MCB 150 Final Exam Review
The RNA component of telomerase (TERC) functions as a __________. Choose all that apply. (A) guide (B) ribozyme (C) template (D) primer (E) decoy
A and C
Which of the following are typically used to construct a cDNA library? The list does not necessarily contain everything needed. Choose all that apply. (A) DNA ligase (B) Reverse transcriptase (C) Whole cell DNA (D) Primary mRNA transcripts (E) DNA polymerase
A, B, D, E
It is necessary for what signal to be present on a molecule of HIV integrase? (A) ER signal sequence (B) Nuclear localization signal (C) Mitochondrial targeting signal (D) Extracellular matrix binding domain (E) HIV integrase does not require any of these signals.
B
The function of all ncRNAs depends on their ability to _______________. (A) inhibit translation (B) interact with other molecules (C) bind to proteins (D) attach to a cell membrane
B
A cell that does not pass the G1 checkpoint _____. (A) is diverted to a non-proliferative state called G0 (B) has active cdks preventing its entry into S-phase (C) will commit to apoptosis (D) progresses into S-phase but is closely monitored (E) All of the above
A
Based on the information you have, which of the four strains is most likely to be the one causing the illness? (A) Strain #1 (B) Strain #2 (C) Strain #3 (D) Strain #4
A
Ca2+ release plays a role in cell signaling most similar to _______________. (A) the conversion of ATP to cAMP (B) the direct activation of a transcription factor (C) the phosphorylation of a membrane receptor protein kinase
A
Consider the following statements about genetic regulation: (1) The LCT gene is primarily regulated at the transcriptional level. (2) It is possible for a mutation in one gene to affect expression of a different gene. Identify the correct option below. (A) Statements 1 and 2 are both true. (B) Statements 1 and 2 are both false. (C) Statement 1 is true, statement 2 is false. (D) Statement 1 is false, statement 2 is true.
A
How does dystrophin stabilize the sarcolemma of muscles? (A) It prevents the stress from sarcomere contraction from degrading the sarcolemma. (B) It holds multiple extracellular matrix proteins together. (C) It coordinates muscle movement by making direct physical contact with neighboring muscle fibers (cells). (D) It maintains the cell in G0 so the membrane does not have to undergo cytokinesis.
A
In the classic experiment performed by Meselson and Stahl, which possible model(s) of DNA replication were disproved after a single round of replication in the presence of the light isotope of nitrogen? Choose all that apply. (A) Conservative (B) Semiconservative (C) Dispersive
A
Maximal expression of the lac operon will only occur in the _______________. (A) presence of lactose and absence of glucose (B) presence of glucose and absence of lactose (C) presence of both glucose and lactose (D) absence of both glucose and lactose
A
Scientists have summarized a typical viral replicative cycle into six steps, although not all viruses proceed through each step. Which step(s) are not found in the replicative cycle of every virus? Choose all that apply. (A) Integration (B) Synthesis of viral components (C) Release (D) Entry (E) Assembly of viral particles (F) Attachment
A
The mutation in the LCT gene among people of Northern European descent results in _______________. (A) increased binding of an activator protein to an enhancer sequence (B) increased binding of a repressor protein to a silencer sequence (C) decreased binding of an activator protein to an enhancer sequence (D) increased binding of a repressor protein to an enhancer sequence (E) decreased binding of a repressor protein to a silencer sequence
A
Typical HA RNA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3' Strain #3 RNA5'UAACCAUGAAGACCAUCAUUGCUUUGAGCUACAUUC 3' How is the HA protein produced by the new flu virus different from a typical flu virus? (A) There is no difference. (B) One amino acid has been changed. (C) Several amino acids have been changed. (D) The protein is too short. (E) The protein is too long.
A
Using information on this website: https://www.thegenehome.com/how-does-gene-therapy-work/techniques which type of gene therapy do you feel would be more beneficial for Lee F.? (A) in vivo (B) ex vivo
A
What is the probability that a mouse pup (male or female) from a heterozygous normal-size mother (Ifg2 Igf2-) and a homozygous dwarf father (Igf2- Igf2-) is normal-sized? (A) 0% (B) 25% (C) 50% (D) 75% (E) 100%
A
Which of the following is not a net product of glycolysis per molecule of glucose? Consider only the reactions of glycolysis and not what may occur before or after. (A) 2 molecules of CO2 (B) 2 molecules of pyruvate (C) 2 molecules of ATP (D) 2 molecules of NADH (E) All of the above are net products of glycolysis per molecule of glucose.
A
True or False: An initial (or pre-)mRNA transcript contains all the exons and introns that are part of the gene from which it is transcribed. (A) True (B) False
A Since RNA polymerases carry out transcription prior to intron removal, the primary transcript contains all the information in a gene, including introns and exons that will not be part of the mature mRNA.
True or False: A single gene can specify more than one unique protein. (A) True (B) False
A This is the essence of alternative splicing. In eukaryotes, removal of introns allows for different combinations of exons to be used, resulting in different mature mRNAs, and consequently different proteins being translated.
Identify the treatments most likely to be effective for patients with TNBC. Choose all that apply. (A) surgery (B) chemotherapy (docetaxel, carboplatin) (C) trastuzumab (D) tamoxifen
A and B
The CALCA gene would be found in DNA extracted from which tissue type? Choose all that apply. (A) Neural tissue (B) Thyroid tissue
A and B Because DNA contains all introns and exons for all of the genes in an organism, the same DNA is found in all cell types in that organism.
Identify the correct statement(s) about p53. Choose all that apply. (A) p53 is a transcription factor (B) p53 levels fall when DNA has been damaged, promoting repair (C) p53 can activate expression of genes that lead to apoptosis (D) A nonsense mutation in p53 would cause a cell to be stalled at the G1 checkpoint
A and C
You have discovered a diploid, multicellular organism with sex chromosome production and function resembling humans. However, in this life form, the males have two copies of the sex chromosome M (MM), while the females have one copy of the sex chromosome M and one copy of the sex chromosome J (MJ). Which of the following statements is most likely correct about this life form? Choose all that apply. (A) The males of this species inactivate an M chromosome. (B) Females of this species have structures resembling Barr bodies in their cells. (C) Mosaicism of M-linked traits occurs in males of the species. (D) Males and females of this species are equally likely to practice dosage compensation.
A and C
Identify the correct statement(s) about bacterial cell division. Choose all that apply. (A) Many bacterial species divide by a process called binary fission. (B) Bacterial cell division requires proteins that are evolutionarily related to actin and tubulin. (C) Repeated rounds of division of a bacterial cell on solid growth medium leads to a colony of identical cells. (D) During division, plasmids are distributed to the daughter cells such that each cell receives one or more copies of that plasmid.
A, B, C, D
Identify the possible targets of regulation of gene expression/protein activity in eukaryotes. Choose all that apply. (A) Transcriptional initiation (B) RNA processing (C) Translational initiation (D) mRNA stability (E) Protein modification/phosphorylation
A, B, C, D, E
Theoretically, a medication that reduces the activity of CGRP and therefore prevents migraine headaches could _____________________. Choose all that apply. (A) target and block CGRP directly (B) target and block CGRP receptors on cells (C) prevent transcription of the CALCA gene (D) prevent translation of CALCA mRNA molecules
A, B, C, and D While some of these regulatory possibilities would have undesired consequences, they are all theoretically possible.
Which type(s) of mutation could knock out the function of a gene product? (A) missense (B) nonsense (C) same sense (D) insertion (E) deletion
A, B, D, E
During interphase, a eukaryotic cell would be expected to __________. (A) Grow in size (B) Replicate its DNA (C) Prepare for mitosis (D) Complete cytokinesis
A, B, and C
If an antigen is a protein, then whether or not an antibody binds with the antigen depends on _____________________. Choose all that apply. (A) the amino acid sequence of the antigen (B) the secondary, tertiary, or quaternary structure of the antigen (C) whether or not there is a mutation in the antigen
A, B, and C An antibody is extremely specific for what it will bind to. Changing amino acids changes the three-dimensional shape of the antigen. It can also change the overall three-dimensional structure of the protein, leading to a loss of antibiody binding for that reason as well.
Which of these modifications to a pre-mRNA molecule in eukaryotes will occur before it is considered a mature mRNA molecule? Choose all that apply. (A) Addition of a 5' cap (B) Addition of a poly-A tail (C) Removal of introns and splicing of exons
A, B, and C Full processing of eukaryotic mRNAs includes all three of these activities.
Children receiving chemotherapy or bone marrow transplants to treat cancer have a weakened immune system. Some vaccinations are comprised of a weakened live virus and are not recommended for those who are immunocompromised. What strategies can help protect the immunocompromised individuals in a community? Choose all that apply. (A) Achieve high vaccination rates to provide herd immunity. (B) Vaccinate them even if they are immunocompromised. (C) Create an alternative non-live vaccine. (C) Vaccinate their family and close contacts.
A, C, D
The cell cycle is regulated by checkpoints during _______ phase. (A) G1 (B) S (C) G2 (D) M
A, C, and D
Identify the correct statements about membrane proteins. Choose all that apply. (A) They can aid in the transportation of molecules across membranes. (B) They are used in DNA replication. (C) They can act as cell surface receptors. (D) They are entirely water-soluble. (E) They can be enzymes.
A, C, and E
A cell has three X chromosomes, but one of those chromosomes has a large deletion mutation in its Xic. How many Barr bodies is this cell likely to have? (A) 0 (B) 1 (C) 2 (D) 3
B
A messenger RNA is 918 nucleotides long, including the sequences for the initiator and termination codons, and ignoring the untranslated regions at the 5' and 3' ends. The number of amino acids in the protein made from this mRNA would be __________. (A) 304 (B) 305 (C) 306 (D) 918 (E) 2754
B
An organism's DNA is analyzed and found to contain 27% adenine. What percentage of that organism's DNA would be guanine? (A) 27% (B) 23% (C) 73% (D) 46%
B
Consider the following statements about eukaryotic messenger RNA molecules: (1) The first three bases in a eukaryotic mRNA are AUG and specify a non-modified version of methionine. (2) The last three bases in a eukaryotic mRNA are a stop codon recognized by a single release factor. Determine which one of the statements below is correct. (A) Statements 1 and 2 are both true. (B) Statements 1 and 2 are both false. (C) Statement 1 is true, statement 2 is false. (D) Statement 1 is false, statement 2 is true.
B
Consider the following statements about genomes: (1) There is a linear relationship between the size of a eukaryote's genome and the number of protein-coding genes. (2) Although prokaryotic genomes are typically smaller than eukaryotic genomes, a higher percentage of a prokaryote's genome consists of repetitive sequences. Determine which option below is correct. (A) Statements 1 and 2 are both true. (B) Statements 1 and 2 are both false. (C) Statement 1 is true, Statement 2 is false. (D) Statement 1 is false, Statement 2 is true.
B
Consider the following two statements: (1) Positive regulation of the lac operon involves removing the repressor protein from the operator and allowing transcription to occur. (2)A repressible operon is off by default and can be activated when necessary. (A) Statements 1 and 2 are both true. (B) Statements 1 and 2 are both false. (C) Statement 1 is true, statement 2 is false. (D) Statement 1 is false, statement 2 is true.
B
Disruption of a myosin motor protein is most likely to affect _______________. (A) prophase (B) cytokinesis (C) prometaphase (D) telophase (E) anaphase
B
IF the original mutation in Jacob & Monod's constitutive mutant had been in the operator region and not the lacI gene, would their merozygote results have been the same? (A) Yes (B) No
B
Imetelstat is a drug that inhibits telomerase activity. True or False: imetelstat would be an appropriate antibiotic agent to fight a bacterial infection, but not a viral infection (A) True (B) False
B
In Jacob and Monod's classic experiment studying lac operon regulation in E. coli, their constitutive phenotype was caused by a mutation in the lacI gene leading to a non-functional repressor. What other mutation would have led to the same constitutive phenotype? (A) A mutation in the lac operon core promoter preventing RNA polymerase from binding (B) A mutation in the lacO region preventing repressor from binding (C) A different mutation in the lacI gene leading to a repressor that can bind to the operator but cannot be lifted by inducer molecules (D) A mutation in the lacZ region of the lac operon leading to non-functional β-galactosidase (E) All of the above mutations would lead to the same constitutive phenotype for the lac operon observed by Jacob and Monod.
B
Oligomycin A is a research antibiotic (as opposed to a therapeutic antibiotic) which inhibits ATP synthase by blocking its proton channel. If a mammal is exposed to a high dose of oligomycin A, _______________. Choose all that apply. (A) no ATP will be produced through substrate level phosphorylation (B) no ATP will be produced through oxidative phosphorylation (C) feedback inhibition of glycolysis will be accelerated (D) NADH cannot be oxidized at the electron transport chain (E) the electrochemical gradient will be lost
B
The Lederberg experiment described in your textbook suggests that _______________. (A) mutations are spontaneous, not induced (B) mutations are random, not directed (C) frameshift mutations disrupt protein function more than missense mutations do (D) proto-oncogenes can be mutated into oncogenes
B
Typical HA RNA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3' Strain #1 RNA5'UAACCAUGAGGACUAUCAUUGCUUUGAGCUACAUUC 3' How is the HA protein produced by the new flu virus different from a typical flu virus? (A) There is no difference. (B) One amino acid has been changed. (C) Several amino acids have been changed. (D) The protein is too short. (E) The protein is too long.
B
What is the difference between cancer and tumor? (A) The two terms can be used interchangeably as they are synonymous. (B) Cancer is a disease that eventually disrupts body functions whereas a tumor is a mass of cells with no apparent function in the body. (C) Cancer is a disease which affects men whereas a tumor may affect both men and women. (D) Cancer is a disease of the digestive tract whereas a tumor may develop anywhere in the body.
B
What would you expect cells to be like if they did not have properly functioning p53? (A) The absence of p53 inside cells would cause them to divide more rapidly. (B) The absence of p53 could cause cells to replicate with damaged DNA that could ultimately lead to cancer. (C) The absence of p53 could cause cells to skip mitosis (M phase) and stay in S phase of the cell cycle. (D) The absence of p53 would have no effect on the cells.
B
Which of the following is least likely to be a component of every signal transduction pathway? (A) A molecule to function as a signal (B) An extracellular receptor molecule (C) Molecule(s) that transmit the message (D) A short- or long-term cellular effect
B
Why must the electron transport chain proteins and molecules be embedded in a membrane? (A) So that ATP can be formed (B) So that protons can be compartmentalized and form a gradient (C) So that the product of one reaction can become the reactant of the next reaction (D) So that prosthetic groups can more efficiently bind to electrons (E) All of the above are reasons that an ETC is embedded in a membrane.
B
True or False: If mRNA is extracted and isolated from both thyroid and neuronal cells, the same sets of mature mRNA molecules would be found in both tissue types. (A) True (B) False
B Mature mRNAs have been fully processed, including splicing and possibly alternative splicing. So different sets of mature mRNAs would be found in different tissue types, leading to production of tissue-specific proteins.
Would you expect ALD403 to block activity of the calcitonin protein in the body? (A) Yes (B) No
B The proteins are different, so antibodies specific to CGRP should not affect calcitonin.
A mutation changes the sequence of the Cas1 gene so that Cas1 protein is no longer produced. How will this affect bacterial immunity? (A) The bacteria will have normal ability to defend itself against first and second infections with any bacteriophage. (B) The bacteria will have no defense against the first infection with any new bacteriophage. (C) The bacteria will not have adaptive immunity against any second infections from new bacteriophage. (D) The bacteria will have normal defense against first and second infections with some bacteriophages, but will have no defense against others.
B and C
Identify the most likely ways to turn off transcription of the LCT gene. Choose all that apply. (A) Increase the activity of Activators (B) Decrease the activity of Activators (C) Increase the activity of Repressors (D) Decrease the activity of Repressors
B and C
Mammals like caribou that live in the arctic often have different lipids in the cells of their legs compared to the cells of their internal organs. Their legs get colder than their internal organs, which stay warmer. Identify the adaptations you would expect to find in membrane lipids from the cells of caribou legs as compared to cells from the caribou internal organs? Choose all that apply. (A) The lipids would be more saturated. (B) The fatty acyl tails of the phospholipids would be shorter. (C) The membranes would contain more cholesterol.
B and C
Identify the correct statements about GPCR and/or G-proteins. Choose all that apply. (A) An activated G-protein is a transmembrane protein complex. (B) G-protein cannot interact productively with GPCR in the absence of ligand binding to the GPCR. (C) When an activated G-protein separates into the α subunit and the β/γ dimer, only the α subunit initiates a transduction pathway leading to a cellular response. (D) The α subunit of a G-protein has a nucleotide binding site that is occupied by GDP when the G-protein is in an inactive state
B and D
Identify the differences between a benign tumor and a malignant tumor. Choose all that apply. (A) A benign tumor is considered cancerous, while a malignant tumor is not considered cancerous. (B) The cells in a benign tumor have acquired fewer relevant mutations than the cells in a malignant tumor. (C) A benign tumor is more likely to metastasize than a malignant tumor. (D) A malignant tumor has spread into neighboring tissues, while a benign tumor has not spread to neighboring tissues.
B and D
Identify the item(s) below that are found in both bacteria and eukaryotes. Choose all that apply. (A) Sigma factors (B) 5S rRNA (C) Alternative splicing (D) Aminoacyl tRNA synthetases (E) 5' methylguanosine caps
B and D
Mutations to SRP72 (the RNA component of the signal recognition particle) are known to cause some forms of familial bone marrow failure. Which of the following protein(s) is/are potentially affected by such deleterious mutations? Choose all that apply. (A) Cytochrome c (B) Epidermal growth factor receptor (EGFR) (C) uS7 (a small ribosomal subunit protein from all domains of life) (D) Insulin (a secreted protein)
B and D
Which two of the following strands of DNA would work best as primers for the DNA sequence shown below? 5'-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3' 3'-GGGACCCGAGACATTTACAAAGATTCAC-5' (A) 5′ -GTGAATCTT-3′ (B) 5′ -CACTTAGAA-3′ (C) 5′ -GGGACCCGA-3′ (D) 5′ -CCCTGGGCT-3′
B and D
What experimental question(s) can be addressed by a microarray analysis? Choose all that apply. (A) The sequence of a certain gene in an organism (B) If a certain gene is being expressed in a specific tissue (C) If a certain gene is being expressed in an organism (D) If a certain gene is expressed at different levels in different tissues (E) If a certain gene is expressed in some developmental stages but not others
B, C, D, E
A strain of bacteria has a CRISPR-Cas system, but a mutation has destroyed the function of the Cas9 gene. How will the strain of bacteria be affected? (A) The bacteria will not be able to defend itself from the first infection with a bacteriophage. (B) The bacteria will not be able to incorporate bacteriophage DNA into its chromosomal DNA. (C) The bacteria will not be able to target a specific bacteriophage for destruction upon infection for the second time. (D) The tracrRNA-crRNA complex will not form.
C
Can surgery successfully cure a cancer that has metastasized? (A) No, all body cells are dividing uncontrollably (B) Yes, it could remove all cells with defective cell-cycle regulation (C) No, cancer cells are no longer localized in one spot (D) Yes, if the tumor is benign
C
Consider the following statements about mitochondria: (1) Mitochondria have genomes which need to be replicated, but the gene for mitochondrial DNA polymerase is not found on the mitochondrial genome itself. (2) Mitochondria evolved from prokaryotic ancestors with circular genomes, but have adapted to their eukaryotic hosts by changing their genomes to linear chromosomes for consistency. Determine which of the options below is correct. (A) Statements I) and II) are both true. (B) Statements I) and II) are both false. (C) Statement I) is true; statement II) is false. (D) Statement I) is false; statement II) is true.
C
Consider the following statements: (1) Phosphorylating Protein X can activate that protein. (2) Phosphorylating Protein Y can inactivate that protein. Identify the correct statement below. (A) Statement 1 is true, statement 2 is false (B) Statement 1 is false, statement 2 is true (C) Statements 1 and 2 are both true (D) Statements 1 and 2 are both false
C
Consider whether the following statements are true or false. (1) Most mutations arise from errors in DNA replication (2) Of the three processes involved in the Central Dogma, DNA replication is the most reliable (A) Statement 1 is true; statement 2 is false (B) Statement 1 is false; statement 2 is true (C) Statements 1 and 2 are both true (D) Statements 1 and 2 are both false
C
HIV enters a cell by _______________ and leaves the cell by _______________. (A) endocytosis; lysis (B) nucleic acid injection; lysis (C) membrane fusion; budding (D) membrane fusion; lysis (E) nucleic acid injection; budding
C
How do cancer cells travel through the human body? (A) Cancer travels through the body by way of sexual intercourse between a healthy person and one affected by the disease. (B) The circulatory system only is responsible for relocating cancer cells. (C) The lymphatic system collects fluids from capillaries and with it cancer cells, which are then delivered by the circulatory system. (D) They are moved around on neurons throughout the body.
C
Identify the drug treatments that would be considered precision medicine. Choose all that apply. (A) docetaxol (B) carboplatin (C) trastuzumab
C
Organellar genomes in higher eukarytoes are typically _______________. (A) derived from the nuclear genome (B) paternally inherited (C) maternally inherited
C
Part of an mRNA molecule is shown below. If this fragment came from the beginning of the mRNA, for which of the amino acid sequences below would it most likely code? 5'CACGGUCGAUGAGGUUACAUCGC... 3' (A) His-Gly-Arg (B) Thr-Val-Asp-Glu-Val-Thr (C) Met-Arg-Leu-His-Arg (D) Gln-Tyr-Ile-Gly-Val-Ala-Gly
C
RNA molecule (A) is produced and processed by a cell, and functions to inhibit translation of Protein X. When the cell determines that additional molecules of Protein X need to be produced, RNA molecule (B) is produced which is complementary to RNA molecule (A). In this scenario, RNA (A) is functioning as a __________, and RNA (B) is functioning as a __________. (A) scaffold; blocker (B) guide; scaffold (C) blocker; decoy (D) decoy; guide
C
What happens to a wild-type mammal's lactase levels over the life of the organism? (A) They start high and remain high. (B) They start low and remain low. (C) They start high and drop after weaning. (D) They start high and taper off gradually over time. (E) They start low and rise sharply at adolescence.
C
What is meant by a virus having a segmented genome? (A) The virus exhibits both a lytic and a lysogenic cycle. (B) More than one copy of the viral genome is packaged into a capsid. (C) The entire viral genome is not found on a single nucleic acid molecule. (D) The genetic material is a combination of RNA and DNA.
C
When a human cell is progressing normally through the cell cycle, M-phase is usually the shortest in duration. This is primarly because _______________. (A) there are no checkpoints in M-phase (B) DNA replication is a surprisingly fast process (C) gene expression stops during M-phase (D) DNA repair is easier when chromosomes are condensed
C
Which of the following chemical formulas would represent an oligosaccharide of three hexose sugars? (A) C15H30O15 (B) C18H30O15 (C) C18H32O16 (D) C15H26O13 (E) C18H36O18
C
Which of the following possible sources of mutation is the most common? (A) Exposure to chemical carcinogens (B) Exposure to high-intensity radiation (C) Errors in DNA replication (D) Changes in nucleotide structure (E) Transposon insertion
C
Why does cancer primarily affect older people rather than young people? (A) Because the immune system of older people is not as effective in distinguishing normal cells from cancer cells. (B) Because older people have been exposed to more carcinogens. (C) Because cancer develops after multiple mutations have occurred which takes years to happen. (D) None of the above
C
You are designing an experiment to observe the modification of proteins and their movements out of the cell. On what organelle would you focus and what statement best describes the protein's journey? (A) Smooth ER. Ribosomes translate mRNA next to the smooth ER which then attaches to them and alters their shape; this confirmation then activates the formation of lipid vesicles that move the protein out of the cell. (B) Golgi apparatus. Once in the Golgi, the protein will be re-folded; this modification helps package it into smaller vesicles for transportation to the cell surface where it is released. (C) Rough ER. The ribosomes on the surface of this ER translate the protein from mRNA into the ER for modification. This protein can then be sent to the Golgi for packaging and transportation out of the cell. (D) ER. Proteins are released into the ER from the nucleus, causing modification. They are then sent to the Golgi to be attached to the membrane for release as a functional polypeptide. (E) Ribosomes. The protein would first be translated from mRNA and then transported through the cytosol to the ER. It would then be folded, leading to vesicle transportation to the cell membrane for release.
C
You have been asked to do a structural study to understand how increasing cell surface area affects cell size, shape, and function. What cell type would help you most efficiently observe the effects of increasing surface area? (A) Red blood cells from the bone marrow. The shape of a red blood cell is a biconcave disk and looks like a donut. (B) Stem cells from the skin. In this case, assume a skin stem cell is flat and plate-like. (C) Microvilli covered cells from the intestine. Microvilli are tiny hair-like protrusions in the plasma membrane of intestinal cells that increase the absorption of nutrients in the intestine. (D) Monocytes from the blood serum. Monocytes are large roughly spherical cells.
C
Identify any item below that exerts a cis-effect. Choose all that apply. (A) CAP-cAMP (B) Mediator (C) TATA box (D) lac operator
C and D
If the DNA molecule below were transcribed, which of the following RNAs might be produced? 3'-ATCGGCAGGACCTTAAAT-5' 5'-TAGCCGTCCTGGAATTTA-3' (A) 5′-AUCGGCAGGACCUUAAAU-3′ (B) 3′-UAGCCGUCCUGGAAUUUA-5′ (C) 3′-AUCGGCAGGACCUUAAAU-5′ (D) 5′-UAGCCGUCCUGGAAUUUA-3′
C and D
Typical HA RNA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3' Strain #4 RNA5'UAACCAUGAAGACAUCAUUGCUUUGAGCUACAUUC 3' How is the HA protein produced by the new flu virus different from a typical flu virus? (A) There is no difference. (B) One amino acid has been changed. (C) Several amino acids have been changed. (D) The protein is too short. (E) The protein is too long.
C and D
Identify any mutation that matches all of the following criteria: Classified as a point mutation Results in a change in the primary sequence of the protein Choose all that apply. (A) Insertions (B) Deletions (C) Nonsense (D) Missense (E) Same sense (F) Frameshift
C, D, F
A hormone is discovered to elicit a different cellular response in cell type (A) than it does in cell type (B) within the same organism. Which of the following is the least likely explanation for this observation? (A) Chromatin accessibility may differ between cell (A) and cell (B) leading to different proteins ultimately being expressed. (B) Different transcription factors are ultimately expressed in cell (A) and cell (B) as a response to the hormone. (C) The receptor for the hormone on cell (A) is different than the receptor for the hormone on cell (B), leading to a different initial response. (D) The genomes of cells (A) and (B) differ, so the proteins they are capable of synthesizing as responses will differ. (E) All of the above explanations are equally likely to account for the observation.
D
A human mother's genes seem to influence brain development while a human father's genes seem to influence growth. What does this imply? (A) Brain development genes are on the X chromosome and growth genes are on the Y chromosome. (B) Mothers and fathers both imprint brain development genes. (C) The mother imprints brain development genes and the father imprints growth genes. (D) The mother imprints growth genes and the father imprints brain development genes.
D
A tyrosine kinase _______________. (A) phosphorylates every tyrosine in a protein (B) dephosphorylates specific tyrosines on a protein (C) phosphorylates tyrosines on only one kind of protein (D) phosphorylates tyrosines within a specific motif on any protein displaying that motif
D
Below is one strand from part of the amelogenin gene. What is the nucleotide sequence of the other strand? 5'-CCCTGGGCTCT-3' (A) 5′ -CCCTGGGCTCT-3′ (B) 5′ -TCTCGGGTCCC-3′ (C) 5′ -GGGACCCGAGA-3′ (D) 5′ -AGAGCCCAGGG-3′
D
During G2, the cell is preparing for mitosis. Using your knowledge of cellular organelles and molecules, which molecule is produced in the highest quantity during G2? (A) DNA polymerase (B) TFIID (C) Telomerase (D) Tubulin (E) Ca2+ pump proteins
D
Identify any nucleic acid synthesizing enzymes that are RNA-dependent, DNA-synthesizing. Choose all that apply. (A) E. coli DNA polymerase I (B) E. coli DNA polymerase III (C) E. coli Primase (D) Human telomerase
D
The crossover frequency for two genes on the same chromosome is experimentally determined to be 7 times in 1,000 offspring. This leads to the conclusion that the genes are _______________. (A) far from each other and 7 mu apart (B) close to each other and 7 mu apart (C) far from each other and 0.7 mu apart (D) close to each other and 0.7 mu apart (E) far from each other and 70 mu apart (F) close to each other and 70 mu apart
D
Typical HA RNA 5'UAACCAUGAAGACUAUCAUUGCUUUGAGCUACAUUC 3' Strain #2 RNA5'UAACCAUGAAGACUAUCAUUGCUUAGAGCUACAUUC 3' How is the HA protein produced by the new flu virus different from a typical flu virus? (A) There is no difference. (B) One amino acid has been changed. (C) Several amino acids have been changed. (D) The protein is too short. (E) The protein is too long.
D
Which of the following is an example of post-translational regulation? (A) Using alternative splicing to produce different versions of proteins in different cell types (B) Positioning a repressor protein on an operator region to prevent RNA polymerase from binding (C) Preventing a ribosome from recognizing a start codon by hiding a ribosome binding site (D) Inactivating a functional protein by phosphorylating it (E) Stalling a ribosome by limiting the availability of certain charged tRNA molecules
D
Which of the following sequences are most likely to be recognized by a Type II restriction enzyme (the type described in your text)? Only one strand of a double stranded DNA sequence is shown, and all sequences are given 5'-3'. Choose all that apply. (A) TTTTTT (B) AGAGAG (C) GCAACG (D) CCCGGG (E) GATTACA
D
Which of the following stabilizing forces is the most STABLE under normal physiological conditions? (A) Hydrogen bonding (B) Ionic bonding (C) Hydrophobic interactions (D) Covalent bonding (E) van der Waal's interactions
D
You are preparing to use a reverse transcriptase to create cDNA from a sample containing purified mature eukaryotic mRNA. If you are preparing a primer using only one type of nucleotide, the primer most likely to be successful would be __________. (A) poly-A (B) poly-C (C) poly-G (D) poly-T (E) No primer composed of a single type of nucleotide can be used to prepare cDNA from these mRNAs.
D
Mad cow disease is caused by ____________. (A) a DNA virus (B) an RNA virus (C) a bacterial infection (D) a bacterium harboring a prophage which causes the actual symptoms (E) None of the above.
E
Proteins are made from 20 different amino acids, but two amino acids compose almost one third of Histone H1. Which of the following amino acids are most likely to be found in such high numbers in Histone H1? (A) Leucine and Valine (B) Methionine and Cysteine (C) Serine and Threonine (D) Glutamic acid and Aspartic acid (E) Lysine and Arginine
E
What type of gene mutation is most closely associated with DMD? (A) missense (B) nonsense (C) same sense (D) insertion (E) deletion
E
Some cells divide constantly, whereas other cells rarely divide if at all. Rank the following cell types by their frequency of cell division from never to constantly. (A) Sensory neurons (B) Liver cells (C) Hair cells
Sensory neurons < Liver cells < Hair cells
