Molecular genetics II

How are DNA and RNA different?

(1) the sugar in RNA is ribose not dioxyribose (2) RNA is generally single-stranded and not double-stranded (3) RNA contains uracil in place of thymine.

Transcription

(genetics) the organic process where the DNA sequence in a gene is copied into mRNA

mRNA

(messenger) Makes "copy" of DNA/gene and takes into ribosomes. - type of RNA conveys DNA's genetic message in the form of an RNA transcript/complementary strand

How are DNA and RNA similar?

1. Structure because they both have: a sugar-phosphate backbone, and nitrogen base rungs- basically both made of nucleotides. 2. function because they both perform: protein synthesis. 3. Like DNA, RNA is made up of a 5-carbon surgar, a phosphate group, and a nitrogenous base.

Assume the DNA sequence below serves as a template during transcription. What would be the RNA sequence produced?3' - TACCGCACCTACGCGGAGGACGGGGACGACCGCGACGACATC - 5'

5' -AUG-GCG-UGG-AUG-CGC-CUC-CUC-CCC-CUG- CUG- GCG-CUG-UAG - 3'

Template

DNA replication each strand of the duplex acts as a template for the synthesis of a new double helix.

What does the process of transcription do? Why is it called "transcription?"

DNA---->RNA The information in DNA is transcribed—or summarized—into a smaller version (RNA) that can be used by the cell.

What effect does the polarity of strands of nucleic acids have on how transcription occurs?

The direction of strands

How do codons and anticondons relate to each other? How do they relate to theoverall process of protein synthesis?

The genetic code describes the relationship between the sequence of DNA bases (A, C, G, and T) in a gene and the corresponding protein sequence that it encodes. The cell reads the sequence of the gene in groups of three bases.

Translation

Process by which mRNA is decoded and a protein is produced

What does the process of translation do? Why is it called "translation?"

RNA-----> Protien. After DNA is transcribed into a messenger RNA (mRNA) molecule during transcription, the mRNA must be translated to produce a protein.

Assuming the entire RNA molecule coded for by the DNA sequence in #8 above is translated, whatis the polypeptide (amino acid sequence) coded for by this RNA molecule?

UAC- CGC-ACC-UAC-GCG-GAG-GAG-GGG-GAC-GAC-CGC-GAC-AUG

What is a ribosome and what does it do?

a minute particle consisting of RNA and associated proteins found in large numbers in the cytoplasm of living cells. -They bind messenger RNA and transfer RNA to synthesize polypeptides and proteins. -work together to produce proteins.

Promoter

a region of a DNA molecule which forms the site at which transcription of a gene starts

Termination sequence

a section of nucleic acid sequence that marks the end of a gene or operon in genomic DNAduring transcription.

What are codons?

a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.

What are introns?

are noncoding sections of an RNA transcript, or the DNA encoding it, that are spliced out before the RNA molecule is translated into a protein

What is an anticodon?

complementary to mRNa condons are located tRNA molecules which bring the correct amnio acid to the growing polypeptide chain during translation

RNA polymerase

is an enzyme that is responsible for copying a DNA sequence into an RNAsequence, duyring the process of transcription.

What is the genetic code? How does it relate to information storage in nucleic acid molecules?

The collection of all 64 possible mRNA condons is known as this and is common to all organisms They form specific pairs with one another that are stabilized by hydrogen bonds. The base pairing results in the formation of a double helix, a helical structure consisting of two strands.

Three types of RNA were discussed as playing a role in the overall process of protein synthesis

mRNA, rRNA, tRNA

DNA strand

nucleotides are linked into chains, with the phosphate and sugar groups alternating.

Non-template DNA strand

the coding strand because its sequence will be the same as that of the new RNA molecule.

tRNA

transports a particular amino acid to ribosome -the fundamental building blocks of a protein

How does the near universality (i.e., a few prokaryotic species use a slightly modified version) of thegenetic code suggest for the evolutionary relatedness of all life?

It suggests that it is evidence for the common origin of life on Earth....Many species today likely evolved from an ancestral organism in which the genetic code was a present.

rRNA

Make up ribosomes along with protein

How can removal of introns affect how the information in a gene is read?

Must remove in order for the mRNA to encode a protein with the right sequence.

What are exons?

The sections of DNA (or RNA) that code for proteins

What is the central dogma of molecular biology? What is so "central" about it?

The two-step process, transcription and translation, by which the information in genes flows into proteins: DNA → RNA → protein. Transcription is the synthesis of an RNA copy of a segment of DNA. -DNA contains instructions for making a protein, which are copied by RNA. RNA then uses the instructions to make a protein.

What processes are involved?

Transcription and Translation