Module 2 Exam

In the DNA double helix, a) the number of hydrogen bonds between the participating bases is always constant a purine always pairs with a pyrimidine disulfide bridges are formed between the two DNA strands A pairs with G, and T pairs with C None of the above

a purine always pairs with a pyrimidine

A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is: a) 3' UCA 5' b) 3 'ACU 5' c) 5' TCA 3' d) 3' UGA 5'

a) 3' UCA 5'

In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3 a) aminoacyl-tRNA; A; P; ribosome b) tRNA; P; A; peptidyl-tRNA c) synthetase; P; A; ribosome d) mRNA; E; P; polymerase

a) aminoacyl-tRNA; A; P; ribosome

What is a gene? to begin a) A sequence of DNA that tells polymerase where transcription b) A sequence of DNA that encodes a protein c) A sequence of RNA that regulates expression d) A sequence of amino acids that catalyze a reaction

b) A sequence of DNA that encodes a protein

You are producing a heteropolymer of synthetic mRNA using a 1:5 (C:G) ratio. In this synthetic mRNA what is the proportion of codons with 2G and 1C? a) 25/216 b) 75/216 c) 1/216 d) 125/216

b) 75/216

Refer to pic Molecules: Which diagram shows a nucleotide with a purine base? diagram a diagram b diagram c diagram d diagram e

diagram D (adenine, purine bases have 2 rings, pyrimide only have 1)

Refer to pic nucleotide: Which circle shows a phosphodiester bond? circle a circle b circle c circle d

circle a

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?

-- Hershey and Chase labeled the protein of one group of bacteriophages with radioactive S and labeled the DNA of another group of bacteriophages with radioactive P. They then allowed the phages to infect bacteria. Afterwards, they found that the ghost/shells of the phages still contained the S while the bacteria now contained the P. This made them conclude that DNA must have been transferred as the genetic material --They knew that T2 phages infect bacteria and then new progeny phages with the same traits as the parent phages are released. They also knew that T2 phages were only made of protein and nucleic acid. Thus one of these two classes of molecules must be responsible for passing on these traits. They created a batch T2 phages with radioactive phosphorus and separate batch of T2 phages with radioactive sulfur. They infected one group of bacteria with the rad active sulfur phages and another group of bact with rad active phosphorus phages. As only nucleic acids contain phosphorus and only proteins contain sulfur they were able to look at the progeny of the phages and determine that only the ones from rad active phosphurus parents were radioactive. This confirmed that nucleic acids, not protein is the genetic material being passed to the progeny,

Explain at least two reasons why the following definition of a gene is inadequate: A gene consists of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide.

-- excludes tRNA, snRNA and other forms RNA's -- excludes RNA sequences that are necessary for translation but do not specifically encode polypeptides -- excludes an explanation for exons and introns •Because of introns and exons pre-RNA can become a variety of different RNA molecules •Once those introns are removed, those different mRNA strands will code for different proteins •The words single in front of RNA and polypeptide are both incorrect •This is not adequate because it excludes introns/exons and also the nucleotides that encode the 5 and 3 ends of an mRNA molecule, which are required for translation but do not encode amino acids. It also excludes sequences that encode rRNA, tRNA, and other RNAs that do not encode protein.

Which of the following DNA sequences could be the template for a piece of mRNA with the sequence: 5 UGC CGA CGU AGG 3 5 TGC CGA CGT AGG 3 3 TGC CGA CGT AGG 5 5 ACG GCT GCA TCC 3 3 ACG GCT GCA TCC 5

3 ACG GCT GCA TCC 5

in eukaryotes, RNA polymerase __ transcribes the genes that encode proteins.

2

Name at least four structural predictions made by Watson/Crick DNA model?

2 polynucleotide chains coiled around a central axis, forming right-handed helix. The 2 chains are anti-parallel: 5'-->3' runs in opposite directions on each strand. The bases lay flat, perpendicular to the axis, stacked on one another 3.4 Angstroms apart. The nitrogenous bases of opposite chains are paired as a result of hydrogen bonds. In the chain, there are major grooves alternating with minor grooves. The double helix is 20 Angstroms in diameter. Each complete turn of the helix is 34 Angstroms.

TRUE/FALSE: 25. In eukaryotes, genes for rRNA and tRNA are usually present within tandem repeats. • 26.Transcriptionandtranslationtakeplace simultaneously in bacterial cells. • 27. In all organisms, all genes are transcribed from the same strand • 28.Ribosesugarshaveahydroxylonthe2'carbon. • 29.A-, B-, and Z-form DNA are all right-handed helixes. • 30. RNA has a five-carbon sugar and DNA has a five- carbon sugar.

25. T 26. T 27. F 28. T 29. F 30. T

In transcription, nucleotides are always added to the _____end of the elongating strand.

3'

An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it? 5' AUG 3' 3' AUG 5' 5' ATC 3' 3' ATC 5'

3' AUG 5'

When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing 5' base middle base 3' base

3' base

Which of these sequences could form a hairpin? 5 GGGGTTTTCCCC 3 5 AAAAAAAAAAA 3 5 ACACACAACACAC 3 5 TTTTTTGGGGGG 3

5 GGGGTTTTCCCC 3

Which of these sequences, if paired with its complementary strand, would be a palindrome? 5' CCCCCC 3' 5' CCCGGG 3' 5' CTGCTG 3' 5' TCCCCT 3'

5' CCCGGG 3'

If the following DNA strand was used as a template, what would the sequence of an RNA be?5' GTACCGTC 3: 5' GUACCGUC 3' 5' GACGGTAC 3' 5' CAUGGCAG 3' 5' GACGGUAC 3' 5' GUCGGUAC 3'

5' GACGGUAC 3'

Refer to pic TT: If the bottom strand of the DNA (sequence not shown) is the template, the RNA sequence, left to right 5' to 3', is

5AGGGUCCAC3

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids? 300 100 600 1200 900

900

Which one of the following statements regarding eukaryotic transcriptions is not true? Eukaryotic transcription involves a core promoter and a regulatory promoter. There is no one generic promoter. A group of genes is transcribed into a polycistronic RNA. Chromatin remodeling is necessary before certain genes are transcribed.

A group of genes is transcribed into a polycistronic RNA.

Which of the following relations will be found in the percentages of bases of a double-stranded DNA molecule?(Enter Yes on No in the respective answer boxes). 1. A+G=T+C 2. A+C=G+T 3. A+T/A+G = 1.0 4. A+G/C+T = 1.0 5. A/C = G/T 6. A/G = T/C 7. A/T = G/C 8. A+T=G+C

A+G=T+C____yes____ A+C=G+T______yes__ A+T/A+G = 1.0_______no_ A+G/C+T = 1.0__yes______ A/C = G/T_____no___ A/G = T/C___yes_____ A/T = G/C__yes______ A+T=G+C no

Which of the following statements is NOT true about enhancers? a) Enhancers are recognized by and bind directly to RNA polymerase. b) Enhancers can differ for each gene in a eukaryotic cell (although overlap is possible). c) Enhancers can be located thousands of nucleotides upstream of downstream of the gene they affect. d) Enhancers represent control elements located far away from the promoter. e) Enhancers contain sequences that are recognized by transcription factors.

A. enhancers are recognized by and bind directly to RNA polymerase

Which of these sequences could form a hairpin? CGCCAAAAAATCGCCCCCCAATTA ATTATTTCGTACCCCCAATTTT TTCAATAATCGCTAATAACTGA ATTATTGGCGCTAACGCCAATTTT GCCGCCGCCGCCCCATTATTATTAT

ATTATTGGCGCTAACGCCAATTTT

Which of the sequences could form a hairpin? TTACGGCGGTTCCGCCGGTG CGCCAAAAAATCGCCCCCCAATTA GCCGCCGCCGCCCCATTATTATTAT ATTATTTCGTACCCCCAATTTT ATTAGGCCCTACCGCCAATTTT TTCAATAATCGCTAATAACTGA

ATTATTTCGTACCCCCAATTTT

Name the three major modifications of mRNA of eukaryotes before it is transported to the cytoplasm. In addition, tell why each of the modifications is necessary

Add 5' cap (protect against degradation, acts as a binding site for the ribosome); add poly-A tail (possibly protect against degradation, possibly helps in the transfer of the mRNA to the cytoplasm); remove introns (forms a message that can be translated into a functional protein).

What is the function of the TATA binding protein? Aids in the removal of introns from eukaryotic pre-mRNA Allows prokaryotic RNA polymerase to bind to the promoter of genes Allows eukaryotic RNA polymerase II to bind to the promoter of genes Helps termination factors bind and terminate transcription.

Allows eukaryotic RNA polymerase II to bind to the promoter of genes

What experimental methods led Avery, McCarty, and Macleod to determine that DNA was the "transforming material" in their classic experiments?

Avery, McCarty, and Macleod treated bacteria with various enzymes that broke down different components of the bacteria. When protease (breaks down proteins) was added, transformation still occurred. When RNAse (broke down RNA) was added, transformation also occurred so neither protein nor RNA could not be the transforming materials. When DNAse was added (enzyme that broke down DNA), the transformation did not occur (because the DNA was broken down) and so it was determined that DNA must be the transforming material.

Kornberg, in his experiment to demonstrate the function of DNA poly I sought to show that DNA poly ! Was capable of replicating biologically active DNA. What does biologically active DNA mean in this context.

Biologically active DNA is capable of supporting metabolic activities and directs reproduction of the original organism from which it was originally duplicated

Which is true of the secondary structure of DNA? Thymine pairs with guanine Sugar-phosphate groups are on the inside of the DNA molecule. Bases on complementary strands are held together by hydrogen bonds. Nucleotide bases are on the outside of the DNA molecule. Cytosine pairs with adenine.

Bases on complementary strands are held together by hydrogen bonds.

Why does DNA polymerase III exist as a dime?

Because both strand are replicated simultaneously

A major difference between eukaryotes and prokaryotes is that eukaryotes have a nucleus, whereas prokaryotes do not. Discuss the impact of having a nucleus on the creation of mature mRNA.

Because prokaryotes do not have a nucleus, the translational machinery is able to attach to the mRNA as it is being synthesized. Thus, there is no time to process the mRNA. In eukaryotes, the translational machinery is not present in the nucleus. Thus, there is time for the cell to process the mRNA before it is transported from the nucleus to the cytoplasm and translated into protein.

How does bacterial DNA differ from eukaryotic DNA?

Because prokaryotes do not have a nucleus, the translational machinery is able to attach to the mRNA as it is being synthesized. Thus, there is no time to process the mRNA. In eukaryotes, the translational machinery is not present in the nucleus. Thus, there is time for the cell to process the mRNA before it is transported from the nucleus to the cytoplasm and translated into protein.

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences? any trinucleotide repeat satellite DNAs CAAT, TATA GGTTC, TTAT

CAAT, TATA

Why do eukaryotic chromosomes have multiple origins of replication, whereas prokaryotic chromosomes typically have only one origin?

Circular DNA molecules that undergo theta or rolling-circle replication have a single origin of replication. Because of the limited size of these DNA molecules, replication starting from one origin can traverse the entire chromosome in a reasonable amount of time. The large linear chromosomes in eukaryotic cells, however, contain far too much DNA to be replicated speedily from a single origin. Eukaryotic replication proceeds at a rate ranging from 500 to 5000 nucleotides per minute at each replication fork (considerably slower than bacterial replication).

This form of DNA replication was eliminated during the Meselson-Stahl experiment because the original double-helix did not appear to be preserved during cell division.

Conservative replication

In the late 1950s, Meselson and Stahl grew bacteria in a medium containing "heavy" nitrogen (15N) and then transferred them to a medium containing 14N. Which of the results in the above figure would be expected after one round of DNA replication in the presence of 14N? A) Tube A (one bar for 15N DNA) B) Tube B (two bars: one 15N DNA and one 14N DNA) C) Tube C (one bar 14n DNA) D) Tube D (one bar 14-15n DNA)

D

Which of the following traits exemplify plasmid DNA? A) It often carries genes beneficial to its bacterial host. B) It replicates independently of the genomic DNA. C) It is always larger than the genomic DNA. D) Both A and B, above E) Both B and C, above

D) Both A and B, above

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)?Indicate the reason (or reasons) for your choice. A:GCATTAGGCATCCC CGTAATCCGTAGGG B:TTAGCGTTAATAGCAT AATCGCAATTATCGTA Mark the correct boxes below: DNA molecule A DNA molecule B DNA molecule B has a higher A-T content DNA molecule B has a higher G-C content DNA molecule A has a higher G-C content. DNA molecule A has a higher A-T content

DNA molecule A DNA molecule B has a higher A-T content DNA molecule A has a higher G-C content

The long term storage of genetic information in a cell occurs in the: a) microRNA b) DNA c) mRNA d) RNA

DNA

In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts? a) DNA contains sulfur, whereas protein does not. b) DNA contains nitrogen, whereas protein does not. c) DNA contains phosphorus, but protein does not d) DNA contains purines, whereas protein includes pyrimidines.

DNA contains phosphorus, but protein does not

Reverse transcriptase (from a retrovirus like HIV) a) DNA from RNA b) Genomic DNA from protein c) RNA from an RNA template d) RNA from a DNA template e) DNA from DNA

DNA from RNA

This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them.

DNA ligase

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)?Indicate the reason (or reasons) for your choice. A:GTATTAGAACATCTCCATAATCTTGTAGAG B:TGAGCGTTCCAGCAGACTCGCAAGGTCGTC Mark the correct boxes below: DNA molecule A DNA molecule B DNA molecule A has a lower A-T content DNA molecule B has a higher G-C content DNA molecule A has a higher G-C content. DNA molecule A has a higher A-T content

DNA molecule B DNA molecule B has a higher G-C content DNA molecule A has a higher A-T content

When this molecule is synthesized, both strands of a DNA molecule are used as a template. a. RNA only b. DNA only c. both RNA and DNA •neither RNA nor DNA

DNA only

Which different DNA polymerases are found in eukaryotic cells? What are their functions?

DNA pol alpha: initiates DNA synthesis by synthesizing an RNA primer • DNA pol delta: completes replication on the lagging strand • DNA pol epsilon: takes part in nuclear replication on leading strand • DNA pol beta: repair and recombination of nuclear DNA • DNA pol gamma: replicates mitochondrial DNA

Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction? a) DNA polymerase III b) topoisomerase c) DNA ligase d) primase

DNA polymerase 3

What is semiconservative replication?

Each of the parent nucleotide strands remains intact (conserved), but they are now bound to new nucleotide strands instead of each other.

In biology, most information flows through which sequence? a) protein to RNA to DNA b) RNA to DNA to protein c) DNA to RNA to protein d) protein to DNA to RNA

DNA to RNA to protein

Kornberg used the phage PhiX14 to demonstrate DNA pol I was able to produce biologically active DNA in vitro. Briefly describe the experimental methods that he used to draw the conclusions that DNA pol I could produce biologically active DNA.

He use H3 in the initial ++++ strand of DNA. then using BU and P32 (heavy) he created a heavy radioactive --- strand of DNA. He then heated and separated the two strands of DNA. Next he used the heavy --- DNA strand and applied the DNA pol I and normal P. A +++ strand was synthetically made and was separated from the heavy --- strand. Once the synthetic +++ strand of DNA was put in a bacteria and biological activity occurred form the phage, Kornberg was able to deteremine that the DNA pol I was able to produce biologically active DNA in vitro.

In eukaryotic replication there is a fundamental level of complexity because of what proteins?

Histone proteins

Assume the following experiment in neurospora, where B, F, K, and S are suspected precursors in the M pathway. The data below show the growth behaviour of mutants from 4 complementation groups. + indicates growth; - indicates no growth. Comp. group I: Comp. group II: Comp. group III: Comp. group IV: growth on substances F and M containing minimal medium growth on substance M containing minimal medium growth on substances B, F and M containing minimal medium growth on substances B, F, K, and M containing medium In what order do the proteins encoded by the genes of comp. groups I to IV act in this pathway?

IV,III,I,II, =K,B,F,M

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA? Cytoplasm Endoplasmic Reticulum Nucleus Mitochondia Golgi apparatus

Nucleus

You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicates its DNA. Based on the following equilibrium centrifugation results, what type of replication would you propose for this new bacterium? one bar moving up and getting darker with every replication

If it was semiconservative you would expect to see two lines, one would be mixed of the intermediate and a pure new strand, if it was dispersive everything would be mixed of everything and the bar would not change with generations, if it was conservative you would see a 3 to 1 ratio of new to old that gets bigger during each generation. Because it is slowly getting lighter and only one band the answer must be dispersive

Describe the direction of information flow in living systems. Use appropriate, scientific terms in your description.

In living systems, on a DNA level, information flows in a 5' to 3' direction. This refers to the various bonds on the sugar of a DNA molecule and how the nucleotides are bonded to one another. 5' means the Carbon 5 of the pentose sugar ring and in turn the 3' is the Carbon 3 of the ring. A string of nucleotides is then read 5' to 3' starting with the nucleotide with an unbonded (or just not bonded to the referred-to string) 5' Carbon. Direction of information flow in living systems goes from DNA that is transcribed into RNA which is in turn translated into proteins (The Central Dogma)

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? for It blocks access of RNA polymerase to the promoter, until removed by general transcription factors. It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. It modifies histones so that nucleosomes can be removed from DNA transcription. It bends and partly unwinds DNA at a promoter.

It bends and partly unwinds DNA at a promoter.

Telomerase is a "special" enzyme because of what characteristic?

It contains protein and RNA together, a ribonucleoprotein

Genetic material must replicate faithfully. Describe how the double-stranded structure of DNA gives it this property.

It is semiconservative. Specific base pairing reactions, etc

Briefly discuss the evidence for the semi-conservative replication of DNA

Meselson & Stahl let E. coli to be radioactively labeled with 15N and 14N and then followed the density of daughter cells using CsCl gradient centrifugation. They hypothesized that parental DNA molecules of one density which were allowed to replicate in another medium of a different density would show daughter DNA molecules of intermediate density because half will be old DNA and the other half would be new DNA of intermediate density. EDA: M&S ran experiments w/ heavy (15N) and regular (14N) in which they made double strands of heavy DNA (both strands had N-bases composed of 15N). These heavy strands were placed in pools/ solutions containing regular (14N) bases and allowed to replicate. The results showed that at gen. 0, the double stranded DNA was composed only of heavy N bases; at gen. 1, the DNA double strands were all hybrids (one strand 14N bases and one strand 15N bases or 50% 14N 50% 15N); and at gen. 2 the DNA double strands were 50% regular N and 50% hybrid. This suggested that the DNA must be undergoing semi-conservative replication as the only way to get these results would be for each of the 2 parent strands to separate from each other and become a template for an entirely new strand of DNA.

If the following DNA sequence 5'---------TTT AGA CCC CCC AGA TTT-----3' 3'---------AAA TCT GGG GGG TCT AAA-----5'is transcribed and translated, what would be the primary sequence of the final protein product? Note: UUU, AGA, and CCC code for phenylalanine (Phe), arginine (Arg) and proline (Pro), respectively. N and C in the following answers refer to the N and C termini, respectively. N-----Phe-Pro-Arg-Arg-Pro-Phe------C N-----Phe-Arg-Phe-Phe-Arg-Phe---- C N-----Phe-Arg-Pro-Pro-Arg-Phe---- C N-----Phe-Arg-Pro-Pro-Phe-Arg------C N-----Pro-Arg-Phe-Phe-Arg-Pro------C

N-----Phe-Arg-Pro-Pro-Arg-Phe---- C

A friend gave you the following molecule and told you that it was a fragment of his RNA. Do you believe him? Justify your answer. 5 TCC TGA CGA TGC TAC CGA 3

No, the molecule has Ts. If it were truly RNA, it would have Us rather than Ts

Which of the following statements about a mammalian messenger RNA are FALSE? directly a) It is synthesized in the nucleus. b) It is translated in the cytoplasm. c) It usually contains a cap at the 5' end. d) It is usually much smaller than the initial transcript (that is copied from the gene). e) None of the above.

None of the above.

This organic subunit is the monomer from which nucleic acid is formed.

Nucleotide

A coworker in your lab discovered a strain of E. coli that has a nonfunctional RNA polymerase. He felt sorry for the suffering E. coli and decided to add an RNA polymerase enzyme and gene from Drosophila to this mutant E. coli to allow the mutant strain to survive. You think that this is a foolish idea that will not work. Put together an argument as to why the addition of a Drosophila RNA polymerase could not possibly allow this mutant E. coli to survive.

Prokaryotic and eukaryotic RNA polymerases are different. The Drosophila RNA polymerase will not be able to find the E. coli promoters and thus will not be able to transcribe any of the E. coli genes.

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

Promoter

Heinz Shuster collected the following data on the base composition of ribgrass virus (H. Schuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. NY: Academic Press, 1955).On the basis of this information (see below) is the hereditary information of the ribgrass virus RNA or DNA? Is it likely to be single stranded or double stranded? Percent: A: 29.3 G: 25.8 C: 18.0 . T: 0.0 . U: 27.0 RNA DNA single stranded double stranded

RNA (because of presence of uracil and no thymine) single stranded (because A/U and G/C numbers are not equal)

Which of the following statements is not true concerning RNA and DNA? a) DNA is transcribed into RNA which is translated into protein b) The sugar portion of RNA and DNA are different c) DNA is permanent in a cell, RNA is temporary d) RNA is more stable than DNA

RNA is more stable than DNA

This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil. a. RNA only b. DNA only c. both RNA and DNA •neither RNA nor DNA

RNA only

This short piece of RNA is present only transiently in a newly-synthesized DNA molecule.

RNA primer

An intron is a section of RNA that is removed during RNA processing. protein that is clipped out post-translationally. DNA that is removed during DNA processing. transfer RNA that binds to the anticodon. carbohydrate that serves as a signal for RNA transport.

RNA that is removed during RNA processing

The RNA World theory suggests that: RNA is the intermediate between DNA and proteins. RNA was the genetic material in the first living cells. many RNAs are capable of self-splicing. eventually RNA will become the genetic material of most living organisms. RNA viruses are more dangerous than DNA viruses.

RNA was the genetic material in the first living cells

Uracil contains________as sugar.

Ribose

Telomeres regulate the replication of the ends of chromosomes in eukaryotes. Why is this structure implicated in human aging?

Telomeres are structures at the ends of eukaryotic chromosomes that contain tandem DNA sequences added to the 3ʹ ends by the enzyme telomerase. Telomeres stabilize chromosomes by preventing the loss of genomic information after each round of DNA replication. Human somatic cells contain little or no telomerase, and those that do get progressively shorter and enter premature senescence. People with diseases of premature aging such as Werner syndrome and dyskeratosis congenital have shorter telomeres than healthy people.

Which of the following are role(s) of the 5 cap? The cap helps the RNA polymerase find the promoter and initiate transcription. The cap plays a role in the removal of introns. The cap acts as a binding site for the ribosome. The cap protects the RNA from degradation. none of the above

The cap plays a role in the removal of introns. The cap acts as a binding site for the ribosome. The cap protects the RNA from degradation.

What are roles of 5' cap?

The cap plays role in removal of introns • Cap acts as a binding site for ribosomes • Cap protects the RNA from degredation

What is the spliceosome?

The spliceosome is the RNA-protein complex that is responsible for intron-exon splicing in eukaryotes. Following the GU-AG rule, introns are excised and removed from mRNA and the exons are joined to form a mature mRNA molecule ready for translation. The spliceosome is made of five small nuclear ribonucleoproteins (snRNPs) which consists of proteins and one of five snRNAs (U1, U2, U4, U5 and U6) which together with over 100 proteins form the large biological machine used for splicing.

DNA replication is semi-conservative in that: a) The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved. b) The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication. c) DNA replication can only follow the replication fork on the leading strand. d) The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

List the following events in the pre-RNA processing of a one intron-two exon gene in correct sequence order: Attachment of snRNP U1 to the 5' splice site •Transesterification reaction at the branch point adenine •Transcription of the DNA template into the pre-mRNA molecule •Recognition and binding the 3' AAUAAA sequence by specific protein factors •Cleavage at the poly(A) site •Addition of the 5' cap •Export to the cytoplasm •Addition of the poly(A) tail •Release of lariat structure •Splicing together of exons

Transcription, addition, recognition, cleavage, addition (poly a), attachment, transesterification, release, splice, export

Process 2 is _____________..

Translation, mRNA to protein

During translation, chain termination is signaled by which triplets? Check all that apply. UAG UGA UAA AUG UGG

UAG, UGA, UAA

Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5' UCG 3', considering wobble-base pairing rules.

Wobble-base pairing can vary in the 5 base of the anitcodon, this is opposite the 3 end of the mRNA codon •3 ACG 5 (exact) •Wobbe codons: 3 ACC 5,3 ACU 5, 3 ACA 5

The 5' cap on an mRNA is important for all the processes listed below except for the ___ of an mRNA molecule. a.Transcription • b. intron removal •c. stability •d. initiation of translation

a.Transcription

Which is a characteristic of DNA sequences at the telomeres? a) One strand protrudes beyond the other, creating some single-stranded DNA at the end. b) The consist of repeated sequences c) They consist of cytosine and adenine nucleotides d) all of the above

all of the above

The secondary structure of a protein includes the following elements: α-helix and β-pleated sheet. gamma and delta. alpha and gamma. hydrophobic clusters. disulfide bridges.

alpha helix and beta pleated sheet

The next step in the translation of this mRNA will be the formation of a peptide bond between which two amino acids? amino acid 2 and amino acid 3 amino acid 2 and amino acid 4 amino acid 1 and amino acid 3 amino acid 1 and amino acid 2

amino acid 2 and amino acid 3

Heterochromatin is characterized by all of the following, EXCEPT that it a) is present all over the inactive X chromosomes in mammals. b) contains genes that require high levels of transcription. c) is present at centromeres and telomeres. d) is present on most of the Y chromosome. e) remains highly condensed throughout the cell cycle.

b) contains genes that require high levels of transcription.

In eukaryotes, tRNAs are: a) transcribed in the nucleus, and function in the nucleus. b) transcribed in the nucleus, but function in the cytoplasm. c) transcribed in the cytoplasm, and function in the cytoplasm. d) transcribed in both the nucleus and the cytoplasm, and function in the cytoplasm.

b) transcribed in the nucleus, but function in the cytoplasm.

The anticodon on the tRNA molecule: binds to the mRNA in a complementary fashion. is oriented and written in the 5→ 3 direction. is a catalytic part of protein synthesis. is the same for all tRNA molecules. contains amino-acyl-tRNA synthtase.

binds to the mRNA in a complementary fashion.

How do centromeres help control the cell cycle? a) by inhibiting the S phase until the cell is ready to double its DNA content b) by causing DNA not attached to centromeres to be lostby inhibiting anaphase until spindle fibers are attached to chromosomes c) by inhibiting anaphase until spindle fibers are attached to chromosomes d) by activating cell cycle control genes

by inhibiting anaphase until spindle fibers are attached to chromosomes

Which statement is true regarding negative supercoiled DNA? a) Negative supercoiled DNA has 10 base pairs per turn of its helix b) Negative supercoiled DNA is not usually seen in cells. c) That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription. d) Negative supercoiled DNA carries more negative charges than positive supercoiled DNA does. e) All of the above statements are true.

c) That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription.

In prokaryotes, translation of an mRNA is coupled to: a) mRNA splicing b) mRNA processing c) transcription d) nuclear export e) None of the above

c) transcription

The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___. • a. mRNA stability b. translation c. intron splicing d. protein stability

c. intron splicing d. protein stability

The concept that genetic information passes from DNA to RNA to protein is called

central dogma

Which circle shows a bond that would also be found in an RNA transcribed from one strand of this DNA? circle a circle b circle c

circle a (mRNA is single stranded so no H bons, C in RNA would contain an OH group, not sure about D?)

Refer to pic nucleotide: Which circle shows a noncovalent bond? circle a circle b circle c circle d

circle b-- H bond

Translation is directly dependent on all of the following associations except _______. A) complementary base pairing between mRNA and rRNA B) association of the 30S and the 50S ribosomal subunits C) complementary base pairing between mRNA and tRNA D) complementary base pairing between mRNA and DNA

complementary base pairing between mRNA and DNA

Which of the following best describes the addition of nucleotides to a growing DNA chain? a) A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. b) A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. c) A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. d) A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

d) A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

Translation of RNA into Protein takes place on which cellular organelle? a) tRNA b) Nucleus c) Polymerase d) Ribosome

d) Ribosome

Which is not true of amino acids? a) There are 20 of them essential in the body b) They are the building blocks of proteins c) tRNA brings them to the ribosome for protein synthesis d) all of the above are true

d) all of the above are true

The antiparallel nature of DNA refers to a) its charged phosphate groups b) the formation of hydrogen bonds between bases from opposite strands c) the pairing of bases on one strand with bases on the other strand d) the opposite direction of the two strands of nucleotides.

d) the opposite direction of the two strands of nucleotides.

Briefly the four primary ingredients that, coupled with DNA polymerase I, are needed for the in vitro synthesis of DNA.

dNTP, DNA template, primer DNA or RNA, Mg2+

Codon that specify the same amino acid are said to be _________________.

degenerate codons

Refer to pic Molecules: Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment? diagram a diagram b diagram c diagram d diagram e

diagram b (because it contains sulfur which they labeled/radioactive)

Refer to pic Molecules: Which diagram shows a nucleotide as it would appear in DNA? Question options: diagram a diagram b diagram c diagram d diagram e

diagram d (this is adenine, C is uracil which is only in RNA)

Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon? a) multiple random mutations within specific exons of the gene b) differences in pre-mRNA splicing that results in an altered pattern of exon inclusion. c) differential acetylation of specific histone proteins prior to transcription. d) use of different transcriptional activators e). All of the above .

differences in pre-mRNA splicing that results in an altered pattern of exon inclusion

In the Meselson-Stahl experiment, what hypothetical form of DNA replication results in the same DNA density distribution as the semiconservative method after the first cell division, but was not supported upon the second cell division?

dispersive replication

Which of the following features distinguishes RNA from DNA? a) DNA has only purine bases b) RNA has a pentose sugar while DNA utilizes a hexose sugar c) Unlike RNA, DNA uses a phosphodiester backbone d) RNA has only pyrimidine bases e) None of the above

e) None of the above

A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will serve as the initiation codon. encode N-formylmethionine. encode methionine that will eventually be removed. encode unformylated methionine.

encode unformylated methionine.

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes a) fusion into circular forms known as plasmids b) union with ribosomes c) excision of introns d) linkage to histone molecules

excision of intron

Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that --genetic material must contain complex coding information --genetic material must replicate faithfully. --genetic material must encode the phenotype. --genetic material must be composed of many different units to account for the variability seen in nature.

genetic material must be composed of many different units to account for the variability seen in nature.

What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary? a) hairpin b) B-DNA c) double helix d) Z-DNA

hairpin

RNA differs from DNA in that it: (more than one answer may be correct) has uracil rather than thymine. is usually single-stranded rather than double-stranded. is made in the cytoplasm rather than in the nucleus. has ribose sugars rather than deoxyribose sugars in its nucleotides. all of the above.

has uracil rather than thymine. is usually single-stranded rather than double-stranded. has ribose sugars rather than deoxyribose sugars in its nucleotides.

What chemical group is found at the 3' end of a DNA molecule? carboxyl group sulfate group nitrogenous base phosphate group hydroxyl group dideoxy group

hydroxyl group

The spliceosome is a large enzyme that catalyzes removal of specific . a) junk sequences in the DNA by splicing different parts of a gene b) amino acid sequences in the protein by splicing different parts of a protein. c) introns in pre-mRNAs. d) sequences in either a DNA or an RNA e)None of the above.

introns in pre-mRNAs.

Which of the following two terms relates most closely to split genes? transcription, translation introns, exons heteroduplex, homoduplex 5'-cap, 3'-poly-A tail elongation, termination

introns, exons

What is the function of peptidyl transferase activity? It charges tRNAs. It acetylates the end of a protein after translation. It cleaves the polypeptide from the last tRNA during termination. It moves ribosomes along mRNA during translation. It forms peptide bonds.

it forms peptide bonds

This new strand of DNA has its 3' end oriented in the OPPOSITE direction as that in which the replication fork travels.

lagging strand

This new strand of DNA has its 3' end oriented in the SAME direction as the replication fork travels.

leading strand

The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells. a) less, permanently b) less, temporarily c) more, temporarily d) more, permanently

less, temporary

All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one? tRNA mRNA Methionine Initiation factors

mRNA

Which of the following statements best describes the messenger RNA? a) mRNA molecules have a double-helix structure b) mRNA is synthesized by ribosomes in the endoplasmatic reticulum protein c) mRNA consists of an anti-codon and an amino acid d) genetic information is permanently stored in mRNA e) mRNA is the only type of RNA that carries DNA's building instructions

mRNA is the only type of RNA that carries DNA's building instructions

What enzyme is exploited to produce synthetic mRNA polynucleotide kinase polynucleotide phosphorylase liagse RNA Poly II

polynucleotide phosphorylase

A short segment of an mRNA molecule is shown below. The polypeptide it codes for is also shown: 5'-AUGGUGCUGAAG : methionine-valine-leucine-lysine Assume that a mutation in the DNA occurs so that the fourth base (counting from the 5' end) of the messenger RNA now reads A rather than G. What sequence of amino acids will the mRNA now code for? (You do not need a copy of the genetic code to answer the question.) methionine-leucine-leucine-lysine methionine-valine-leucine-lysine methionine-methionine-leucine-lysine methionine-lysine-leucine-lysine methionine-valine-methionine-lysine

methionine-methionine-leucine-lysine

Which of the following statements about the genetic code are TRUE? a) Most amino acids are encoded by more than one codon b) The code is ambiguous but not redundant c) There is only one codon for each amino acid d) Two consecutive bases specify an amino acid e) None of the above

most amino acids are encoded by more than one codon

An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it? 5'ATT3' 5'AUC3" 5" ACU3' none

none

Refer to pic Molecules: Which diagram shows a nucleotide that would be used to make RNA? diagram a diagram b diagram d diagram e

none no ribose sugars, all deoxyribose)

Short bursts of DNA synthesis that establish the lagging strand are called these.

okazaki fragments

This term describes the sequence of nucleotides which direct the formation of a new nucleic acid strand.

parent strand

What chemical group is found at the 5' end of a DNA molecule? dideoxy group phosphate group carboxyl group sulfate group nitrogenous base hydroxyl group

phosphate group

The bonds that connect nucleotides in a strand are called _________bonds.

phosphodiester

Hershey and chase labeled DNA using this radioactive atom.

phosphorus

The DNA replication enzyme that most closely resembles RNA polymerase is DNA polymerase I. DNA polymerase III. primase. telomerase. helicase.

primase

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can then take over for replication.

primase

The ribosome is the primary site of oxidative phosphorylation. protein packaging. protein synthesis. cellular respiration. amino acid storage.

protein synthesis

The ribosome is the primary site of: oxidative phosphorylation. protein packaging. protein synthesis. cellular respiration. amino acid storage.

protein synthesis

DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide? a) DNA contains all of the above. b) phosphate c) a ribose sugar d) purine or pyrimidine nitrogen-containing bases e) a deoxyribose sugar

ribose sugar

This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the "parental" double helix to form two templates.

semiconservative replication

Hairpins are formed in DNA as a result of a) sequences on the opposite strand that are identical b) sequences on the same strand that are inverted and complementary c) sequences on the opposite strand that arecomplementary d) sequences on the same strand that are identical

sequences on the same strand that are inverted and complementary

types of small RNA molecules involved in gene regulation?

siRNAs • miRNAs

The 3' untranslated region affects the ___ of mRNA and the ___ of the mRNA protein-coding sequence. •Translation •b. splicing •c. stability •d. transcription

stability; translation

Telomeres________________the end of chromosomes a) stabilize b) replicate c) transcribe d) destabilize

stabilize

Codon that specify the same amino acid are said to be _________________.

synonymous

What are the three classes of functional RNAs? Briefly describe the role of each class of functional RNA.

tRNA (brings the correct amino acid to the mRNA during translation); rRNA (major component of ribosomes); snRNA [helps process RNA transcripts (especially, helps remove introns)].

After the peptide bond forms, what will happen? tRNA A will be carrying the polypeptide and it will shift to the P site. tRNA A will be carrying the polypeptide and it will shift to the A site. tRNA B will be carrying the polypeptide and it will shift to the P site. tRNA B will be carrying the polypeptide and it will shift to the A site.

tRNA B will be carrying the polypeptide and it will shift to the P site.

To translate a mRNA you require two other RNAs. These are : tRNA and mRNA. tRNA and miRNA. tRNA and rRNA. rRNA and siRNA.

tRNA and rRNA

Eukaryotes have two of these per chromosome; prokaryotes have none.

telomeres

he packaging of DNA into a confined space is what level of DNA structure? a) quaternary b) secondary c) tertiary d) primary

tertiary

What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence? a) that RNA was the genetic material b) that DNAse or protease, but not RNase, stimulates transformation c) that protein was the genetic material d) that DNA was the genetic material

that RNA was the genetic material

What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli.Q a) that DNA was the genetic material in phage b) that protein and DNA together made up the genetic material getting c) that protein was the genetic material in phage d) that somehow the radioactivity prevented DNA from into E. coli

that protein was the genetic material in phage

The antiparallel nature of DNA refers to a) the pairing of bases on one strand with bases on the other strand b) the opposite direction of the two strands of nucleotides. c) its charged phosphate groups d) the formation of hydrogen bonds between bases from opposite strands

the opposite direction of the two strands of nucleotides.

In DNA replication, the lagging strand is a) the strand which must be replicated in a direction toward replication fork. b)the part of the DNA which is just about to be unwound. c) the portion of the helix that is not anti-parallel with its paired strand. d) the portion of the DNA that has been fully replicated. e) the strand which must be replicated in a direction away from the replication fork.

the strand which must be replicated in a direction away from the replication fork.

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? a) The tRNA that was in the A site moves into the P site. b) The tRNA that was in the A site moves to the E site and is released. c) The tRNA that was in the A site departs from the ribosome via a tunnel. d) The tRNA that was in the P site moves into the A site.

the tRNA that was in the A site moves into the P site

This Greek letter describes the shape of a bacterial chromosome mid- way through replication.

theta

The role of tRNA is: to serve as an intermediate in the decoding of genes. to act as transporters bringing amino acids to the site of protein synthesis. to serve as general translational components of the ribosome. to facilitate splicing of pre-messenger RNAs. to facilitate splicing of pre-messenger RNAs.

to act as transporters bringing amino acids to the site of protein synthesis.

DNA polymerase III adds nucleotides to internal sites in the DNA template. to the 3' end of the RNA primer. in the place of the primer RNA after it is removed. to the 5' end of the RNA primer. to both ends of the RNA primer.

to the 3' end of the RNA primer

What is the function of eukaryotic RNA polymerase I? transcription of rRNA genes transcription of mRNA genes transcription of tRNA genes transcription of snRNAs initiation of transcription (but not elongation)

transcription of rRNA genes

The genetic code is fairly consistent among all organisms. The term often used to describe such consistency in the code is exceptional. none of these terms. overlapping. universal. trans-specific.

universal

Can RNA act as genetic material, if so name one ex of an organism

yes, retrovirus

What three general characteristics must the genetic material possess?

• 1. Genetic material must contain complex information. • 2. Genetic material must replicate faithfully. • 3. Genetic material must encode the phenotype.

How many primase molecules are needed on the leading strand? The lagging strand?

• Leading = 1 Lagging = Multiple one for each Okazaki fragment

Are Okazaki fragments formed on the leading strand during DNA replication? Explain your answer.

• No, because the leading strand can replicate continuously

Which of the following is not true concerning RNA and DNA? 2-16 • A. DNA is transcribed into RNA which is translated into protein • The sugar portion of DNA and DNA are different • DNA is permanent in a cell, RNA is temporary • RNA is more stable that DNA

• RNA is more stable that DNA

List 3 requirements of any substance that be a "genetic material"

• Replication • Storage • Expression • Variation by mutation

A number of scientists have become interested in telomerase as a drug target. Why would they be interested in telomerase? How might cancer drug therapies that target telomerase work?

• Telomerase is a special enzyme that extends the lagging strand after DNA replication. Telomerase creates telomeres. Telomeres shorten with age. Telomerase is not active in somatic cells unless they are cancer cells. The drug therapies could inactivate telomerase in the indefinitely dividing somatic cells.

What does "proofreading" refer to with regard to DNA replication?

•Proofreading refers to the active process of identifying mismatches in DNA and repairing them; in eukaryotes this is partially accomplished by the DNA pol III eta subunit. •If errors arise in nucleotide selection they can be corrected by proofreading. This happens when a DNA polymerase inserts an incorrect nucleotide into the growing strand the 3-OH group of the mispaired nucleotide is not correctly positioned in the active site of the DNA polymerase for accepting the next nucleotide. The incorrect positioning stalls the polymerization rxn, and the 3-5 exonuclease activity of DNA polymerase removes the incorrectly paired nucleotide. •From book per EA •When a DNA polymerase inserts an incorrect nucleotide into the growing strand, the 3ʹ-OH group of the mispaired nucleotide is not correctly positioned in the active site of the DNA polymerase for accepting the next nucleotide. The incorrect positioning stalls the polymerization reaction, and the 3ʹ→5ʹ exonuclease activity of DNA polymerase removes the incorrectly paired nucleotide. DNA polymerase then inserts the correct nucleotide.

Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe. RNA Pol I; RNA Pol II; RNA Pol III •mRNA b. tRNA c. rRNA d. snRNA

•RNA Pol I- rRNA •RNA Pol II- mRNA, snRNA •RNA Pol III- tRNA, rRNA, snRNA

Two double-stranded fragments of DNA are exactly the same length. At 89C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?

•Strands with more C-G bonds (which form 3 hydrogen bonds) will be more tightly held together, they will not denature as quickly as strands with more A-T bonds •A-T only form 2 hydrogen bonds so they are more easily denatured when temperature in increased

Whereas the nucleotide strand used for transcription is termed the____________ the nontranscribed strand is called the _____________ .

•Template strand •coding strand

Splicing of eukaryotic pre-mRNA involves ___ reactions and occurs in the ___ . •Methylation •b. transesterification •c. polyadenylation •d. nucleus • cytoplasm

•b. transesterification •d. nucleus