Module 2 Short Answer

Assume that A + T/G + C equals 0.5 in one strand of DNA. What is the ratio of these bases in the complementary strand?

0.5

You have a solution of DNA who's absorbance of UV radiation at 260nm is 0.05. What is the concentration of DNA in the sample?

13

If A + G/T + C equals 0.5 in one strand, what is the ratio of these bases in the complementary strand?

2.0

An organism has a G content of 30%. What is the percentage for A

20%

Assuming that an amino acid sequence is 250 amino acids long, how many different molecules, each with a unique sequence, could be formed?

20^250

In transcription, nucleotides are always added to the _____end of the elongating strand

3'

An organism has a T content of 20%. What is the percentage for C?

30%

3' TACCGTGCGTGACATTAAGCC 5' What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? Type the sequence from 5' to 3', but DO NOT INCLUDE 5' and 3' characters

5′ ATGGCACGCACTGTAATTCGG 3′

Which of the following relations will be found in the percentages of bases of a double-stranded DNA molecule? (Enter Yes or No in the respective answer boxes).

A+G=T+C Yes A+C=G+T Yes A+T/A+G = 1.0 No A+G/C+T = 1.0 Yes A/C = G/T No A/G = T/C Yes A/T = G/C Yes A+T=G+C No

Three forms of DNA are...

A-DNA B-DNA R-DNA L-DNA Z-DNA A, B, Z

The triplet _____ is commonly used as a start codon during translation

AUG

Describe four base triplets that are clearly responsible for punctuation (initiation, termination)

AUG, UAA, UGA, UAG

5'-AUGCAUGAGCCCUGAAAAACGCGGGAGAACAUAAGGGCCUUUUCAG-3' How many amino acids are in the longest polypeptide that could be encoded by the above nucleic acid?

AUGCAUGAGCCCCGAAAAACGCGGGAGAACA (up to UAA stop codon) -

5' ...GGAGCUCGUUGUAUU... 3' Is this sequence RNA or DNA? How can you tell? 3' TACCGTGCGTGACATTAAGCC 5' What would be the sequence of an RNA produced by using the DNA sequence shown as a template? Type your answer from 5' to 3', but DO NOT INCLUDE 5' and 3' characters.

AUGGCACGCACUGUAAUUCGG

Splicing of eukaryotic pre-mRNA involves ___ reactions and occurs in the ___ . a. methylation b. transesterification c. polyadenylation d. nucleus e. cytoplasm

B & D

Until about 1970, mitotic chromosomes viewed under the microscope could be distinguished only by their size, positions of centromeres, and "satellites" in some cases. However, various staining techniques have allowed a different view of chromosomes because they allow the visualization of ________.

Bands similar to those of polytene chromosomes / distinct bands along the chromosome

Kornberg, in his experiments to demonstrate the function of DNA polymerase I, sought to show that DNA Pol 1 was capable of replicating biologically active DNA. What is the definition of biologically active DNA in this context?

Biologically active DNA is capable of supporting metabolic activities and directs reproduction of the original organism from which it was originally duplicated

The concept that genetic information passes from DNA to RNA to protein is called

CENTRAL DOGMA

This form of DNA replication was eliminated during the Meselson-Stahl experiment because the original double-helix did not appear to be preserved during cell division

Conservative replication

This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them.

DNA Ligase

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? Indicate the reason (or reasons) for your choice. A: GTATTAGAACATCTC CATAATCTTGTAGAG B: TGAGCGTTCCAGCAG ACTCGCAAGGTCGTC Mark the correct boxes below: DNA molecule A has a lower A-T content DNA molecule A DNA molecule B DNA molecule B has a higher G-C content DNA molecule A has a higher G-C content. DNA molecule A has a higher A-T content

DNA molecule B DNA molecule B has a higher G-C content DNA molecule A has a higher A-T content

What protein is responsible for the initial step in unwinding the DNA helix during replication of the bacterial chromosome?

DNAa

The Avery et al. (1944) contribution to an understanding of molecular biology was ________.

Demonstration that DNA is the genetic material in Diplococcus

In the Meselson-Stahl experiment, what hypothetical form of DNA replication results in the same DNA density distribution as the semiconservative method after the first cell division, but was not supported upon the second cell division?

Dispersive Replication

If the GC content of a DNA molecule is 60%, what are the molar percentages of the four bases (G, C, T, A)?

G = _____ %. 30 C = _____%. 30 A = _____%? 20 T = _____%? 20

Assume that the molar percentage of thymine in a double-stranded DNA is 20. What are the percentages of the three other bases (G, C, A)?

G = _____%. 30 C = _____%. 30 A = _____%. 20

The finding that virtually all organisms use the same genetic code provides the basis for declaring that the code is universal. Name one exception to such universality

Human and yeast mitochondrial DNA can sometimes use codon UGA to code for tryptophan rather than termination

Considering the types of side chains on amino acids and their relationship to protein structure, where are the amino acids with hydrophobic side chains most likely to be located?

Inside of the protein

There is some indication that the code is in some way ordered; a certain pattern exists. Name an observation that supports this view.

It has been observed that amino acids that are chemically similar share the middle base of their respective codons. Also, codons that share the same two starting nucleotides frequently encode the same amino acid.

This new strand of DNA has its 3' end oriented in the same direction as the replication fork travels.

Leading strand

Describe the function of N-formylmethionine in prokaryotes.

N-formylmethionine is a modified amino acid, which serves as the starting amino acid in protein synthesis.

In which set of molecules does the Genetic code reside?

Nucleic acids

This organic subunit is the monomer from which nucleic acid is formed.

Nucleotides

Short "bursts" of DNA synthesis on the lagging strand produce ___________.

Okazaki fragments

The bonds that connect nucleotides in the backbone of a DNA strand are called _________bonds.

Phosphodiester bonds

is seen primarily among prokaryotes where one mRNA carries coding information and internal punctuation for the translation of more than one protein

Polycistronic mRNA

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can then take over for replication.

Primase

In eukaryotes, what factors (either DNA sequences or proteins) appear to encourage the specific association of RNA polymerase(s) to a specific region of DNA?

Promoters, enhancers and transcription factors

Certain triplets (AUG) commonly signal the starting point for protein synthesis, while other triplets typically signal stop (UAA, UGA, UAG). In terms of the genetic code, what is the term for this type of signal?

Punctuation (initiation, termination). AUG (rarely GUG) for initiation; UAA, UGA, and UAG for termination

During DNA replication, what is the function of RNA primase?

RNA primase provides a free 3'-OH upon which DNA polymerization depends.

This short piece of RNA is present only transiently in a newly-synthesized DNA molecule

RNA primer

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication DNA primase

RNA primer synthesis

Referring to the genetic code, what is meant by "wobble"?

Relaxed pairing specificities in the third-base position of a codon.

the complex of proteins that is involved in the replication of DNA is called a ________

Replisome

The discovery of RNA self-splicing by T. Cech (1982) and others in Tetrahymena revealed that RNA can demonstrate autonomous catalytic properties. RNAs that undergo such splicing are often called ________.

Ribozymes

Considering the Central Dogma of Molecular Biology, what three general properties are ascribed to DNA?

Storage and expression of information, variation through mutation

As unwinding of the helix occurs during DNA replication, tension is created ahead of the replication fork. What is the term for the nature of this tension? What enzyme resolves this tension?

Supercoiling DNA Gyrase

RNA polymerase II binds to the ____________ strand of DNA and uses it to guide transcription. In contrast, the strand not used to guide transcription is called the _____________ . Separate your answers with a comma

Template stand, coding strand

Which of the following are role(s) of the 5' cap? none of the above

The cap plays a role in the removal of introns. The cap protects the RNA from degradation. The cap acts as a binding site for the ribosome.

The base content of a sample of DNA is as follows: A = 31%, G = 31%, T = 19%, and C = 19%. What conclusion can be drawn from this information?

The sample of DNA is single-stranded

Sidney Brenner argued that the code was nonoverlapping because he considered that coding restrictions would occur if it were overlapping. A second major argument against an overlapping code involved the effect of a single nucleotide change. In an overlapping code ________ adjacent amino acids would be affected by a point mutation, while in a nonoverlapping code ________ amino acid(s) would be affected. Separate the two answers with a comma in the box below.

Two, one

5'-ATATGCCCTTTATATAGTTATTTCCGTTCCCCGGGAAACTTGGCCTGCCAAA-3' 3'-TATACGGGAAATATATCAATAAAGGCAAGGGGCCCTTTGAACCGGTACGGTTT-5' What is the longest polypeptide that could be encoded by the above nucleic acid?

UNANSWERED

This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil.

a. RNA only b. DNA only c. both RNA and DNA d. neither RNA nor DNA A

The 5' cap on an mRNA is important for all the processes listed below except for the ___ of an mRNA molecule.

a. transcription b. intron removal c. stability d. initiation of translation Enter only the letter of your choice A

The 3' untranslated region affects the ___ of mRNA and the ___ of the mRNA protein-coding sequence.

a. translation c. stability

When this molecule is synthesized, both strands of a DNA molecule are used as a template. Enter only the letter of your choice.

b. DNA only

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Theta replication

bidirectional circular replication

The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___.

c. intron splicing d. protein stability

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Okazaki fragments

d. lagging strand

A procedure that is often used to separate molecules by using their molecular charges is called ________.

electrolysis

What term is used to describe genetic exchange at equivalent positions along two chromosomes with substantial DNA sequence homology?

general or homologous recombination

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication continuous synthesis

h

In eukaryotic replication, there is another fundamental level of complexity because of what proteins?

histones

A(n) ________ is a section of an RNA that gets spliced out

intron

The code is nonoverlapping, meaning that, assuming "standard translation" a given base participates in the specification of _________ amino acid(s

one

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication DNA ligase

phosphodiester bonds at DNA nicks

Hershey and chase labeled DNA using this radioactive atom

phosphorus

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins?

polymerase II

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

promoter

Present two forms of post-translational modification of protein

proteolytic cleavage, chemical modification, folding

Name the pyrimidines and the purines in DNA

pyrimidines: T/C purines: A/G

List 3 requirements of any substance that is "genetic material"

replication, storage, expression

Uridine contains __________ as sugar

ribose

This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the "parental" double helix to form two templates

semiconservative replication

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication DNA Gyrase

supercoil removal

Of the following three types of nucleic acids-DNA, mRNA, tRNA-which is most likely to contain modified bases?

tRNA

This term describes the sequence of nucleotides that direct the formation of a new nucleic acid strand.

template

A base at the first position of an anticodon on the tRNA would pair with a base at the ________ position of the mRNA

third

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Rolling-circle replication

unidirectional replication