually primed to draw the conclusions they did concerning regulation of the lac operon. In part, this was due to their fascination with mechanisms of enzyme regulation. They knew that the activity of some enzymes is regulated when their reaction product binds to the enzyme, changing its shape and, therefore, its activity. This knowledge allowed them to easily make the intellectual leap to propose _____.

allosteric regulation of the repressor

Altering patterns of gene expression in prokaryotes would most likely serve an organism's survival by _____.

allowing an organism to adjust to changes in environmental conditions

Use this information to answer the question(s) below. Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the repressor gene (lacI), along with its promoter, to a position at some several thousand base pairs away from its normal position, we would expect the _____.

lac operon will function normally

Transcription of structural genes in an inducible operon _____.

starts when the pathway's substrate is present

The lactose operon is likely to be transcribed when _____.

the cyclic AMP and lactose levels are both high within the cell

When an amino acid is specified by more than one codon, what is usually shared by the set of codons that specify this amino acid?

the first and second bases


Kaugnay na mga set ng pag-aaral

Chapter 5.3 Independence and the Multiplication Rule

View Set

measuring weather \ assignment 15

View Set

AP Physics 2 Unit 2 Progress Check C

View Set

Articulation and Phonological Disorders-Chapter 1

View Set

Chapter 52: Anticoagulant, Antiplatelet, and Thrombolytic Drugs

View Set

Chapter 7 (Clinical Psychology) Completed

View Set

Anatomy and Physiology of Hearing Mechanisms

View Set

Wound Assessment And Measurement

View Set

Chapter 37: Management of Patients with Musculoskeletal Trauma

View Set

Mastering biology cell structure 4.3 - 4.7

View Set