Past Exam Review
c
A deletion in an operon removes the promoter. How will that affect the transcript that is produced from the operon? a. The transcript will be produced, but contain a deletion b. The transcript will be produced, but longer than normal c. The transcript will not be produced. d. The transcript will be produced and normal in length e. the transcript will be produced, but shorter than normal
b
A histone variant is usually found at the +1 position of a transcriptional start site. What would be a useful characteristic of this histone? a. The histone variant associates with other nucleosomes to create nucleosome clusters b. The histone variant is not tightly bound to the DNA, making it easier to remove c. The histone variant stabilizes the nucleosome
b
A particular gene has a mutation in its NFR that causes it to bind abnormally tightly to histones. What effect would you expect this mutation has on the expression of this gene? a. The promoter of the gene will be constantly available to transcription factors and RNA polymerase b. The expression of the gene would be abnormally low or absent c. The expression of the gene would be abnormally high d. The effect on gene expression is impossible to predict e. The gene would encode a different protein instead
b
A researcher has discovered a new compound that appears to affect the amount of HIV that they obtain from infecting cells. When cells are treated with the drug and then infected there are proviruses in the nuclear genome and viral RNA in the cytoplasm but no virus particles form. What is the most likely protein that the drug inhibits? a. integrase b. gag proteins c. reverse transcriptase d. spike protein
b
A tRNA's anticodon is 3'-GGC-5'. What amino acid is attached to it? a. glycine b. proline c. alanine d. arginine
a
AZT is an HIV drug. AZT is a reverse transcriptase inhibitor. That means AZT is only effective during the _____________ stage of the viral life cyle a. integration b. release c. entry d. viral assembly
D
Abnormal levels of miRNAs are associated with nearly all forms of what type of human disease? A. Gastrointestinal B. Cardiovascular C. Cancer D. Neurological disorders
c
According to Chargaff's rule, if the DNA of a species contains 30% adenine, what percent of guanine will it contain? a. 75% b. 50% c. 20% d. 30%
a
An activator is present and results in the increase in transcription of the target gene. This is an example of _________________ a. positive control b. feedback inhibition c. negative control d. termination
False
Bacteriophage lambda is an example of a virulent phage: True/False
b
CpG islands are associated with which of the following? a. cAMP pathway b. DNA methylation c. Nucleosome location d. Steroid hormone activity
c
How many promoters are in an operon? a. one for each gene in the operon b. 2 c. 1 d. 3
c
Long terminal repeats are unique to which group of transposons? a. Repetitive Transposon b. Insertion sequence c. LTR transposon d. Non-LTR transposon e. Simple transposon
a
Many scientists and drug companies have worked hard to produce drugs to stop various stages of the HIV life cycle. Some drugs have been tested that inhibit the function of Vpu. What stage of the HIV life cycle would such a drug inhibit? a. Virus budding b. Synthesis of double stranded DNA c. Virus assembly d. Integration of the host chromosome
b
Mice with a paramutagenic allele of the kit gene (here called kit') have white feet and white spots on their tails. Mice with the paramutable kit allele have brown feet and a brown tail. If you cross mice that are homozygous for the paramutagenic allele with those that are homozygous for the paramutable allele, what will be the phenotype of the progeny? Assume that the kit' allele is very stable and very paramutagenic. a. Mice will be in a 3:1 ratio of white feet and white spots on their tails : brown feet and brown tails b. All mice will have white feet and white spots on their tails c. All mice will have brown feet and tails
d
Reverse transcriptase copies __________ a. DNA to DNA b. DNA to RNA c. RNA to RNA d. RNA to DNA
b
Ribozymes are RNA molecules with what type of activity? a. binding b. catalytic c. decoy d. protease
b
Royal jelly contains phenyl butyrate. Phenyl butyrate is a histone deacetylase inhibitor. What do you expect to find if you look at the histones of worker bees? a. The histones of worker bees are acetylated b. The histones of worker bees are not acetylated
d
SmY RNAs are a family of ncRNAs in nematodes that are thought to be involved in a special type of RNA splicing. Based on this function, SmY RNA's are most likely members of which category of ncRNAs? a. snoRNA b. siRNA c. tRNA d. snRNA
b
The correct order of compaction from least compacted to most compacted would be______________ a. naked DNA, metaphase chromosome, loop domain, 30-nm fiber, nucleosome b. Naked DNA, nucleosome, 30-nm fiber, loop domain, metaphase chromosome c. naked DNA, loop domain, 30 nm fiber, nucleosome, metaphase chromosome
B
The crispr-cas system in bacteria is most similar to what system in vertebrates? A. Circulatory B. Immune system C. Nervous system D. Digestive system
negative
The lac operon is under ____________ control
c
What is the role of TFIID? a. TFIID plays a role in ribosomal binding, and participates in Translation regulation b. TFIID in an activator protein, and binds to the enhancer region, turning transcription on c. TFIID binds to the TATA box, and is necessary for the recruitment of RNA polymerase d. TFIID is a mediator, it facilitates interactions between multiple transcription factors, but does not bind DNA directly
clamp loader
What is the role of the beta subunit in the DNA polymerase III holoenzyme?
b
You are working in a lab that studies tobacco mosaic virus (TMV). You wish to perform follow up experiments to the Fraenkel-Conrat/Singer experiments. You use the Holmes ribgrass (HR) strain of TMV that they used, which produces streaks along the veins and contains histidine and methionine in the TMV capsid protein. You also use a second TMV strain that you've isolated, called Purp, that causes purple lesions on the leaves, and lacks histidine and methionine in the TMV capsid protein. If you use Purp RNA and HR proteins to create reconstituted viruses, what lesions do you expect will form, and what will the amino acid composition of the capsid protein be? a. Purple lesions, histidine and methionine in the capsid protein b. purple lesions, no histidine and methionine in the capsid protein c. streaks on the veins, no histidine and methionine in the capsid protein d. streaks on the veins, histidine and methionine in the capsid protein
c
You perform a cell free translation experiment like Nirenberg and Matthaei, what percentage of your codons would be 5'-CGG-3' if you used a mixture of 40%G, 40%C and 20%U? a. 8% b. 4% c. 6.4% d. 3.2% 3. 1.6%
a
A bacterial ncRNA called OxyS regulates translation by binding to the Shine Dalgarno sequence, which prevents ribosome binding. What is the function of this ncRNA? a. blocker b. scaffold c. ribozyme d. decoy
d
An enormous variety of genomic structures can be seen among viruses, with a given virus having either a DNA or an RNA genome. The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Based on this information equine influenza is a ____________ virus. a. double stranded RNA b. double stranded DNA c. single stranded DNA d. single stranded RNA
c
An enzyme catalyzes a substrate into a final product. When the concentration of the final product is high enough, it binds to a regulatory site on the enzyme. This binding at the regulatory site changes the shape of the enzyme, which prevents it from binding the substrate and prevents formation of more final product. This is an example of a/an ___________ a. methylation b. translational repressor c. feedback inhibition d. posttranslational modification
c
Genomic imprinting is a result of _________ a. serine to leucine changes in the genetic code b. nucleosome location c. DNA methylation d. histone activation
b
Insertion sequences can be identified by which of the following? a. Presence of a reverse transcriptase enzyme b. Presence of inverted repeats at the end of the sequence c. High level of mutation d. Presence of an integrase enzyme
B
Into which gene of the CRISPR-Cas system are fragments of bacteriophage DNA inserted? A. Cas2 B. Crispr C. Cas1 D. Tracr E. Cas9
a
Plays a role in chromosome condensation by binding to chromosomes and compacting the radial loops a. condensin b. cohesin
d
Small regulatory RNAs and long regulatory RNAs are categories of what? a. CRISPR-cas system b. histone modifying complexes c. mRNAs d. ncRNAs
d
T2 phage __________ was labeled using the radioisotope 32P in the Hershey-Chase experiments a. protein b. RNA c. carbohydrates d. DNA
false
The HIV genome contains nine genes and therefore encodes just nine proteins true or false
b
The Pfizer and Moderna vaccines are what type? a. protein subunit b. RNA c. whole inactivated virus d. DNA
b
The backbone of the DNA molecule is formed by ____________. a. nitrogenous bases b. phosphodiester bonds c. peptide bonds d. ribose sugars
c
The signal to activate the CREB protein uses what type of system? a. Primary messenger system b. Operon system c. Secondary messenger system d. Binding of receptor to gene regulatory region
positive
The trp operon is under ______________ control
false
True/False: 61 different tRNAs are required for translation
true
True/False: Combinatorial control is a system of gene regulation that allows eukaryotes to use a variety of gene expression control methods simultaneously
false
True/False: DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration
false
True/False: In arabadopsis, the FLC gene is necessary to promote flower development
true
True/False: Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling
true
True/False: Repressor proteins are responsible for negative transcriptional regulation
true
True/False: The 30-nm fiber formed from arrays of nucleosomes
true
True/False: The deletion of a single nucleotide in the coding region of a gene will result in a frame-shift mutation
a
True/False: The majority of bacterial DNA is negatively supercoiled
true
True/False: The result of the movement of most TE's appear to be silent producing no phenotypic effect
c
What is unusual about the 5' cap found on almost all eukaryotic mRNAs? a. the nucleotide added is an adenine methylated at N7 and the bond is typical phosphodiester bond with the terminal nucleotide b. The nucleotide added is a guanine methylated at N7 and the bond is a typical phosphodiester bond with the terminal nucleotide c. The nucleotide added is a guanine methylated at N7 and the bond is created between the phosphate group on the guanine and the phosphate on the terminal nucleotide d. The nucleotide added is an adenine methylated at N7 and the bond is created between the phosphate group on the guanine and the phosphate on the terminal nucleotide
a
What piece of the RNA HIV genome is used as a primer during the synthesis of double-stranded DNA from HIV RNA? a. PPT b. U3 c. tRNA d. gag
b
What types of amino acids are most responsible for the binding of histones to DNA? a. Negatively charged amino acids b. Positively charged amino acids c. Polar amino acids d. Hydrophobic amino acids
c
With which injection did Mello and Fire observe the lowest amount of mex-3 probe staining? a. uninjected b. injected with mex-3 antisense RNA c. Injected with double stranded RNA
d
Antisense RNA does which of the following? a. prevents the correct folding of a newly formed peptide b. inhibits the formation of the open complex in transcription c. occupies the A and P sites of the ribosome d. Binds to the mRNA and prevents translation
a
Following mitosis, the two daughter cells usually have ____________ pattern of facultative heterochromatin and __________________ patter of constitutive heterochromatin as was present in the mother cell a. the same; the same b. a different; a different c. the same; a different d. a different; the same
a
Functionally, how does methylation alter gene expression? a. Methylated cytosines are found in the major groove, and interfere with the binding of transcription factors b. Methylated guanines are found in the major groove and promote transcription factor binding c. Methylated cytosines interact with histones and prevent chromatin remodeling d. Methylated guanines create supercoiled DNA
d
Histone acetyltransferases are directly involved in which of the following? a. movement of nucleosomes b. termination of gene expression c. insertion of variant histone proteins d. chemical modification of histones e. Removal of histones from chromatin
d
How does DNA differ from RNA? a. RNA has multiple bases attached to the sugar b. RNA contains different sized phosphate grous c. RNA uses only purines d. RNA uses a different five carbon sugar
a
How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3' a. 8 b. 13 c. 10 d. 7
d
In order of their occurrence what are the steps in RNA interference? a. Processing of RNA transcript by Drosha and DGCR8, processing by Dicer, transport to cytoplasm, binding to proteins to form a RISC, binding to target mRNA b. Processing of RNA transcript by Drosha and DGCR8, binding to proteins to form a RISC, transport to cytoplasm, processing by Dicer, binding to target mRNA c. Processing by Dicer, processing of RNA transcript by Drosha and DGCR8, transport to cytoplasm, binding to proteins to form a RISC, binding to target mRNA d. Processing of RNA transcript by Drosha and DGCR8, transport to cytoplasm, processing by Dicer, binding to proteins to form a RISC, binding to target mRNA
false
True/False: Negative sense RNA is the viral form of RNA that most resembles mRNA
true
True/False: Transcription and translation may occur simultaneously in prokaryotic cells
true
True/False; The regulation of the CAP complex using cAMP is an example of inducible genetic regulation
expressed
Under normal conditions the genes of the trp operon are ___________________
Not expressed
Under normal conditions, the genes of the lac operon are _____________
d
Viral DNA that has been integrated into the chromosome of a eukaryotic host cell is known as a a. virulent phage b. prophage c. episome d. provirus
b
What activates CREB? a. Binding to GRE b. Phosphorylation c. Lowering of cAMP concentration d. Binding of cAMP e. Dimerization
c
What causes the black color of urine in alkoptonuria? a. Build up of phenylalanine b. build up of tyrosine c. build up of homogentisic acid
c
What enzyme is responsible for the movement of transposons? a. remodelase b. duplicase c. transposase d. transversease
a
What hypothesis was developed from the work with bread mold of Beadle and Tatum? a. One gene/ one enzyme b. Patterns of inheritance c. Relationship between DNA and polypeptide sequence d. Inborn errors of metabolism
a
What is found at the 3' carbon of a DNA nucleotide? a. OH b. H c. P d. CH2
c
What is the relationship between glucose and cAMP? a. high cAMP increases the import of glucose into the cell b. There is no relationship between glucose and cAMP c. High glucose results in low cAMP d. High glucose results in high cAMP
c
What is true according the the adaptor hypothesis? a. the anticodon and amino acid have no relationship b. a given tRNA can carry any of the 20 amino acids c. The position of an amino acid within a polypeptide is determined by the binding of mRNA with a tRNA carrying a specific amino acid d. An amino acid recognizes the codon in mRNA
e
What typically terminates the process of translation? a. Rho proteins b. Introns c. Aminacyl tRNA synthase d. rRNA e. Stop codons
a
Which gene encodes for proteins used for viral assembly and capsid formation? a. gag b. env c. Vif and Vpu d. pol e. Vpr
b
If a cell is fused with another cell, which of the following would be the best example of trans-mechanism of epigenetic control? a. A gene that is originally silenced in one cell but expressed in the other is still expressed in the hybrid b. A gene that is originally silenced in one cell but expressed in the other is silenced by the hybrid c. There are no examples that could conform to a trans-mechanism d. the methylation pattern of the same gene from either cell is not altered
c
In numerous studies that investigate gene expression, the mRNA levels of proteins are examined. If one is interested in the amount of protein being produced, is this the best approach to use? a. No, examining the transport of mRNA from the nucleus would provide more reliable data since mRNA must be transported to the cytoplasm for translation b. Yes, this the best approach because all mRNA is eventually translated into protein c. No, directly determining the amount of protein produced would be best because many steps are involved in regulating protein levels d. No, examining mRNA processing would be more reliable since that is the limiting step for protein production
paternal
In the igf-2 allele, the paternal chromosome is imprinted, in the offspring which allele is expressed?
a
Infectious mononucleosis is caused by the Epstein-Barr virus, and patients often exhibit a fever, sore throat, swollen glands, and fatigue for several weeks. In some patients, the virus can reactivate later and cause physical symptoms once again. This is likely because __________. a. the virus was latent in these patients, and then switched to the active form and began making new virus particles b. they were misdiagnosed the first time, and only really were infected by the virus the second time they became sick c. the patients had the virus initially, and they became sick again at the time the virus became latent d. the Epstein-Barr virus is an emerging virus so we do not know much about its infectious life cycle
a
One strand of DNA is 5'-AGGCCTTA-3'. What is the sequence of the opposite strand? a. 3'-TCCGGAAT-5' b. 3'-AGGCCTTA-5' c. 5'-TCCGGAAT-3' d. 5'-AGGCCTTA-3'
A
PiRNA sequences are complementary to______________ A. RNA from a transposable element B. The crispr gene C. Bacteriophage DNA D. Another RNA with the piRISC
b
Plays a role in sister chromatid alignment by binding along the arms of sister chromatids and cohering (sticking) them together a. condensin b. cohesin
a
Prior to secretion, proteins must first be targeted to the endoplasmic reticulum in eukaryotes. What RNA-protein complex plays an integral role in this targeting process? a. SRP b. snoRNP c. snRNA d. siRNA
false
The function of PIWI proteins is to enhance the insertion of transposable elements, allowing them to be passed from parent to offspring
false
The lac operon has 3 operator sites. These sites are redundant, and only one is necessary for the repression of the lac operon
a
The major and minor grooves are features of what DNA structure a. double helix b. 30 nm fiber c. during stem loop formation d. nucleosomes
d
The majority of nonrepetitive genes in an organism are found in which of the following? a. None of these choices are correct b. Moderately repetitive sequences c. Highly repetitive sequences d. Unique sequences
d
The ncRNA HOTAIR recruits what type of proteins to target genes? a. histone acetyltransferase b. RNA polymerase c. Transcription factors d. Histone-modifying complexes
b
The peptidyl transferase is a component of ___________ a. mRNA b. the ribosome c. tRNA d. DNA e. the protein being translated
b
The zig-zag model is associated with the _____________ level of DNA organization a. beads-on-a-string b. 30 nm fiber c. scaffoldprotein d. 11-nm fiber e. histone
false
True/False: In bacteria, the most common way gene regulation occurs is by post-translational modifications
d
When phage lambda enters the lytic cycle: a. many new copies of the phage genetic material and coat proteins are assembled to make new phages. The host cell remains intact b. it immediately lyses the host cells without producing any new viruses c. the genetic material of the phage is integrated into the chromosome of the bacterium d. many new copies of the phage genetic material and coat proteins are assembled to make new phages. The host cell is lysed
b
Which is the order of steps in a viral reproductive cycle. a. Entry, integration, synthesis of viral components, viral assembly, viral release b. attachment, entry, integration, synthesis of viral components, viral assembly, viral release c. attachment, entry, integration, viral assembly, synthesis of viral components, viral release d. entry, integration, attachment, synthesis of viral components, viral assembly, viral release
a
Which of the following are molecular mechanisms used in epigenetic gene regulation? a. All of these choices are correct b. Covalent histone modification c. Chromatin remodeling d. DNA methylation
d
Which of the following is NOT a reason for high fidelity of DNA synthesis of DNA Pol III? a. The DNA polymerase has exonuclease function b. The hydrogen bonding between purines and pyrimidines is stable c. The DNA polymerase is unlikely to form bonds between nucleotides if they are mismatched d. The DNA polymerase has the ability to change the structure of the base in order to form the correct bond
b
Which of the following is an example of a primate-specific transposable element? a. Mu b. Alu c. TMV d. RNA
b
Which of the following recognizes response elements, control elements, and regulatory elements? a. general transcription factors b. regulatory transcription factors c. mediator d. Transactivation domains
b
X-chromosome inactivation is necessary because: a. Only a single copy of sex-specific genes are required b. The x-chromosome contains large amount of non-sex specific genes, and males and females are adapted to having these gene products at similar levels c. x-chromosomes are large, and take up too much space in the nucleus if one is not compacted d. The x chromosome contains female specific genes, and needs to be silenced in males
d
You are working in a lab that studies ncRNAs. You develop an assay to isolate ncRNAs and any associated molecules. You must then identify the molecules you have isolated. You find a molecule that is associated with an ncRNA that is not changed by protease, RNase, or DNase. The associated molecule is most likely ____________ a. a protein b. DNA c. an mRNA d. a small molecule